ID: 1147957036

View in Genome Browser
Species Human (GRCh38)
Location 17:44141898-44141920
Sequence TGCCTGCCCCTTTAAGAAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147957034_1147957036 2 Left 1147957034 17:44141873-44141895 CCTTTGTGTCGGCGGGAAAGAAA 0: 1
1: 0
2: 0
3: 6
4: 35
Right 1147957036 17:44141898-44141920 TGCCTGCCCCTTTAAGAAGGCGG 0: 1
1: 0
2: 0
3: 17
4: 150
1147957028_1147957036 30 Left 1147957028 17:44141845-44141867 CCAGAGCGGAAGACTACAGTGAG 0: 1
1: 0
2: 0
3: 24
4: 306
Right 1147957036 17:44141898-44141920 TGCCTGCCCCTTTAAGAAGGCGG 0: 1
1: 0
2: 0
3: 17
4: 150
1147957033_1147957036 3 Left 1147957033 17:44141872-44141894 CCCTTTGTGTCGGCGGGAAAGAA 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1147957036 17:44141898-44141920 TGCCTGCCCCTTTAAGAAGGCGG 0: 1
1: 0
2: 0
3: 17
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147957036 Original CRISPR TGCCTGCCCCTTTAAGAAGG CGG Exonic
900899495 1:5507097-5507119 TTCCTGCCCCTTAAATTAGGTGG - Intergenic
901474050 1:9476922-9476944 TGCCTGCCCCTGAAAGCAGGGGG - Intergenic
901659687 1:10790780-10790802 TGCCTGACATTTTAAAAAGGGGG + Intronic
902360141 1:15937911-15937933 TCCCTGCCCCTTTCTGAAGGAGG + Exonic
903523106 1:23969926-23969948 TGCCTGCCTCTTTATGAGGGAGG - Intronic
905904437 1:41608467-41608489 TGCCTGCCTCTTTGTGAAGAAGG + Intronic
906921624 1:50070625-50070647 TGGCTCACCCTTTAAGTAGGTGG - Intronic
908380488 1:63593334-63593356 CCCCTGTCCCTTTAAGGAGGAGG + Intronic
908747805 1:67393059-67393081 GGCTTGACCCTTGAAGAAGGTGG + Intronic
913141681 1:115947431-115947453 TGCATGTCCCTGCAAGAAGGTGG - Intergenic
914341662 1:146765170-146765192 TGAATGCCCCTTTCAGAAGGAGG - Intergenic
915380364 1:155434265-155434287 TGCCTGCCCTTCTAGGAATGGGG + Intronic
915451584 1:156009157-156009179 TGCCTCCCCCTCTCAGAAGAGGG - Exonic
918839290 1:189513501-189513523 TGGCTGCCCCTTGGTGAAGGGGG - Intergenic
920660188 1:207908827-207908849 TTTCTGTCCCTTTGAGAAGGTGG - Intronic
923825958 1:237501036-237501058 TGCCTGTGCCTTGAAGGAGGAGG + Intronic
924746887 1:246843835-246843857 TGTCTGCTCCTTAAAGCAGGAGG + Exonic
1063925141 10:10970150-10970172 TGCTTGACCCTGCAAGAAGGAGG - Intergenic
1067032229 10:42885753-42885775 TGCCTGGCCCTGTATGTAGGAGG + Intergenic
1069132037 10:64717855-64717877 TGTTTGCCCCATTAAGAAGTGGG + Intergenic
1070732833 10:78843192-78843214 TGTCTGGCCCTTTAAGAAAAGGG + Intergenic
1070919126 10:80172932-80172954 TGGCTGCCCTTTCAAGAAGCTGG - Intronic
1072465794 10:95661289-95661311 TACCTGCCCCTTTCAGAATCCGG - Intergenic
1075956300 10:126525955-126525977 TGCCTACCCATTTAAGAGGACGG - Intronic
1076405095 10:130206440-130206462 TGGGTGCCCCTTGAAGGAGGAGG + Intergenic
1077497515 11:2893353-2893375 TGCCTGCCCCTCTAGGTTGGAGG - Intronic
1077955437 11:7014608-7014630 TGGCTGCCCCTTTAGGAGAGGGG + Intronic
1079475511 11:20825393-20825415 TGCCTGCCCATTAAAGCAGCTGG + Intronic
1080928274 11:36781401-36781423 TGCCTACCCCTTGAAAGAGGAGG + Intergenic
1085826429 11:79852724-79852746 TGCCTGCTCCCTTATTAAGGGGG - Intergenic
1091214778 11:133894029-133894051 TGCCTGTGCCGTTAAGAAAGAGG - Intergenic
1091807655 12:3367252-3367274 TGTGTGCCCCTGGAAGAAGGTGG - Intergenic
1092396695 12:8133746-8133768 TGCCTGCCCTTCTAGGAATGGGG - Intronic
1092708253 12:11308276-11308298 GGCCTGCCCCCTTGAGGAGGTGG + Exonic
1094110511 12:26856922-26856944 GGACTGACCCTTCAAGAAGGAGG + Intergenic
1094485794 12:30925583-30925605 TATCTGCCCCTGGAAGAAGGTGG + Intergenic
1096124716 12:49110720-49110742 TGCCTGCCCCTTTAAGGGCGGGG - Exonic
1096178625 12:49538938-49538960 GGCCTGTCCCTTTAAGGAGGCGG + Intergenic
1096725600 12:53559356-53559378 TGCCTGGCCCTTTAAGACTGAGG + Intronic
1100780354 12:98019061-98019083 TGACTTCCCCTGTAAGAATGTGG + Intergenic
1102688072 12:114739674-114739696 TGCCTGCCCTAGTAGGAAGGAGG + Intergenic
1102815616 12:115863298-115863320 TGCCTGCGTCTTTATGAAGGTGG - Intergenic
1103026974 12:117581696-117581718 TACCTGCCCTTTTAGGGAGGGGG - Intronic
1103518866 12:121524617-121524639 TGCCTCCCTCAGTAAGAAGGAGG + Intronic
1103850985 12:123933571-123933593 TGCCTGTCCCTTTGAGTTGGAGG - Intronic
1107568511 13:41631327-41631349 TTCCTGCCCCTGTTAGAAGATGG - Intronic
1117593712 14:57304670-57304692 TGGCTGTCCCTTTATCAAGGTGG - Intergenic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1117961959 14:61172041-61172063 TGCTGGCCCCTTGCAGAAGGAGG + Intergenic
1119001661 14:70887621-70887643 TGCCTGCACTTTGAAGAAGGAGG + Intergenic
1124046478 15:26155520-26155542 TGGCTGCCCCTTGATGGAGGGGG + Intergenic
1127182259 15:56433743-56433765 TGCATGCTATTTTAAGAAGGTGG - Intronic
1128792596 15:70444195-70444217 TGCCTGCCCCTTGAGGAAGTCGG - Intergenic
1129784927 15:78303889-78303911 TGCCTGCTCCGTAAAGCAGGAGG - Intergenic
1131279735 15:91010959-91010981 AGCCTGGCCCTGAAAGAAGGGGG + Intronic
1131512392 15:93056521-93056543 TGCCTGCCACTCAAAGATGGTGG + Intronic
1132305232 15:100807355-100807377 TGCCTGCTCCATGAAGCAGGAGG - Intergenic
1132764770 16:1528844-1528866 GCCCTGCCCCTGTGAGAAGGAGG + Intronic
1134333758 16:13274628-13274650 TGGCTGACCCTGAAAGAAGGAGG + Intergenic
1135423789 16:22322422-22322444 CACCTGCCCCTTTCAGCAGGTGG + Intronic
1135543322 16:23348896-23348918 TGCTAGCCCCTTCAAGTAGGTGG + Exonic
1137400858 16:48153566-48153588 TCCCAGCCCCTTTGAGAAGGTGG + Intronic
1139849603 16:69942743-69942765 TGCCACCTCCTTTAGGAAGGAGG - Intergenic
1139992616 16:70952272-70952294 TGAATGCCCCTTTCAGAAGGAGG + Intronic
1140710735 16:77674974-77674996 TGGTTGCCCCTTTAAGGAGTTGG + Intergenic
1143611229 17:8018889-8018911 TTCCTTCACCTTTAGGAAGGAGG - Intronic
1147957036 17:44141898-44141920 TGCCTGCCCCTTTAAGAAGGCGG + Exonic
1150001749 17:61444730-61444752 TGCCTGCCCCTTTAGAATTGGGG + Intergenic
1153024520 18:660419-660441 TCCCTTCCCCTGTTAGAAGGGGG + Intronic
1154402496 18:14054356-14054378 TGCCTGCCCAGTTAAAAAGAAGG + Intergenic
1157862774 18:51156244-51156266 TGCCTACCTCTTTATGAGGGAGG - Intergenic
1163674030 19:18646421-18646443 CTCATGCCCCTTTCAGAAGGAGG + Intronic
1165774148 19:38395161-38395183 CTCCTGCGCCTTTAAGGAGGAGG + Intronic
1166158035 19:40930034-40930056 TGCCTGCCACTGAAAGAATGAGG + Intergenic
1166166902 19:40997063-40997085 TGCCTGCCACTGAAAGAATGAGG + Intronic
1166233541 19:41439997-41440019 TGCGTGCACCTTTAAGAGGACGG - Intronic
1166711706 19:44941963-44941985 TGCCTCCCACTTTATGGAGGAGG + Intergenic
1167293412 19:48636412-48636434 TTCCTGCCCCTTACAGATGGTGG - Intronic
925767123 2:7246954-7246976 TGCCTGCCCCCATGAGAAGGGGG + Intergenic
926909863 2:17842556-17842578 GGCCAGCCCCATTGAGAAGGGGG + Intergenic
929139031 2:38651287-38651309 TGCCTGGCCCTTAAGGAAGAAGG + Intergenic
930152012 2:48068852-48068874 TCCCTGCCCCTTTAATACTGAGG - Intergenic
932747614 2:74347090-74347112 AGTCTGCCCCTTTGGGAAGGAGG - Intronic
933212772 2:79590163-79590185 TGACTGCTCCTTTGAGGAGGCGG + Intronic
933534944 2:83559673-83559695 TCCCTGCCTTTTTAAAAAGGAGG + Intergenic
937081811 2:119145603-119145625 TGCCTGCCTCTCTTAGAAAGTGG + Intergenic
937472433 2:122185719-122185741 AGCCATCCCCTGTAAGAAGGTGG - Intergenic
937670351 2:124531609-124531631 AGCTTTCCCCTTTTAGAAGGTGG - Intronic
941118539 2:161501197-161501219 TGTCTGCTCCTTAAAGCAGGAGG + Intronic
941587486 2:167379153-167379175 TTCCTGCCCCCTTATGAAGAAGG - Intergenic
947482190 2:230510820-230510842 TGCAGGCCCCTTGAAGTAGGAGG + Intronic
948689803 2:239694716-239694738 TGCCTGCTCCTTCAGGAGGGTGG + Intergenic
1170129415 20:13002519-13002541 TGCCTGTCACTGGAAGAAGGGGG + Intergenic
1174661818 20:52220317-52220339 TTCCTGCCACTTTATGAAGAAGG - Intergenic
1181801481 22:25350628-25350650 TGCCTGCCCCTGGGAGGAGGGGG - Intergenic
1183976953 22:41517818-41517840 TGCCAGGCCCTTTGAGAAGCTGG - Intronic
1185225150 22:49647935-49647957 TGCCTGCCCCTTTCAGATTAAGG + Intronic
951136341 3:19107815-19107837 TGCCTGCTCCTTGGAGCAGGAGG + Intergenic
951702778 3:25512659-25512681 TGCCTGCTCATTTAGGAAGAAGG - Intronic
952534855 3:34298443-34298465 TCCATGTCCCTTTAAGACGGGGG + Intergenic
955341360 3:58127942-58127964 TGCCTGCCCTTTTAGAAATGGGG - Intronic
955948305 3:64216826-64216848 TGCCTGCCTCATTAGGAAGGAGG - Intronic
961691688 3:128674642-128674664 TGCCTGCCCTTCTAGGAATGGGG - Intronic
962256266 3:133872142-133872164 TGTCTGCAGCTTTCAGAAGGTGG + Intronic
962881933 3:139586543-139586565 TGCCATCCCCTTGAAGGAGGGGG - Intronic
964023057 3:152038192-152038214 TGCCTGGCTGTTTAAGAAGAAGG - Intergenic
965564659 3:170101738-170101760 AGCCAGCCCCTTGGAGAAGGTGG + Intronic
968093064 3:195909812-195909834 GGCCGGGCCCTTTAAGAGGGCGG - Intronic
968313138 3:197700692-197700714 TGTCTGCCCCTCTGAGAAGCTGG + Exonic
968500837 4:949146-949168 TGGCTGCCCCTTTCAGAACGGGG + Intronic
968768112 4:2485287-2485309 TTCCTCCTCCTTGAAGAAGGAGG + Intronic
968841779 4:3012389-3012411 TGCATACCCATGTAAGAAGGTGG + Intronic
969707323 4:8819042-8819064 AGCCTCCCCAGTTAAGAAGGCGG + Intergenic
969707343 4:8819107-8819129 AGCCTCCCCAGTTAAGAAGGCGG + Intergenic
972398183 4:38674828-38674850 TGCCTGCCCCTTCCTGAGGGAGG - Intronic
973003643 4:44983846-44983868 TAGCTGACCCTTTAACAAGGTGG - Intergenic
973852745 4:54977351-54977373 TACCTTTCCCTTTAAGAAAGAGG - Intergenic
974967704 4:68783346-68783368 TGCCTGCATATTTAAGAAGATGG + Intergenic
975392535 4:73836479-73836501 TGCCTGCTCCCTTAAGGGGGAGG - Exonic
976115647 4:81722990-81723012 TGCCTGCCCTTTGAAGGTGGGGG - Intronic
976435784 4:85016406-85016428 TGACTTCCCTTTTAAGAAGATGG - Intergenic
976608648 4:87006896-87006918 GCCCTGCCCATTTAAGTAGGCGG + Intronic
985206743 4:187546470-187546492 CTCCTGCCCCATTAAGAAGACGG + Intergenic
985805569 5:2040195-2040217 TACTTGCCCCTTGGAGAAGGGGG + Intergenic
985826619 5:2196585-2196607 TGCCTTCCCCTTTGATAAGCAGG + Intergenic
991421189 5:66443994-66444016 TGCCTTTCCCTTTAAGAAATAGG + Intergenic
994146995 5:96406480-96406502 TGCCAGCCCCTCCAAGTAGGTGG + Intronic
998127567 5:139634785-139634807 TCCCTGTCCCTGTTAGAAGGAGG + Intergenic
1000179539 5:158794576-158794598 TTACTGACCCTTTGAGAAGGAGG - Intronic
1006028840 6:31164576-31164598 TGCCTGCCCTTCTAGGAATGGGG - Exonic
1007093787 6:39200914-39200936 TGCCTGCCCATGTCTGAAGGTGG - Intronic
1007444691 6:41895680-41895702 TCTCTGGCCCTTTAAGGAGGAGG - Intergenic
1011990886 6:93515872-93515894 CTCCTGCCACTTTATGAAGGAGG + Intergenic
1012216945 6:96598534-96598556 AGCCACCCCCTTAAAGAAGGAGG - Intronic
1013420712 6:109964117-109964139 TGCTTGCCACTTTGAGAAGCGGG - Intergenic
1014665615 6:124233352-124233374 TGCTTGCCCCTTTAGCAAGTTGG + Intronic
1019028636 6:168992102-168992124 TGCCTGCCCCTCTGAGGATGAGG - Intergenic
1024034335 7:45494965-45494987 TGGCTGCCCCTTTGTGGAGGGGG + Intergenic
1028615072 7:92756732-92756754 TGCCTGTCCCTTTAACAGGATGG - Intronic
1031890398 7:127287293-127287315 TCCCAGCCCCTTAAAGAAGGCGG + Intergenic
1032607152 7:133367953-133367975 TACCTGCCCCTTGTAGAAGAAGG + Intronic
1036694374 8:10965015-10965037 GGCCTGTCCCTTTAAGAGAGAGG - Intronic
1040374841 8:46814976-46814998 TGCCTGGGCCTTTAAAATGGTGG + Intergenic
1040377755 8:46842871-46842893 TGCCTGGGCCTTTAAAATGGTGG + Intergenic
1041286760 8:56271041-56271063 TGCCTGAACCTTGAAGAAGAAGG + Intergenic
1042816350 8:72881807-72881829 TGGCTGTCCCTTCAAGCAGGGGG + Intronic
1047207134 8:122811571-122811593 TGTCTGCCCCTATCAGAGGGCGG - Intronic
1047697439 8:127416949-127416971 TGCCTGCCCTTCTAGGAATGGGG + Exonic
1047720210 8:127632047-127632069 TGCCTTCCTCTTTGATAAGGGGG + Intergenic
1051805695 9:20990388-20990410 TGCCTGCCCTGCTAAGCAGGTGG - Intronic
1052856634 9:33410985-33411007 TGCATCCCCCTTGAAGTAGGAGG + Intergenic
1054920579 9:70538846-70538868 TGCCTGGCCATTTAAGACAGAGG + Intronic
1055073804 9:72193875-72193897 TTCCTTCCCCTTTTTGAAGGTGG + Intronic
1055711125 9:79063107-79063129 TGGTTGCCTCTTTAAGATGGTGG + Intergenic
1060883190 9:127133135-127133157 TCCCTGCCCCTCTGTGAAGGTGG - Intronic
1062584694 9:137243998-137244020 TCCCTACCCCTTTTGGAAGGGGG - Intronic
1186786100 X:12957006-12957028 CTCCTGCCCCTTTAAGAACACGG + Intergenic
1189896970 X:45665619-45665641 TGCCTGGGCCTATGAGAAGGTGG + Intergenic
1190767671 X:53488887-53488909 TGGCTGCCCCTTCAATAAAGGGG + Intergenic
1193108578 X:77704940-77704962 TGCCTGCCCCATAAAGCAGGAGG + Intronic
1195613004 X:106890411-106890433 TGCTTGCCCCCTTGAGATGGAGG + Intronic
1196284466 X:113863588-113863610 TGTCTGCCCCTTGGAGGAGGGGG + Intergenic
1197793883 X:130280955-130280977 TGGCTGCCCTTCTCAGAAGGGGG + Intergenic
1200845294 Y:7826312-7826334 TGCCTGGGCCTTTAATATGGTGG - Intergenic
1200870710 Y:8095100-8095122 TGCCTGGGCCTTTAAAATGGTGG - Intergenic
1202244719 Y:22808299-22808321 TGCCTGGGCCTTTAAAATGGTGG + Intergenic
1202397708 Y:24442045-24442067 TGCCTGGGCCTTTAAAATGGTGG + Intergenic
1202473073 Y:25228042-25228064 TGCCTGGGCCTTTAAAATGGTGG - Intergenic