ID: 1147951403

View in Genome Browser
Species Human (GRCh38)
Location 17:44109942-44109964
Sequence CCGCTCCTTCCCTCACTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 605
Summary {0: 1, 1: 0, 2: 2, 3: 60, 4: 542}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147951403_1147951408 -9 Left 1147951403 17:44109942-44109964 CCTGGGAGTGAGGGAAGGAGCGG 0: 1
1: 0
2: 2
3: 60
4: 542
Right 1147951408 17:44109956-44109978 AAGGAGCGGCCCAGCTCTGGGGG 0: 1
1: 0
2: 0
3: 16
4: 177
1147951403_1147951407 -10 Left 1147951403 17:44109942-44109964 CCTGGGAGTGAGGGAAGGAGCGG 0: 1
1: 0
2: 2
3: 60
4: 542
Right 1147951407 17:44109955-44109977 GAAGGAGCGGCCCAGCTCTGGGG 0: 1
1: 0
2: 0
3: 24
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147951403 Original CRISPR CCGCTCCTTCCCTCACTCCC AGG (reversed) Intronic
900611782 1:3547315-3547337 CGGGTCCCTCCCTCGCTCCCAGG + Intronic
901237898 1:7677325-7677347 CAGCTCCTGCCCTCACTCGGAGG + Intronic
901447737 1:9318474-9318496 ACCCTCCTTCCTCCACTCCCAGG + Intronic
902134415 1:14292533-14292555 CTGCACCTGCCTTCACTCCCTGG - Intergenic
902375092 1:16026813-16026835 AAGCTCCTCCCCTCACACCCTGG + Intronic
902380061 1:16048619-16048641 AAGCTCCTCCCCTCACACCCTGG + Intronic
902820872 1:18942413-18942435 CCGCTCCCTCCCTCCTGCCCTGG - Intronic
903180761 1:21603698-21603720 CCACTCCATCCCGCACGCCCTGG + Intronic
903270065 1:22182604-22182626 CCGCTCCTGCCCTTCCTCCAGGG - Intergenic
903324878 1:22563882-22563904 CCGCTCTGTCCCTTAATCCCGGG - Intronic
903353267 1:22730881-22730903 CTGCTCTGTCCCTCACTCTCTGG - Intronic
903562933 1:24242246-24242268 CCTCTCCTTCCCTCACTGTCTGG + Intergenic
903566100 1:24266832-24266854 TCCCTCCCTCCCTCCCTCCCGGG - Intergenic
903670742 1:25034087-25034109 CCGCTCCTTCGTTCCCTCCCAGG + Intergenic
904577268 1:31513059-31513081 TCCCTTCTTCCCTCTCTCCCAGG + Intergenic
905044537 1:34985359-34985381 CGGCTCATTTCCTCCCTCCCCGG + Intronic
905387647 1:37615250-37615272 TCCCTCCTTCCTTCCCTCCCTGG + Intronic
905774641 1:40660753-40660775 CCCCTCCCTCCCTACCTCCCGGG - Intronic
905815748 1:40949436-40949458 TCCCTCCTTACCTCACTCCCTGG - Intergenic
905868979 1:41392097-41392119 CCGTTCCTTCTCGCACACCCAGG - Intergenic
906344149 1:45004776-45004798 CCATTCCTTCCATCACTTCCAGG + Exonic
906587461 1:46991977-46991999 CCGCTCCTCTCCCCACTCCCAGG + Intergenic
908209689 1:61887552-61887574 AAGCTCATTCTCTCACTCCCTGG - Intronic
908680465 1:66655246-66655268 CCTCTCCTTCCACTACTCCCTGG + Intronic
908831646 1:68185012-68185034 CCGCTCCTTCCATCACACCTGGG - Intronic
909485138 1:76164255-76164277 CAGCTCTTTCCCTCTCTCCTTGG - Intronic
910573897 1:88737068-88737090 CCACCCCTTCCCTCAACCCCAGG - Intronic
910981161 1:92961278-92961300 CCGCTCCCCTCCTCCCTCCCTGG - Intronic
911044389 1:93616786-93616808 CCCCTCCCTTCCTCAGTCCCTGG - Intronic
911514599 1:98851835-98851857 CCTCTCCAGCCCTCCCTCCCAGG + Intergenic
912801596 1:112722950-112722972 CCGCTCCCTCCCGCCCACCCGGG - Intronic
913329184 1:117653169-117653191 CCGCTCCTCCCCTGGCTCCTAGG - Intergenic
913684337 1:121216882-121216904 ACCCTTCTTCCCTCCCTCCCAGG - Intronic
914036176 1:144004497-144004519 ACCCTTCTTCCCTCCCTCCCAGG - Intergenic
914153282 1:145063448-145063470 ACCCTTCTTCCCTCCCTCCCAGG + Intronic
915142274 1:153775162-153775184 TCGCGCCTTCCCTGAATCCCAGG - Intronic
915283475 1:154838295-154838317 TAGCTCCTTCCCCTACTCCCGGG + Intronic
915446145 1:155976088-155976110 CCATTCCTTGCCTCATTCCCTGG - Intronic
916059644 1:161089670-161089692 TCCCTCCTTCCCTCCCTCCCTGG - Intergenic
917804193 1:178598554-178598576 CTGCTCCTCCCCTGGCTCCCAGG - Intergenic
918040686 1:180912571-180912593 CAGCTCCTGCCCGCGCTCCCCGG + Intergenic
918045989 1:180941306-180941328 CCGCTACTGGCTTCACTCCCTGG - Intronic
918067786 1:181113219-181113241 CCTCTGCTTCCCACCCTCCCTGG + Intergenic
919872122 1:201829583-201829605 ACCCTCCCTCCCCCACTCCCAGG - Intronic
920094968 1:203480688-203480710 CCTCCCCTTCCCTCAGCCCCAGG - Intronic
920180048 1:204127034-204127056 CCTCCCCTTCACTCCCTCCCTGG + Exonic
920471645 1:206235395-206235417 ACCCTTCTTCCCTCCCTCCCAGG - Intronic
920674385 1:208029212-208029234 CCTCTCCTTCCATTTCTCCCAGG - Intronic
920698718 1:208201586-208201608 CCACTTCTTCCCTGGCTCCCTGG - Intronic
920902684 1:210127252-210127274 CCATTCTTACCCTCACTCCCAGG + Intronic
921191098 1:212709293-212709315 CCTCTCCTTCCCTGTCTCCAAGG + Intergenic
922322811 1:224503035-224503057 TCCCTCCCTCCCTCCCTCCCCGG - Intronic
922955276 1:229594177-229594199 CCCCTCCTCCCCTCTCTCCTGGG - Exonic
923519670 1:234725899-234725921 CCAGTCCTTCCCTGCCTCCCCGG + Intergenic
924350579 1:243110623-243110645 CCTCTCTTTCCCTCCATCCCTGG + Intergenic
1062907358 10:1187753-1187775 CAGCTCCTTCCTTCTGTCCCCGG - Intronic
1062922817 10:1292939-1292961 TCTCTCCTTCCCTCTCTCCATGG - Intronic
1063236118 10:4118147-4118169 CAACTCCTCTCCTCACTCCCAGG - Intergenic
1064706967 10:18083100-18083122 TCTCTGCTTCTCTCACTCCCAGG + Intergenic
1065282330 10:24152063-24152085 CCGCTCCCTCCCTCCCTGCATGG + Intronic
1065961991 10:30741154-30741176 CAGATGTTTCCCTCACTCCCTGG - Intergenic
1066443908 10:35464453-35464475 CCACTCCTTCAGTAACTCCCTGG + Intronic
1067142091 10:43666612-43666634 CCCATCCCTCCTTCACTCCCTGG + Intergenic
1067330298 10:45309425-45309447 CCAAACCTTCCCTGACTCCCTGG + Intronic
1067669607 10:48306928-48306950 GCGCTCCCGCCCCCACTCCCAGG - Intronic
1067703837 10:48592523-48592545 CCGCTTCTCCCCTCCCTCACCGG + Intronic
1069948319 10:72002309-72002331 CTTCTCCTTCCCTCCCTTCCAGG - Intronic
1070353019 10:75611527-75611549 CCCCTCCTCCCCTCAGCCCCAGG + Intronic
1070553789 10:77512935-77512957 CCACTCCTGCCCTTACTCCCTGG + Intronic
1072636900 10:97184302-97184324 CTCCTCCTTCCCACACTCCTCGG - Intronic
1072660394 10:97360272-97360294 CAGCTCCTTCCCACCCGCCCAGG - Intronic
1073281413 10:102357129-102357151 CCACTCCTTCCTTAACTCCAAGG + Intronic
1074274633 10:111989603-111989625 CCTTTCCTCCCCTCTCTCCCGGG - Intergenic
1074857243 10:117482437-117482459 GCCCTCCCTCCCTCCCTCCCTGG - Intergenic
1075162569 10:120037444-120037466 TCCCTCCTTCCCTCTCTACCAGG - Intergenic
1075275193 10:121086703-121086725 CGGCTGCTTCCCTCTCACCCAGG + Intergenic
1076461271 10:130649073-130649095 TCGCTCCTTCGCTCTGTCCCTGG - Intergenic
1076721925 10:132396745-132396767 CTGCGCCCTCCCTCCCTCCCCGG - Intergenic
1076911857 10:133394379-133394401 CCTCTGCTTCCCTCCCACCCCGG + Intronic
1077177261 11:1196536-1196558 CCGCTGCATCTCCCACTCCCAGG + Intronic
1077264685 11:1642819-1642841 TCCCTCCTTCCCTCCCTCCCAGG + Intergenic
1077390131 11:2297019-2297041 CCGCACCTTCCCTCCCACCCTGG + Intronic
1077476142 11:2791527-2791549 CCGAGCCTCCCCTCCCTCCCGGG + Intronic
1077478135 11:2800533-2800555 AGGCCCCTTCCCCCACTCCCTGG - Intronic
1077945597 11:6894303-6894325 ACACTCCTTTCCTCACTTCCTGG + Intergenic
1078057247 11:8018657-8018679 CTACTCCCTCCCTCTCTCCCGGG - Intergenic
1078131068 11:8614640-8614662 CTGCTCCCTCTCTCACTCCATGG - Exonic
1079094975 11:17504286-17504308 CAGCCCCTTCCCTCTCTCCTAGG + Intronic
1079126001 11:17719343-17719365 TCGCTCCCTCCCTCCCTGCCCGG + Intergenic
1079444656 11:20547758-20547780 CCTCTCCCTCCCTCTCTCCACGG + Intergenic
1079553236 11:21727270-21727292 TAGCACCTTCCCTCACTCTCTGG + Intergenic
1080639867 11:34152375-34152397 CCGCCCCCTGCCTCACACCCGGG + Exonic
1081686427 11:45046432-45046454 CCGCGCCCGTCCTCACTCCCAGG - Intergenic
1082807557 11:57460473-57460495 CCACTCCTTCCCGCACTCGCTGG - Intergenic
1082810107 11:57474463-57474485 GCACTCCCTCCCTCACTGCCTGG - Intronic
1082811800 11:57482921-57482943 CTGCTCACTCCCCCACTCCCCGG - Intergenic
1083679188 11:64343485-64343507 CTGACCCTTCCCTCACCCCCAGG + Exonic
1083727016 11:64633972-64633994 ATGCTCCTTCCTTCACACCCTGG + Intronic
1083827618 11:65212178-65212200 CCCCTCCTTCCCAACCTCCCAGG - Intergenic
1083864296 11:65445413-65445435 CGCCTCCCTCCCTCCCTCCCAGG - Intergenic
1084096532 11:66915139-66915161 ACCCTCCCTCCCTCCCTCCCTGG - Intronic
1084179539 11:67439521-67439543 CCACTCCCTCCCTGACTGCCTGG + Intronic
1084190957 11:67498530-67498552 CCGCTCCCTGCCCCGCTCCCTGG + Intronic
1084385186 11:68839349-68839371 CCGCCCCTTCCCCCAAGCCCCGG + Intronic
1084401105 11:68943458-68943480 CTGCTCCTGCCCTCAGCCCCAGG + Intergenic
1084858680 11:72004515-72004537 CCTCTCTTTCCCTCTCTCCAAGG - Intronic
1085275005 11:75292712-75292734 TCGCTCCTTCCAGCAGTCCCTGG - Intronic
1085296239 11:75433299-75433321 CCTTTCTTTCCCTCCCTCCCAGG - Intergenic
1085522220 11:77145557-77145579 CCGCTCCCTGCCTCTGTCCCAGG - Intronic
1087970219 11:104471765-104471787 TCCCTCCTTCCCTCAAGCCCTGG - Intergenic
1088022828 11:105140302-105140324 CCTTTCCTTCCATCAGTCCCTGG + Intergenic
1088585439 11:111356642-111356664 CCCTTCCTTCCTTCATTCCCGGG + Intronic
1088906258 11:114157553-114157575 CCGCTCGTTCCCTGCCTGCCTGG + Intronic
1089175768 11:116547837-116547859 CCACCCCCTCCCTCTCTCCCTGG + Intergenic
1089178909 11:116567414-116567436 CTTCTCCTTCCCTCCCACCCCGG - Intergenic
1089335899 11:117723819-117723841 CCCATCATTCCCTCCCTCCCAGG - Intronic
1089579303 11:119471436-119471458 CCCTTTCCTCCCTCACTCCCAGG + Intergenic
1089612485 11:119677288-119677310 CTGCTCCTTCCATCCCTTCCTGG - Intronic
1090075160 11:123576048-123576070 CCCCTCCTGCCCACACTCGCTGG + Intronic
1090367903 11:126223151-126223173 CAGCCCCCTCCCTCACTCGCTGG - Intronic
1090522985 11:127498591-127498613 CAGCTCTTTCCCTGACTACCTGG + Intergenic
1090718669 11:129452977-129452999 CCTCTCCTCCCCTGAATCCCCGG + Intergenic
1090916188 11:131165130-131165152 CCCCTCTGTCCCTCAGTCCCTGG + Intergenic
1090938379 11:131365631-131365653 CCCCTTCCTCCCTCACTCACAGG + Intergenic
1091010676 11:131997964-131997986 CCGCCCCTCCCCTCACTCCCTGG + Intronic
1091084983 11:132712795-132712817 CCTCTCCTTCCCTGACCACCAGG - Intronic
1091207742 11:133832994-133833016 CCGCCCCTCCCCGCAGTCCCAGG - Intergenic
1091269024 11:134292734-134292756 CCGCTCCCCTGCTCACTCCCGGG - Intronic
1091393437 12:139394-139416 CTCCTCCTTCCCTCCCTCCCAGG - Intronic
1091787246 12:3250623-3250645 CCTGTCCTTCTCCCACTCCCAGG + Intronic
1091912482 12:4243306-4243328 CACCTCCTTCCCTCCCTGCCTGG - Intergenic
1096497108 12:52044969-52044991 CCCCTCCCTCCCTCCCTCTCAGG - Intronic
1096541939 12:52312975-52312997 CTCCTCCTACCCTCACTCCTCGG - Intergenic
1096789982 12:54038577-54038599 CCCCTCCCTCCCTCACTACCAGG + Intronic
1096877892 12:54644820-54644842 CCTCTCCTTCCCCAATTCCCTGG - Intronic
1097110222 12:56652422-56652444 CCTCCCCTTCCCTCTCTCCATGG - Intergenic
1097250714 12:57631086-57631108 CCTCTCCTTCCTCCACTGCCAGG - Exonic
1100343906 12:93708440-93708462 CCTCTCTTTTCCTCACTCACTGG + Intronic
1101418802 12:104532105-104532127 CGTCTCTTTCCCTCACACCCTGG + Intronic
1101682933 12:106987018-106987040 CCCGTCCTTCCCTCTCTCTCCGG + Exonic
1101864170 12:108507728-108507750 AAGCTCCTTCCCTCAGCCCCTGG - Intergenic
1102197359 12:111034682-111034704 CAGCTCCCTCCCTCCCTCGCCGG - Intronic
1102723262 12:115035822-115035844 CCCTTCCTTCCCTCCCTCCAGGG + Intergenic
1103415434 12:120739465-120739487 CCGCGCCTTCCCGCAGTCCTGGG - Exonic
1103988198 12:124780991-124781013 CCCTTCCTTTCCTCTCTCCCAGG - Intronic
1104272273 12:127293126-127293148 CCTCTCCACCCCTCACTCCTCGG + Intergenic
1104559459 12:129830975-129830997 CCTCCCCTTCCCTCCCTCCTGGG + Intronic
1106759758 13:32857234-32857256 CAGCTAGTTCCCTCACTCCTTGG - Intergenic
1106921966 13:34573811-34573833 TCCCTCCTTCCCTCCCTCCTGGG - Intergenic
1107276573 13:38686852-38686874 CCACTTCTTCCCTCACTTCCAGG + Intergenic
1107424990 13:40283687-40283709 CAGATCCTTCCTTCACTACCTGG - Intergenic
1108548572 13:51520830-51520852 CTGCTCCATGCCTCTCTCCCAGG + Intergenic
1109210845 13:59534276-59534298 CCCCTTCTTCCTTCCCTCCCTGG + Intergenic
1110145197 13:72182083-72182105 TCAGTCCTTGCCTCACTCCCAGG - Intergenic
1110219467 13:73058727-73058749 CCGCTACTTCCCTCCGCCCCCGG + Intronic
1110630090 13:77697816-77697838 CGGCTCCTTCCCTGTCGCCCCGG - Intergenic
1110630288 13:77698553-77698575 CCGCTCCTTCCCCGAGACCCTGG + Intronic
1111985371 13:95060903-95060925 CCCCACCTTCCCTCAGCCCCTGG + Intronic
1112799647 13:103096424-103096446 CCTTCCCTGCCCTCACTCCCTGG + Intergenic
1113726453 13:112606424-112606446 CCTCTCCTTCCCTCAGTCTGAGG + Intergenic
1113861773 13:113491316-113491338 CCCTTCCTTCCCTCCCTCCCTGG + Intronic
1113861810 13:113491404-113491426 TCCTTCCTTCCCTCCCTCCCTGG + Intronic
1113861846 13:113491487-113491509 TCCTTCCTTCCCTCCCTCCCTGG + Intronic
1114263579 14:21057494-21057516 CCTATTCTTCCCACACTCCCAGG - Intronic
1115770692 14:36662123-36662145 TCGCTCCCTCCCTCCCTTCCCGG - Intronic
1117920634 14:60723060-60723082 CCGCCCCCTACCTCGCTCCCCGG - Intronic
1118747560 14:68785233-68785255 CCCCTTCTTCCTTCACGCCCTGG + Intergenic
1118853172 14:69600500-69600522 CTGCTACTTCCCTCACTCTCTGG + Intergenic
1119096882 14:71840870-71840892 CCACTCCTTCCCCCAAACCCAGG - Intergenic
1119182689 14:72615122-72615144 CCCCTTCTTCTCTCACTCCCCGG - Intergenic
1119522893 14:75299032-75299054 ACCCTCCTTCCCCCACTCCTCGG - Intergenic
1121246656 14:92465620-92465642 CCGCTCCTTCCCTCCCCACGAGG + Intronic
1121284704 14:92726303-92726325 CACCTCCTTCCTGCACTCCCTGG + Intronic
1121333293 14:93061380-93061402 CCACTCCTTCCTCCTCTCCCTGG + Intronic
1121488932 14:94344015-94344037 CTGCTCCTTCCCTCCCCACCAGG + Intergenic
1122205393 14:100145652-100145674 CCGCTCCATCCCTCTCTGGCAGG + Exonic
1124166925 15:27335662-27335684 TCTCTCCTCCCCCCACTCCCTGG - Intronic
1124211471 15:27768377-27768399 CCTCTCCTGCCCCCACACCCAGG + Intronic
1124484062 15:30100473-30100495 AGGCCCCTTCCCTCCCTCCCAGG - Intergenic
1124519518 15:30396751-30396773 AGGCCCCTTCCCTCCCTCCCAGG + Intergenic
1124539135 15:30569470-30569492 AGGCCCCTTCCCTCCCTCCCAGG - Intergenic
1124759515 15:32438102-32438124 AGGCCCCTTCCCTCCCTCCCAGG + Intergenic
1124797987 15:32801242-32801264 GCCCTCCTTGCCTCTCTCCCTGG + Intronic
1125334172 15:38611502-38611524 CTGCTGCTTCCCTTCCTCCCAGG + Intergenic
1126111092 15:45175238-45175260 CCGCTCCTTCTTCCACTCCCAGG + Exonic
1126477333 15:49079561-49079583 CCTCCCCACCCCTCACTCCCAGG - Intergenic
1127762671 15:62154269-62154291 CAGCTCCTTCACTTACTACCTGG + Intergenic
1129467306 15:75731333-75731355 CTGCCCCATCCCTCTCTCCCAGG + Intergenic
1129605851 15:77024735-77024757 TCCCTCCCTCCCTCCCTCCCTGG + Intronic
1129719903 15:77872278-77872300 CCACCCCGTCCCTCTCTCCCAGG - Intergenic
1129763821 15:78148513-78148535 CCGCTCCTGTCCTCAATCCCAGG - Intronic
1131056482 15:89378180-89378202 CAGCTCCTCCACCCACTCCCTGG - Intergenic
1131265452 15:90912689-90912711 CCCCTCCTGCCCTCCCTGCCAGG - Intronic
1132688751 16:1172979-1173001 CCACCCCTCCCCTCCCTCCCAGG - Intronic
1132754358 16:1475321-1475343 CGGCTCCTGCCCTCAGGCCCCGG - Exonic
1132853306 16:2034374-2034396 CCACGCCTTCCCTCCGTCCCAGG + Intronic
1132853332 16:2034447-2034469 CCACGCCTTCCCTCCGTCCCAGG + Intronic
1132853358 16:2034520-2034542 CCACGCCTTCCCTCCGTCCCAGG + Intronic
1132853385 16:2034593-2034615 CCACGCCTTCCCTCCGTCCCAGG + Intronic
1132853411 16:2034666-2034688 CCACGCCTTCCCTCCGTCCCAGG + Intronic
1132853438 16:2034739-2034761 CCACGCCTTCCCTCCGTCCCAGG + Intronic
1132973431 16:2700129-2700151 CCGCACCTTCCCCTCCTCCCTGG + Intronic
1133026249 16:2990139-2990161 CCCCTCCTTCCCTCCCTCCCAGG + Intergenic
1133254821 16:4510179-4510201 CCACACCCACCCTCACTCCCAGG - Exonic
1133464908 16:6019697-6019719 CCGCTCCTGCTCTCTCTGCCTGG - Intronic
1133553780 16:6885151-6885173 CTCCTCCTTCCCTAATTCCCAGG + Intronic
1135010005 16:18867417-18867439 CCTCTTCTTGCCTCAGTCCCTGG - Intronic
1135316892 16:21454887-21454909 CCTCTTCTTGCCTCAGTCCCTGG - Intergenic
1135369815 16:21887128-21887150 CCTCTTCTTGCCTCAGTCCCTGG - Intergenic
1135441999 16:22483994-22484016 CCTCTTCTTGCCTCAGTCCCTGG + Intronic
1135509652 16:23071388-23071410 CCGGTCCTTCCCACACCACCTGG + Intronic
1135592249 16:23712972-23712994 CCTCTCCCTCCCTCACGCCTGGG - Intronic
1135965056 16:27028653-27028675 CCTCTCTCTCCCTCTCTCCCTGG + Intergenic
1136313717 16:29435060-29435082 CCTCTTCTTGCCTCAGTCCCTGG - Intergenic
1136327159 16:29536826-29536848 CCTCTTCTTGCCTCAGTCCCTGG - Intergenic
1136441848 16:30276811-30276833 CCTCTTCTTGCCTCAGTCCCTGG - Intergenic
1136519468 16:30786727-30786749 CGGCTCCTTCCAGCACTGCCAGG + Intronic
1136549698 16:30976425-30976447 CCTCTTCTCCCCTCACTCCCAGG - Intronic
1136778725 16:32884743-32884765 CCGCTCCTCCCCTCTGGCCCGGG - Intergenic
1136783244 16:32920295-32920317 CCCCTCCCTAACTCACTCCCAGG - Intergenic
1136886541 16:33933554-33933576 CCCCTCCCTAACTCACTCCCAGG + Intergenic
1136891893 16:33976771-33976793 CCGCTCCTCCCCTCTGGCCCGGG + Intergenic
1136990095 16:35146802-35146824 CCTCTCCCACCCGCACTCCCGGG + Intergenic
1137009600 16:35309635-35309657 CCGCTTCTTCCTTCAGTGCCAGG - Intergenic
1137336434 16:47554126-47554148 CTGCCCCTTCCCTCTGTCCCAGG + Intronic
1137632549 16:49957127-49957149 CTGGTCCTCCCCTCACTCCCTGG - Intergenic
1138105570 16:54285753-54285775 CCCCTCCTTCCCTGGCTCCGCGG + Intronic
1138303100 16:55949018-55949040 CAGCTCCTTTCCCCAATCCCAGG + Intronic
1138410177 16:56833193-56833215 CCTCTCCTCTCCTCTCTCCCAGG + Exonic
1138534213 16:57651369-57651391 CCGATCCTTCCCTGACCCCAGGG + Exonic
1138595432 16:58026838-58026860 CCCCTCCTTCCTTCCCTCCAGGG + Intronic
1139888648 16:70230538-70230560 CCTCTTCTTGCCTCAGTCCCTGG - Intergenic
1140138771 16:72233739-72233761 TCCCTCCTTCCCTCAGCCCCTGG + Intergenic
1141278778 16:82611774-82611796 CCTCTCCCTCCATCACCCCCTGG - Intergenic
1141288411 16:82694548-82694570 CCCCTCCTTCCCTTCCTCCCAGG + Intronic
1142175600 16:88643615-88643637 TCCCTCCCTCCCTCCCTCCCCGG + Intronic
1203081142 16_KI270728v1_random:1146837-1146859 CCGCTCCTCCCCTCTGGCCCGGG - Intergenic
1203085899 16_KI270728v1_random:1184280-1184302 CCCCTCCCTAACTCACTCCCAGG - Intergenic
1142859105 17:2749969-2749991 CCGCTCCGCCCCTCCCGCCCTGG + Intergenic
1143668988 17:8383523-8383545 CCGCTGGTACCTTCACTCCCAGG + Intergenic
1143872315 17:9965845-9965867 CCGCTCCTTCACTCAGCCCTTGG - Intronic
1144874579 17:18390687-18390709 GGGCTCCTTTCCTCACTCCAAGG + Intergenic
1145234997 17:21202079-21202101 CCGCCCCTCCCCGCACACCCAGG - Intronic
1145279421 17:21457080-21457102 CCGCCCCTCCCCTCAGTCGCCGG + Intergenic
1146169494 17:30621725-30621747 CGGCTCCCTTCCTCACTCCATGG - Intergenic
1146170068 17:30625724-30625746 CGGCTCCCTTCCTCACTCCATGG + Intergenic
1146343520 17:32041753-32041775 CGGCTCCCTTCCTCACTCCATGG + Intronic
1146809206 17:35890040-35890062 CCTCTCCTCCCCTCCCTTCCTGG + Intergenic
1147143507 17:38472478-38472500 CCCCTCCCTAACTCACTCCCAGG - Intronic
1147163135 17:38579176-38579198 CCCCTCCTTCCCTCACCTGCTGG - Intronic
1147359622 17:39922732-39922754 CCCCTTCCTCCCTCACTTCCTGG + Intronic
1147752513 17:42744930-42744952 CCTCTCCCTCCCTCAGGCCCAGG + Intronic
1147951403 17:44109942-44109964 CCGCTCCTTCCCTCACTCCCAGG - Intronic
1148104755 17:45113257-45113279 CCACTCCCTCCCTCACCCACAGG - Exonic
1148394234 17:47295583-47295605 CCACTCCCAACCTCACTCCCTGG + Intronic
1148670605 17:49407279-49407301 CAGCTGCCTCCCTCACTCTCAGG - Intronic
1149461442 17:56833394-56833416 CCGCTGCTCCCCTTTCTCCCCGG + Intronic
1149660676 17:58332632-58332654 GCCCTCCCTCCCTCCCTCCCTGG + Intergenic
1149799732 17:59556447-59556469 CCGCTCCTTCCTTTACCTCCAGG - Intergenic
1150423214 17:65056715-65056737 TCGCTGGTTCCCTCCCTCCCTGG - Exonic
1150463449 17:65371961-65371983 CCTCTCCTCCCCTTCCTCCCTGG + Intergenic
1151044940 17:70908905-70908927 CCCTTCCTTCCTTCCCTCCCAGG + Intergenic
1151345003 17:73496068-73496090 CGGTTCCTTCCCACCCTCCCGGG - Intronic
1151402709 17:73866368-73866390 GCCCTCCTTCCATCTCTCCCTGG - Intergenic
1151470427 17:74314418-74314440 CCGCCCCTTCCCTCTCTCCAAGG - Intronic
1151685199 17:75642184-75642206 CCTCCCCTCCCCTCACTCCTGGG - Intronic
1151825015 17:76519272-76519294 CCCCTGCTTCCCTCTCTCCCTGG + Intergenic
1152448236 17:80359085-80359107 CCTCCCCGTCCCTCATTCCCTGG + Intronic
1152530983 17:80918973-80918995 CCGAGCCTTCCCACACACCCGGG + Intronic
1152600783 17:81261127-81261149 TCCCTCCTTCCCCCGCTCCCCGG + Intronic
1154489317 18:14907495-14907517 CCGCTCCTACGCCCTCTCCCTGG - Intergenic
1155124813 18:22862788-22862810 CCGCCTCTTCCCCCAATCCCTGG + Intronic
1155235705 18:23816841-23816863 CCTCTTATTCCCTCTCTCCCTGG - Intronic
1156331509 18:36128596-36128618 CCGCTCCTCGCCTCTCTCCTGGG - Intronic
1156370674 18:36468939-36468961 CCTCTCCTTCCCTGAGCCCCAGG - Intronic
1157689722 18:49671365-49671387 CTCCTTCTTCCCTCACTCGCTGG - Intergenic
1157729622 18:49992209-49992231 CTGCTCCCTGCCCCACTCCCTGG - Intronic
1158649557 18:59273461-59273483 CGGCTCCTCCCCTCTCGCCCTGG + Intronic
1159355876 18:67337155-67337177 CCTCTCCTTCCCTCCATCCATGG + Intergenic
1160163461 18:76491933-76491955 CCGCGCCTTCCCTCCCACTCGGG - Intronic
1160342865 18:78104361-78104383 CCACTCCTTCCCCAACTCCAAGG - Intergenic
1160683455 19:423129-423151 CCGCCCTGACCCTCACTCCCTGG + Intronic
1160683479 19:423190-423212 CCGCCCTGACCCTCACTCCCTGG + Intronic
1160683503 19:423251-423273 CCGCCCTGACCCTCACTCCCTGG + Intronic
1160683527 19:423312-423334 CCGCCCTGACCCTCACTCCCTGG + Intronic
1160683551 19:423373-423395 CCGCCCTGACCCTCACTCCCTGG + Intronic
1160683575 19:423434-423456 CCGCCCTGACCCTCACTCCCTGG + Intronic
1160723673 19:608361-608383 CCGCCCCTCCCCTCAGACCCCGG - Intronic
1160745831 19:710258-710280 CCGCTGCCTCCCTCCCTCCCTGG + Intronic
1160870764 19:1276788-1276810 CCGCGCCCTCCCTGCCTCCCGGG + Intronic
1161079882 19:2305478-2305500 CAGCTCCTTCCCTCAGCTCCTGG + Intronic
1161170588 19:2810618-2810640 TCTCTCCTTCCCTCCCGCCCAGG + Exonic
1161202732 19:3024988-3025010 CCCCTCCTCCCCCCACCCCCAGG + Intronic
1161300315 19:3539294-3539316 CCCCTCCCTCCCTCCCTCCCTGG + Intronic
1161425036 19:4198540-4198562 CCGCTCCTGCGCCCCCTCCCCGG - Intronic
1161812768 19:6479952-6479974 CCTCCCACTCCCTCACTCCCAGG + Intronic
1162097704 19:8320946-8320968 CCTCTCCTTTCCTCTCTCCTGGG - Intronic
1162320520 19:9968614-9968636 CCCCTCTTTCCCTCCCTCCCTGG - Intronic
1162478849 19:10916385-10916407 CCCCTCCCTGCCCCACTCCCAGG + Exonic
1163238044 19:16040859-16040881 CTCCTCCCTCCCTCAGTCCCTGG - Intergenic
1163378669 19:16949884-16949906 CAGCTCCACCACTCACTCCCTGG + Intronic
1163514740 19:17756021-17756043 CTGGTCCTTCCCTGACTCCTGGG - Intronic
1163729528 19:18941133-18941155 CCGCTCGCTCCCTGGCTCCCGGG + Intronic
1164656455 19:29925414-29925436 CCGCCCCTGCACTCACTCACTGG + Intronic
1165262603 19:34633612-34633634 TCCCTCTTTCCCTCCCTCCCTGG - Intronic
1165670262 19:37672376-37672398 TCCATCCCTCCCTCACTCCCAGG - Intronic
1166123932 19:40702556-40702578 TCCCTCCTTCCCTCCCTCCCAGG - Intronic
1166470928 19:43079104-43079126 CAGCTTCTTCCCTCACACCTAGG - Intronic
1166525321 19:43507022-43507044 CCACTCCTTCCCTCAGACCCAGG + Intronic
1166820885 19:45579078-45579100 CTGCTCGTTCCCTCCCTCCTTGG + Intronic
1166942550 19:46375582-46375604 ACGCCCCTTCCCTCCCACCCAGG + Exonic
1166965448 19:46527072-46527094 ACGCCCCTTCCCTCCCACCCAGG - Exonic
1167052885 19:47090354-47090376 CCGCTGCTACTCCCACTCCCTGG - Intronic
1167265797 19:48482730-48482752 CCCCTTCTTCCCTCAGACCCAGG + Intergenic
1167784836 19:51628146-51628168 CCTATCCTTCCCTCCTTCCCAGG + Intronic
1167799312 19:51729934-51729956 AGGCTCCCTCCCTCCCTCCCTGG - Intergenic
1167924869 19:52813346-52813368 CCGCCCCCTGCCCCACTCCCTGG - Intronic
1168109040 19:54181614-54181636 TCCCTCCCTCCCTCCCTCCCTGG - Intronic
1168254160 19:55156975-55156997 TGGCTCCTCCCCCCACTCCCAGG + Intronic
1168274006 19:55266099-55266121 CCACTCCTGCCCTCACTCAAGGG + Intronic
1168280515 19:55302992-55303014 CCGCTGGTTCCATCACTCCCAGG - Intronic
925306061 2:2848970-2848992 CCTCTCCTGCTCTCCCTCCCTGG - Intergenic
925908042 2:8551303-8551325 CTGCTCCTTCAGTCACTCCCAGG + Intergenic
926003626 2:9354138-9354160 CTGTTCCTTCCATCCCTCCCAGG - Intronic
927255228 2:21035471-21035493 CCTCTCCATTCCTCCCTCCCAGG + Intronic
927488533 2:23505415-23505437 CCGCTCCTTCCCTTCCTGCAGGG + Intronic
927809233 2:26172805-26172827 CCGCCCCTGCCCCCGCTCCCCGG - Intergenic
928040942 2:27876647-27876669 CCCCTCCTCCCCTCAGCCCCTGG - Intronic
928090479 2:28370777-28370799 CTCCTCCTTCCCTCCCTCCATGG + Intergenic
928091605 2:28378004-28378026 TCCCTCCTTCCCTCCCTCTCAGG - Intergenic
928093957 2:28392900-28392922 CCGCTCGTTCGCTCGCTCGCTGG - Exonic
928101615 2:28440664-28440686 CCCGTCCTTCCCTCTGTCCCAGG - Intergenic
928947248 2:36782500-36782522 CCGCACCTTCCTCCACTCCGGGG + Intronic
929005447 2:37388925-37388947 CCACTCTTTCCCTCCCTCTCTGG + Intergenic
929212053 2:39367971-39367993 GCCCTCCTTCCCTGACTACCTGG - Intronic
929563616 2:42970848-42970870 CTCCTCTTTGCCTCACTCCCAGG + Intergenic
929589543 2:43136044-43136066 CCTCTCCTTCTCTTCCTCCCAGG - Intergenic
929929425 2:46240599-46240621 CCCCTACTTCCCCCAATCCCTGG - Intergenic
929997914 2:46840559-46840581 CCTCTCTTTTCCTCACTCCCTGG + Intronic
930121386 2:47763759-47763781 CCCATCCTTCCCACCCTCCCAGG + Intronic
932337667 2:70940149-70940171 CTGCTGCTGCCCCCACTCCCAGG + Exonic
932732706 2:74232302-74232324 TCTCTCCTTCCCTCCCTCCAGGG + Intronic
933227218 2:79764813-79764835 CAGCTCATGCCCTTACTCCCTGG - Intronic
933853154 2:86386999-86387021 TCCCTCCTTCCCTCAACCCCTGG + Intergenic
934521842 2:95024920-95024942 CCGCTGCTACCCCCACCCCCAGG - Intergenic
935101097 2:99997066-99997088 CGTCACCTGCCCTCACTCCCTGG + Intronic
935220480 2:101008100-101008122 CAGCTCCTCCCCACACTCCTGGG + Exonic
935249952 2:101252702-101252724 CCGCCCCTCCCCTCCCTTCCCGG + Intronic
935737658 2:106119305-106119327 CTGCTCCTCCCCACACTCCCTGG - Intronic
937048062 2:118863329-118863351 CCTCTCCTTGCTTCTCTCCCTGG - Intergenic
937754914 2:125525465-125525487 TTTCTCCTTCCCTCAATCCCTGG - Intergenic
938108432 2:128548862-128548884 CAGCTCCTCTCCTCACTCCAAGG + Intergenic
938273087 2:129992777-129992799 GCGCTCCCTCCCTCTCTCGCTGG - Intergenic
938443137 2:131353329-131353351 GCGCTCCCTCCCTCTCTCGCTGG + Intronic
938595374 2:132783077-132783099 CCATCCCTTCCATCACTCCCAGG + Exonic
940216036 2:151304500-151304522 TCACTCCTTCCCTCATCCCCTGG - Intergenic
945098357 2:206240372-206240394 CTGCTCCTTCCTTCACTCTGAGG + Intergenic
945386678 2:209209576-209209598 CCTCTGCTTCCCTCTGTCCCAGG + Intergenic
946713139 2:222526436-222526458 CCCCTCCTTCCCTCCATCTCAGG - Intronic
947198678 2:227595651-227595673 CCTCTCATTCCCTCACTCCACGG - Intergenic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
948247211 2:236496600-236496622 CCCTTCCTTCCCTCTCTCCCTGG - Intronic
948796140 2:240402868-240402890 CCCCTCCTGCCCCCGCTCCCAGG + Intergenic
948852993 2:240717520-240717542 CCGCTGGTTCCCTCACCACCTGG + Intronic
1168960586 20:1866776-1866798 CTGCTCCTTCCTTCACTCCTAGG + Intergenic
1169195232 20:3679234-3679256 TCCCTCTTTCCCTCCCTCCCTGG - Intronic
1169510173 20:6255480-6255502 TCCCTCCCTCCCTCCCTCCCAGG - Intergenic
1172006126 20:31820066-31820088 CCTTTCCTTCCCTCTCACCCAGG - Intronic
1172116623 20:32576938-32576960 CCCCTGCTGCCTTCACTCCCGGG + Intronic
1172790742 20:37503714-37503736 CCCCTGCTTCCCTCGCTCTCAGG + Intronic
1172810130 20:37641399-37641421 CCGGCCCTCCACTCACTCCCGGG - Intergenic
1173176778 20:40770909-40770931 CCTTCCCTTCCCTCACTCTCAGG + Intergenic
1173369193 20:42419660-42419682 CAGCCCCTTCCCTACCTCCCTGG + Intronic
1175215507 20:57390075-57390097 CCGCCCCCTCCCCCACTCCACGG - Intergenic
1175443852 20:59007383-59007405 CCGCTCCCTCCCTGGCTCCGGGG + Intergenic
1175543193 20:59761196-59761218 CCCCTCCCTCCCTGGCTCCCAGG - Intronic
1176111375 20:63412279-63412301 CCTTTCCTTCCCTCTCTCTCTGG - Intronic
1176238581 20:64065526-64065548 TCCCTCCCTCCCTCCCTCCCGGG - Intronic
1176364422 21:6024170-6024192 CAGCTCCTTCTCTGACTCCTTGG - Intergenic
1179008044 21:37531686-37531708 GCCCTCCTTCCCTCCCTGCCTGG + Intergenic
1179759096 21:43514375-43514397 CAGCTCCTTCTCTGACTCCTTGG + Intergenic
1179774811 21:43654826-43654848 CCGCTCATTGCCTCACCCCATGG - Intronic
1179821645 21:43940460-43940482 CCCCTGCTTCCCTACCTCCCAGG - Intronic
1179825261 21:43961208-43961230 CCCCTCCTTTCCCCACTCCCTGG - Intronic
1180020121 21:45118635-45118657 TCTCTCCTTCTCTCCCTCCCTGG + Intronic
1181675769 22:24450703-24450725 CCTCTCCCTCTCTCTCTCCCTGG - Intergenic
1181854801 22:25774214-25774236 CCACACCTTCAGTCACTCCCAGG + Intronic
1182015862 22:27039233-27039255 CAGCTCCTGCCCTCAGCCCCAGG + Intergenic
1182434908 22:30324406-30324428 TCTCTCCTTCCCTCACTTTCTGG - Intronic
1182787451 22:32919543-32919565 CAGTTCCTGCACTCACTCCCAGG - Intronic
1183469085 22:37996291-37996313 CCCCTCTTTCCCTGCCTCCCTGG - Intronic
1183494228 22:38133328-38133350 CCGCTCCCTGCATCCCTCCCTGG + Intronic
1184025432 22:41852162-41852184 TCCCTCCCTCCTTCACTCCCAGG - Intronic
1184501750 22:44878828-44878850 CAGCTCCCTCCCTCCCTCCCAGG - Intergenic
1184555262 22:45229383-45229405 CAGCTCCTCCTGTCACTCCCAGG + Intronic
1184663793 22:45977247-45977269 GCGCTCTCTCCCTCGCTCCCTGG + Intergenic
1185035518 22:48474696-48474718 ACCCTGGTTCCCTCACTCCCAGG - Intergenic
1185088341 22:48752671-48752693 CGCCTCCTGCCCTCCCTCCCAGG - Intronic
1185116305 22:48940154-48940176 CTGCTCATTCATTCACTCCCAGG + Intergenic
1185366084 22:50437484-50437506 TCCCTCCCTCCCTCCCTCCCAGG + Exonic
949536010 3:4996748-4996770 CCTCCCCTGCCCTCACTTCCAGG - Intergenic
949709838 3:6861031-6861053 CCACTCCCTCCCTCCCTCGCTGG - Intronic
950195322 3:11005446-11005468 AGGCTCCTTCCCTCCCTCCTTGG + Intronic
950774284 3:15336294-15336316 CATCTCCCTCCCTCTCTCCCTGG - Intronic
950805658 3:15601245-15601267 CACATCCTTCCCTCCCTCCCGGG + Intronic
951451506 3:22844629-22844651 TCACTCCTTCCTTCACTCCAGGG + Intergenic
951717547 3:25664919-25664941 CCGCGCCCTCCCTCTCTCCCCGG - Intergenic
952309764 3:32177648-32177670 TCCCTTCTTCCCCCACTCCCAGG - Intergenic
952502690 3:33978703-33978725 TAGCTCCTTTCCTCACTCCCTGG + Intergenic
952880887 3:37985723-37985745 CCACTCCTTCCCACCCTCCTGGG - Intergenic
953062414 3:39438457-39438479 TCCCTCCCTCCCTCCCTCCCTGG + Intergenic
953391484 3:42536316-42536338 CCGCCCCTTCCCACTCACCCCGG + Exonic
953507176 3:43497640-43497662 CCCTCCCTTCCCTCACTCCAGGG - Intronic
953632996 3:44635819-44635841 CCAATCCTTCCATCATTCCCAGG - Intronic
953882080 3:46695845-46695867 CCAGTCCTTCCCCCATTCCCTGG + Intergenic
954329482 3:49881940-49881962 CCTCTCCTTACCTTCCTCCCTGG + Intergenic
957930001 3:86864913-86864935 CCCCTCTTCCCCTCAATCCCTGG - Intergenic
961004210 3:123393779-123393801 CCCCTCCCTCCCTCCCGCCCCGG + Intronic
961016911 3:123475577-123475599 GGGATCCTTCCCTCTCTCCCTGG - Intergenic
961325103 3:126105004-126105026 CTGCTCCGGCCCTCTCTCCCTGG - Intronic
961450844 3:127001657-127001679 GCCTTCCTTCCCCCACTCCCTGG + Intronic
961573466 3:127816793-127816815 CAGTTCCTTCCCTTGCTCCCGGG - Intronic
963121995 3:141784173-141784195 CAGCTCCTTCCTTGGCTCCCGGG + Intronic
963286210 3:143436927-143436949 CAAGGCCTTCCCTCACTCCCTGG + Intronic
963834877 3:150048151-150048173 CTGCTCCTTACCTCCTTCCCAGG - Intronic
965036219 3:163441620-163441642 CCCCTCCTTCCCTCAGCGCCTGG + Intergenic
967146841 3:186613477-186613499 CTGCCCCTTCCCTCACTCCTGGG - Intronic
967329038 3:188272034-188272056 CCCCTCCTTCTCTTCCTCCCAGG - Intronic
967952217 3:194850089-194850111 CCACTCCTTCACTCCCTCCCCGG - Intergenic
968591975 4:1463947-1463969 CAGCCCCTGCCCTCCCTCCCCGG + Intergenic
968616708 4:1580716-1580738 CCGAGCCCTCCCTCCCTCCCAGG + Intergenic
968849231 4:3067266-3067288 CTTCTCCTTCTCTCTCTCCCTGG - Intergenic
969180510 4:5437034-5437056 ACCCTCCTTCCTTCCCTCCCAGG - Intronic
969298354 4:6282467-6282489 CCTCTCCCTCCCTCCCTCACTGG - Intronic
969374225 4:6752711-6752733 ACCCTCCTTCCCCCATTCCCTGG - Intergenic
969470974 4:7389150-7389172 GCGCTCTTTCCCTCAGTCCCTGG + Intronic
969704172 4:8783061-8783083 CACCTCCCTCCCTCCCTCCCGGG + Intergenic
969987188 4:11224553-11224575 CCCCTCCTTCCCTCACACCTTGG + Intergenic
970018027 4:11534407-11534429 CTGATTCTTCCCTCAGTCCCTGG + Intergenic
970159613 4:13175708-13175730 TCACACCTTCCCTGACTCCCAGG + Intergenic
970332629 4:15002281-15002303 CCGCTCGCTCCCGCCCTCCCGGG + Intergenic
972290398 4:37685969-37685991 CCGCTCCCGCCTTCCCTCCCTGG - Intronic
972730305 4:41788235-41788257 CCTCTCTCTCCCCCACTCCCAGG - Intergenic
973616167 4:52680534-52680556 TGGCTACTTCACTCACTCCCGGG + Intergenic
973859785 4:55051760-55051782 CCCCTCTCTTCCTCACTCCCTGG + Intergenic
974087538 4:57277225-57277247 CATCTCCTTCCCCCATTCCCAGG - Intergenic
975342609 4:73258671-73258693 CCGCGCCCTCCCTCTTTCCCTGG - Exonic
975465399 4:74703644-74703666 CTGCTCTTTTCCTCACTCCTTGG + Intergenic
975602487 4:76117086-76117108 CCCCTCCTCCCCTCACACCCTGG + Intronic
975736870 4:77389519-77389541 CACCTCCTTCCCTCCCTCCATGG + Intronic
976278616 4:83304292-83304314 CCCCTCCTTCCCTTTCTACCAGG - Intronic
976380705 4:84395001-84395023 TGTCTCCTTCCCTCAGTCCCTGG - Intergenic
977235997 4:94507901-94507923 CTGCTCCTTCACTCCCTCCTTGG + Intronic
977749280 4:100589340-100589362 TAGTTTCTTCCCTCACTCCCAGG + Intronic
978886972 4:113775781-113775803 CAGCCCCTCCCCTCACTCCAGGG - Intergenic
978919189 4:114161994-114162016 CCCCTTCTTCCCTCTCTGCCTGG - Intergenic
979251360 4:118569934-118569956 CCTCTCTTTCCCTCCATCCCTGG - Intergenic
979547237 4:121951802-121951824 CCGCTCCTGCCTTCCCGCCCTGG - Intergenic
981193287 4:141888209-141888231 CCTCTGCTTCTCTCTCTCCCGGG + Intergenic
981340125 4:143612238-143612260 CATCTCCTTCCCTGTCTCCCAGG + Intronic
983545348 4:168957617-168957639 CCACCCCTGCCTTCACTCCCAGG + Intronic
984880441 4:184405778-184405800 TTTCTCCTTCCCTCTCTCCCTGG - Intronic
985055348 4:186031123-186031145 CCGCACCTCCCCTCTTTCCCTGG + Intergenic
985733290 5:1563541-1563563 CTGCTGCTCCCCTCACTCACTGG + Intergenic
986321261 5:6633922-6633944 CCGACCCTCCCCTCACTGCCCGG + Intronic
986681594 5:10238078-10238100 CCTCTCCTCCCCTCACCCTCTGG - Intronic
988499398 5:31771815-31771837 TGGCTCCTTCACTCACTGCCTGG + Intronic
989104331 5:37846802-37846824 TTGCTCCTTCTCTCCCTCCCTGG + Intergenic
989173047 5:38492714-38492736 CTGCTCCTTACCTCTCTCTCAGG - Intronic
990054195 5:51549600-51549622 CCTCTCCTTCCCTCTCACCTTGG + Intergenic
990545211 5:56815522-56815544 CCGCCCCCTCCCTCCCTCGCAGG + Intergenic
991405045 5:66293419-66293441 TCGCTTGTTCCCTCACTTCCAGG - Intergenic
991552722 5:67859344-67859366 CAGCTCCTTCAGTCGCTCCCTGG + Intergenic
992399948 5:76403145-76403167 CGGCCCCTTCCCTCTCCCCCGGG + Intergenic
992773500 5:80070210-80070232 CTGCTCCTTTGCTCAATCCCAGG - Intronic
994171310 5:96662326-96662348 TCCCTCCCTCCCTCTCTCCCTGG + Exonic
995670087 5:114593343-114593365 CCCCTCTTTCCCTCTCTCCTTGG - Intergenic
997526269 5:134555141-134555163 CCCCTCTGTCCCTCCCTCCCTGG + Intronic
998513900 5:142735936-142735958 CTGGTCCTTTCCTCAATCCCAGG + Intergenic
999038470 5:148380905-148380927 GCTCTCCTTCCCCCAGTCCCTGG - Intergenic
999256374 5:150211926-150211948 ATGCTCCTTTCCTGACTCCCAGG - Intronic
999259598 5:150229682-150229704 CCTCTCTTTCCTTCACTCCCTGG + Intronic
1001537503 5:172508550-172508572 ACGCCCCTTCCTTCTCTCCCTGG + Intergenic
1001630115 5:173168665-173168687 CCACCCCTCCCCTCACCCCCAGG - Intergenic
1001822592 5:174721423-174721445 CTGCACCTTCCCGCGCTCCCCGG - Intergenic
1001948274 5:175797691-175797713 TCCCTCTCTCCCTCACTCCCCGG + Intronic
1002135574 5:177105661-177105683 CCACCCCTTCCCACATTCCCCGG + Intergenic
1002330908 5:178440000-178440022 CCGTTCCTTCCCCCAGCCCCAGG - Intronic
1002379192 5:178813409-178813431 CTGCTGCTGCCCTCACTGCCTGG + Intergenic
1002435305 5:179227739-179227761 CAGGGGCTTCCCTCACTCCCAGG - Intronic
1002590302 5:180286676-180286698 CCTCTCAATCCCCCACTCCCAGG + Intronic
1003242568 6:4357596-4357618 CTGCAACTTCCCTCCCTCCCTGG - Intergenic
1003617439 6:7668442-7668464 CCTCCCTTTCCCTCACTTCCAGG + Intergenic
1003869170 6:10388325-10388347 CCACTCCCACCCTCACCCCCAGG + Intergenic
1004154920 6:13159076-13159098 CCCCTCATTTCCTCACTCCTGGG + Intronic
1005626011 6:27663184-27663206 CCACACCTTCCCCAACTCCCTGG - Intergenic
1006188950 6:32196111-32196133 CCGCTCCTTCCCGCGCCGCCAGG + Exonic
1006517652 6:34553704-34553726 CCGCTTCTTCCTTTGCTCCCCGG - Intronic
1007390712 6:41548116-41548138 CCGCTCTTTCCTTTGCTCCCCGG + Intronic
1007700699 6:43764832-43764854 GCTCTCCTCCCCTCACTCCTGGG + Intergenic
1008514672 6:52307620-52307642 ATGGTCCCTCCCTCACTCCCCGG + Intergenic
1008920929 6:56843687-56843709 CTCCTCCCTCCCTCTCTCCCCGG - Intronic
1012054434 6:94387609-94387631 CTGCTCAATCCCTCACTTCCTGG + Intergenic
1013091391 6:106903801-106903823 CCCCACCTCCCCTCTCTCCCAGG - Intergenic
1013506028 6:110801193-110801215 CAGCTCCTTCCCCCAGCCCCCGG - Intronic
1013892964 6:115047178-115047200 CTGCTCCTTCCCTCAGTGGCAGG - Intergenic
1015510055 6:134029535-134029557 GCCCTCCTTGCCTCACTCACCGG - Exonic
1018708379 6:166479254-166479276 CCGTGCCTTCCCTCACTCGTGGG - Intronic
1019032404 6:169024464-169024486 CCGCACCTTCCCCCACTCGGCGG + Intergenic
1019340789 7:507875-507897 CCCCTCCTTCCCTGACCCCCCGG + Intronic
1019480284 7:1263562-1263584 CAGCTCCTCCCTGCACTCCCCGG + Intergenic
1019524817 7:1476177-1476199 CCCCTCCATGGCTCACTCCCAGG + Intronic
1020063570 7:5170391-5170413 CCCCTACTTCCTTCCCTCCCCGG - Intergenic
1020188218 7:5974641-5974663 CTGCTCCTTCCCTCTCGCCCTGG - Intronic
1020245307 7:6424703-6424725 CCGCTCCCGCACCCACTCCCAGG + Intronic
1020294699 7:6750127-6750149 CTGCTCCTTCCCTCTCGCCCTGG + Intergenic
1021110154 7:16684719-16684741 TCCCTCATTCCCTCACTCCCTGG + Intronic
1021620842 7:22549971-22549993 CCTCTCCATCCCCCACTCCGAGG - Intronic
1021719484 7:23491731-23491753 CCCCTACTTCCCTCCCTCCCCGG + Intergenic
1022200612 7:28113358-28113380 CTGCTCCTGTCCTCTCTCCCTGG + Intronic
1022599974 7:31748783-31748805 CCACTCCCACCCTCAGTCCCAGG + Intergenic
1023131898 7:37011842-37011864 CTCCTCCTTCCCTCTTTCCCAGG + Intronic
1023766961 7:43520854-43520876 TCTCTCCTTCCATCCCTCCCTGG + Intronic
1023903679 7:44505521-44505543 TCTCTCCCTCCCTCCCTCCCAGG - Intergenic
1024607488 7:51034297-51034319 CCAGACCTTCCCTCACTCCACGG - Intronic
1026374692 7:69738656-69738678 CCATTCCTTCCCTCCCTCCTGGG - Intronic
1026647627 7:72186044-72186066 CCTCTCCTTCTCTCACCCTCCGG - Intronic
1028369867 7:90078995-90079017 CCTCCCCTTCCCTGCCTCCCAGG - Intergenic
1028592584 7:92513536-92513558 CCACTCCTTTCCCCAGTCCCTGG - Intronic
1028692265 7:93666267-93666289 CTACTCCTTCCCTAAATCCCAGG + Intronic
1029496081 7:100895970-100895992 CCGCCCCTCCCCGCTCTCCCGGG + Intronic
1030089640 7:105846942-105846964 TCCCTCCTCCCCTCAGTCCCTGG - Intronic
1030299640 7:107962307-107962329 CCTCTCCTTCCCTCACAACCTGG - Intronic
1032264734 7:130363004-130363026 CCCCTCCTTCCATCCTTCCCAGG - Intronic
1033768765 7:144524485-144524507 CCGTTTCTTCCATCTCTCCCTGG + Intronic
1035004493 7:155644888-155644910 CTGCTCCTCCGCTCGCTCCCAGG - Exonic
1035021638 7:155804146-155804168 ACCCTCCTTCCCTCCCGCCCCGG + Intronic
1036675010 8:10824333-10824355 CCATTCTTTTCCTCACTCCCTGG + Intronic
1037178347 8:15973611-15973633 CCTCTCCTCCCCTTACTCACTGG - Intergenic
1037706775 8:21322035-21322057 CCTCTCCTTCTCTCTCTCTCTGG - Intergenic
1037721203 8:21445618-21445640 CTTCTCCTTCCCCTACTCCCAGG + Intergenic
1037825310 8:22156847-22156869 CCTCCCCTTCCGTGACTCCCAGG - Intronic
1037829070 8:22177545-22177567 CCGCCTCCTCCCTCTCTCCCAGG + Intronic
1037882295 8:22579166-22579188 CCCCGCCTTCCCTCCCTCCCGGG + Exonic
1038624435 8:29177128-29177150 CCGCCTCTTCCCCCACCCCCAGG - Intronic
1039561232 8:38514041-38514063 CCGCAGCCTCCCTCCCTCCCTGG + Intronic
1039948787 8:42152415-42152437 CCGCCCAGCCCCTCACTCCCCGG + Intergenic
1041143533 8:54847124-54847146 TGTCTCCTTCCCTCCCTCCCTGG - Intergenic
1042788136 8:72572539-72572561 CCGCTCCTCCTCTCTCTCTCAGG + Intronic
1043482464 8:80667177-80667199 TCACTCCTCCCGTCACTCCCTGG - Intronic
1045351953 8:101349532-101349554 TTTCTCCTTCCCTCTCTCCCAGG - Intergenic
1048008841 8:130440688-130440710 CCCTGCCTTCCCTCACTCCTTGG + Intronic
1048201780 8:132380669-132380691 ACCCTCCCTCCCTCCCTCCCAGG + Intronic
1048511159 8:135064088-135064110 TCTCTCCTTCCCTCACTTCCTGG - Intergenic
1048972592 8:139653608-139653630 CCACCCCTTCCCTCACCCCAAGG + Intronic
1049155217 8:141062125-141062147 CTGCTTGTCCCCTCACTCCCTGG + Intergenic
1049310998 8:141933799-141933821 TTGCTCCTTCCCTGACACCCTGG - Intergenic
1049442223 8:142614696-142614718 CCGCTCCGTACCTCCCACCCCGG + Intergenic
1049529330 8:143146651-143146673 GGGTTCCTTCCCTCACTCCTGGG - Intergenic
1049800263 8:144514403-144514425 CCGCTGCCTCCCTCACCCCTAGG + Intronic
1049815722 8:144598395-144598417 CTGCTCCTTCCCAGCCTCCCTGG - Intronic
1050591306 9:7163122-7163144 CAGCTCCTTCCCTTTCTCTCTGG - Intergenic
1050662149 9:7894394-7894416 CTGCTCCTTCCCTCTCTGCAAGG + Intergenic
1052049512 9:23829373-23829395 TCACTCCTTCCCTTGCTCCCAGG - Intergenic
1053423519 9:37996259-37996281 CCTCCCCTTCCCTCACACCCAGG + Intronic
1055557313 9:77488371-77488393 CCTGTCCTTCCCTCAATCCATGG + Intronic
1056843061 9:90014348-90014370 CCTCTCCTTCCTTCACTCCTTGG + Intergenic
1057291456 9:93809895-93809917 CCCCTCCCTCCCTCTCTCCCAGG - Intergenic
1057424295 9:94935968-94935990 CCTCTCCTTCACTCCTTCCCTGG + Intronic
1057996265 9:99823726-99823748 CCGCTCCGCCCCCCACCCCCCGG + Intronic
1058991153 9:110256240-110256262 CCGCTGCTTCCCGCAGTCCCAGG + Intronic
1060403326 9:123360902-123360924 CAGCTCCTTCCCTTCCTGCCTGG + Intronic
1060497873 9:124131193-124131215 CCTCCCCTTCCCTCCCTCTCTGG - Intergenic
1060643542 9:125259373-125259395 CCTCTCCTTCCCTTCCTCCCTGG + Intergenic
1060663229 9:125416500-125416522 CCCCTTCTTCCTCCACTCCCAGG + Intergenic
1060906862 9:127314559-127314581 CCCCTCCCTCCCTCCCTCCAAGG + Intronic
1060973510 9:127752392-127752414 CCTCTCCTTCCCCCACCTCCAGG + Intronic
1061087228 9:128406113-128406135 CCTCTCCCTCCCTCACTGCCTGG - Intergenic
1061186678 9:129059078-129059100 TGGCCCCTTCCCTCACCCCCAGG - Intronic
1061892324 9:133629384-133629406 CCGGACCTGCCCTGACTCCCTGG - Intergenic
1061907784 9:133707706-133707728 CCATTCCTTCCCCCTCTCCCTGG - Intronic
1062288538 9:135784508-135784530 TCCCTCCCTCCCTCCCTCCCTGG + Intronic
1062315554 9:135965422-135965444 CCCCTCCCTCCCTCACCCCTGGG + Intergenic
1062408800 9:136410957-136410979 CCTCTCCCCCCCTCACTTCCCGG + Intronic
1186403625 X:9282461-9282483 TCTCTCCTTCCCTCAATCCCTGG - Intergenic
1187419364 X:19121923-19121945 CCGCTCCGTCCCTCGGTGCCCGG + Intronic
1187552677 X:20321800-20321822 CAGCCCCATCCCTCCCTCCCAGG - Intergenic
1187675352 X:21710982-21711004 CCTCAGCTTCCCCCACTCCCGGG + Intronic
1188440097 X:30208251-30208273 TCACTCCTTCCCCCATTCCCTGG + Intergenic
1188645013 X:32554797-32554819 TCCCTCCCTCCCTCCCTCCCAGG - Intronic
1189240316 X:39519700-39519722 ACGCTGCCTCCCTCCCTCCCCGG + Intergenic
1190066970 X:47248073-47248095 CCGCTGCATCGCTCTCTCCCGGG + Exonic
1190154894 X:47982299-47982321 TCCCTCTTCCCCTCACTCCCTGG - Intronic
1190765689 X:53473749-53473771 TCCTTCCTTCCCTCCCTCCCTGG + Intergenic
1192146481 X:68686302-68686324 CCGCTCAGCCCCTCCCTCCCCGG + Intronic
1192194799 X:69021131-69021153 TCGCTCCCTGCCTCACTCTCAGG - Intergenic
1192340899 X:70262524-70262546 CGCCTCCTCCTCTCACTCCCAGG - Intergenic
1192549869 X:72045305-72045327 CCCCTCCTTCCCTCATTGCTGGG - Intergenic
1192960371 X:76124212-76124234 CCTCTCCTTCCTTCAGTCTCTGG + Intergenic
1195652949 X:107304662-107304684 CCTCTCCCTCCCTCCCTCCTGGG - Intergenic
1197223485 X:123934748-123934770 TCCCTCCCTCCCTCCCTCCCTGG + Intergenic
1197262346 X:124332740-124332762 CTCCTTCCTCCCTCACTCCCTGG - Intronic
1197892090 X:131278376-131278398 GAGTTCATTCCCTCACTCCCAGG + Intronic
1199896567 X:152132592-152132614 CAACTCCTTCCCTCTCTCCAAGG + Intergenic
1200240414 X:154490358-154490380 CCCTTCCTTTCCTCCCTCCCAGG - Exonic