ID: 1147958423

View in Genome Browser
Species Human (GRCh38)
Location 17:44150997-44151019
Sequence GCGCCCCAAACTCCAACCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 129}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147958418_1147958423 21 Left 1147958418 17:44150953-44150975 CCTCTTAGCAGAGTGGGAGAAGT 0: 1
1: 0
2: 2
3: 15
4: 161
Right 1147958423 17:44150997-44151019 GCGCCCCAAACTCCAACCCATGG 0: 1
1: 0
2: 1
3: 13
4: 129
1147958413_1147958423 27 Left 1147958413 17:44150947-44150969 CCCTCCCCTCTTAGCAGAGTGGG 0: 1
1: 0
2: 3
3: 20
4: 168
Right 1147958423 17:44150997-44151019 GCGCCCCAAACTCCAACCCATGG 0: 1
1: 0
2: 1
3: 13
4: 129
1147958417_1147958423 22 Left 1147958417 17:44150952-44150974 CCCTCTTAGCAGAGTGGGAGAAG 0: 1
1: 1
2: 1
3: 19
4: 164
Right 1147958423 17:44150997-44151019 GCGCCCCAAACTCCAACCCATGG 0: 1
1: 0
2: 1
3: 13
4: 129
1147958416_1147958423 23 Left 1147958416 17:44150951-44150973 CCCCTCTTAGCAGAGTGGGAGAA 0: 1
1: 0
2: 1
3: 17
4: 135
Right 1147958423 17:44150997-44151019 GCGCCCCAAACTCCAACCCATGG 0: 1
1: 0
2: 1
3: 13
4: 129
1147958415_1147958423 26 Left 1147958415 17:44150948-44150970 CCTCCCCTCTTAGCAGAGTGGGA 0: 1
1: 0
2: 1
3: 15
4: 122
Right 1147958423 17:44150997-44151019 GCGCCCCAAACTCCAACCCATGG 0: 1
1: 0
2: 1
3: 13
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147958423 Original CRISPR GCGCCCCAAACTCCAACCCA TGG Exonic
900571063 1:3358470-3358492 GCGCCCCAGACTCCCAGCCGCGG + Intronic
901109889 1:6785786-6785808 GCGCCCCACACCCCACCCCCGGG + Intronic
901492976 1:9606016-9606038 GCCCCACAAACTCCCTCCCATGG + Intronic
902110115 1:14071318-14071340 TCCCCCCAGACTCCAGCCCAAGG - Intergenic
902991517 1:20190811-20190833 GCACCCAAATCTCCAAACCAGGG + Exonic
904602206 1:31679850-31679872 GCGACCCCCACTCCCACCCAGGG - Exonic
906177650 1:43789321-43789343 CTGCCCCAACCTCCAACCCCAGG - Intronic
906400966 1:45504371-45504393 GCGCCACAAACTCCAGCCTGGGG + Intronic
907303866 1:53503276-53503298 GGGCCCCCGAGTCCAACCCAGGG - Intergenic
918148817 1:181780945-181780967 GGGTCAGAAACTCCAACCCATGG + Intronic
920002101 1:202807517-202807539 GCGCCCCACCCTCCAGACCAGGG - Intronic
920177653 1:204113093-204113115 GACCCCCAAGCTCCAGCCCAGGG + Exonic
920401894 1:205681136-205681158 GCCCCCCAACCCCCAACCCCAGG - Intergenic
1063980407 10:11447546-11447568 AGGCCCCAAGCTTCAACCCAGGG - Intergenic
1066403027 10:35093189-35093211 AAACCCCAACCTCCAACCCAGGG + Intergenic
1067102421 10:43342884-43342906 GCCCCCCACCCTCCACCCCAGGG + Intergenic
1070789648 10:79181597-79181619 GCTCCCCAAACCCCAAACCGTGG + Intronic
1076411784 10:130256823-130256845 GCGCCACAAACACCACACCAAGG + Intergenic
1076880017 10:133235590-133235612 GCGCCCAAGTCTCCTACCCATGG + Intergenic
1077225971 11:1439340-1439362 GCTCCCCACACCCCAACCCTGGG - Intronic
1079493607 11:21016399-21016421 GCTCCCCAAACTCCCAAGCAGGG + Intronic
1081574388 11:44310124-44310146 CCTCCCCAAACTCCCAGCCAAGG - Exonic
1084007106 11:66328975-66328997 GCGCCCCCAGCTCCAGCCAAAGG - Intergenic
1085172564 11:74461839-74461861 TCGTCCCAAGCTCCATCCCAGGG + Intronic
1085529754 11:77184302-77184324 GCACCCCACACCCCACCCCAGGG - Intronic
1088941224 11:114458676-114458698 GAGTCCCAAACTCCAACAGAGGG - Intergenic
1089356948 11:117860193-117860215 CAGCCCCAAACTCCAGCCCTTGG + Intronic
1090084935 11:123642500-123642522 GCGCCTCAAACTCAAACTCCCGG + Exonic
1091780066 12:3208170-3208192 GCGGTCCATACTCCAACCCGTGG - Intronic
1094164259 12:27426041-27426063 CCTCGCCAAACTTCAACCCAAGG - Intergenic
1095719005 12:45380216-45380238 GAGTCCTAAACACCAACCCATGG + Intronic
1100764215 12:97845855-97845877 GCTCCCCCAACTCCATCCCCAGG + Intergenic
1101770794 12:107749011-107749033 GTGCCACAAAATCCAGCCCATGG - Intronic
1103342539 12:120228803-120228825 GCGCCCCTATCTGCACCCCATGG + Intronic
1105461270 13:20590778-20590800 GAGCAGCAAACTACAACCCATGG - Intronic
1106186223 13:27412368-27412390 GCGCACCAATCTCCATCTCAGGG - Intergenic
1107885667 13:44872489-44872511 CCTCCCCACACCCCAACCCAGGG + Intergenic
1109677530 13:65698265-65698287 CCTCCCCAAACTCCAACCTGTGG - Intergenic
1118747944 14:68787246-68787268 GCACCCCAAACACCATCCAAAGG + Intergenic
1121676170 14:95754798-95754820 GTGACCCCAACTCCCACCCAGGG + Intergenic
1122194635 14:100075731-100075753 GCCCCCCAAACCCCACCCCAAGG - Intronic
1123002072 14:105301034-105301056 CCGCCCCAAACTCCAGTCCCGGG - Exonic
1123060549 14:105592361-105592383 GGGCCCCAGACTGCAGCCCAGGG + Intergenic
1123085027 14:105713332-105713354 GGGCCCCAGACTGCAGCCCAGGG + Intergenic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1126284679 15:46997024-46997046 GACCCCCAAACCCCCACCCAAGG - Intergenic
1129257062 15:74339543-74339565 CCGCCCCCAACTCCAATCCCTGG - Intronic
1129457692 15:75684329-75684351 GCTCCCCAAACTCCTGCACAAGG - Intronic
1132699270 16:1215431-1215453 CCGCCCCTCACTCCCACCCATGG - Intronic
1133268369 16:4598427-4598449 CCGCCCCAAACCCCAGCCCCTGG - Intronic
1133909281 16:10050279-10050301 GATCCCCAAACCCCAAGCCACGG + Intronic
1135474869 16:22765107-22765129 GAGCCCCAGAGTCAAACCCAGGG + Intergenic
1136368390 16:29820528-29820550 GCCCCCCAAACCCCAAATCAGGG + Intronic
1136993169 16:35169601-35169623 GCCCCCCAAACCCCTACCGATGG + Intergenic
1141689904 16:85590893-85590915 GCGGCCCAAGCTTCATCCCAGGG - Intergenic
1142254216 16:89006254-89006276 GCGCCCCAAACTCCACTCCCCGG + Intergenic
1143103707 17:4518074-4518096 TCTCCCCATACGCCAACCCATGG - Intronic
1147958423 17:44150997-44151019 GCGCCCCAAACTCCAACCCATGG + Exonic
1147996519 17:44363005-44363027 GCACCCCAAACTCTAAACCAGGG + Intronic
1148663961 17:49361467-49361489 GCACCCAAACCTCCAACCCCCGG - Intronic
1148750136 17:49940859-49940881 GAGACCCAAACTCCAGCCCAGGG - Intergenic
1152504513 17:80739066-80739088 GTGCCCCAGTCTGCAACCCATGG - Intronic
1152540445 17:80971901-80971923 GCTCCGCAGCCTCCAACCCAGGG + Intergenic
1203162148 17_GL000205v2_random:62750-62772 GCGCCCCTGATTCGAACCCATGG - Intergenic
1157345573 18:46828244-46828266 AAGCCACATACTCCAACCCATGG + Intronic
1157984376 18:52420494-52420516 GTGCCCCAAAATCCATTCCAAGG - Intronic
1160772530 19:839382-839404 GCTCCCCAAACTCCCTCCCCCGG - Intergenic
1160867335 19:1261685-1261707 GCCCCCCAAAGTCCAGGCCACGG - Intronic
1161937660 19:7382066-7382088 CCACCCCAAACTCCATCCCCAGG - Intronic
1163581944 19:18144514-18144536 GCGCCCGACACTCCACACCAAGG + Exonic
1166234240 19:41444053-41444075 GCGCCCCCATCTCCAGCCCCAGG - Exonic
1168721231 19:58555999-58556021 GCCCCCCAAACCCCTACCCATGG + Exonic
930404981 2:50942962-50942984 ACTCCCCTAACTCCAACACATGG - Intronic
932280720 2:70489488-70489510 GCGCCCCAGTCTCCAACTCAGGG + Intronic
934059976 2:88284320-88284342 GCGCCCCGAACACAACCCCAGGG + Intergenic
936587056 2:113767306-113767328 TTGCCCCAAACTCCAAATCAGGG + Intergenic
938955510 2:136294182-136294204 CTCCCTCAAACTCCAACCCAGGG - Intergenic
939208529 2:139140616-139140638 AAGCCTTAAACTCCAACCCATGG + Intergenic
944840101 2:203616450-203616472 GAGCACCAAACTCCCACCCGGGG - Intergenic
945139660 2:206671086-206671108 GCGCCCTGAACTGCAACCCCAGG + Intronic
946473645 2:219986845-219986867 GGGCCCCAAACCCCAGGCCATGG + Intergenic
1168928069 20:1599069-1599091 GCTACCCTAGCTCCAACCCAAGG + Intronic
1171460391 20:25294643-25294665 GCGCCCCCTACCCCACCCCAGGG - Intronic
1172871149 20:38136287-38136309 GTGCCCCAGACGCCAGCCCATGG + Intronic
1173618419 20:44418035-44418057 GGGTCCCAAATTCCCACCCATGG - Intronic
1179881388 21:44294555-44294577 GCTCCCCCAACACCAACCCAAGG - Intronic
1179886053 21:44314658-44314680 GAGCCCCCAACTCCACCCCAAGG - Intronic
1181775065 22:25153558-25153580 CAGCCCCAATCTCAAACCCAGGG - Intronic
1182189366 22:28442839-28442861 GGGCCCCAAAGCCCAACCCGGGG - Intronic
1184677558 22:46052097-46052119 GCACCCCAAATCCCATCCCAAGG - Intronic
950480023 3:13238347-13238369 GCACCCCAAGCTCCAGCCCCAGG + Intergenic
950663061 3:14478832-14478854 ACAGCCCAAACTCAAACCCAAGG - Intronic
953397197 3:42582424-42582446 GGGCGCCAAAGTCCGACCCAGGG + Intronic
954454156 3:50587999-50588021 GCACCCCAGTCTCCAACTCAGGG - Intergenic
954592241 3:51792742-51792764 GCTCCCCAAACCCCAGGCCAGGG - Intergenic
954871264 3:53769173-53769195 GCCCCCCAACCCCCACCCCAGGG - Intronic
959769044 3:110071141-110071163 CAGCCCCAAACTCCAACACTGGG - Intergenic
961243492 3:125432315-125432337 CAGCCCCACACTACAACCCAGGG + Intergenic
961457613 3:127031955-127031977 GTGCCCCAAACACCACCTCAGGG - Intronic
963843331 3:150130318-150130340 GCACTCCTAACTCCAACCCAAGG - Intergenic
965977298 3:174641016-174641038 GCGCCCCAAAGGCAAACCCAGGG + Intronic
968935053 4:3605458-3605480 GCGCCCCAAAGGACAGCCCAGGG - Intergenic
969447933 4:7255999-7256021 GGACCCCACACTCCAGCCCAGGG - Intronic
979989425 4:127356940-127356962 GGGAACCAAACTCCAACCAAAGG + Intergenic
985859337 5:2458126-2458148 GAATCCCCAACTCCAACCCAAGG - Intergenic
986877827 5:12132468-12132490 GCTCCCCACCCTCCAAGCCATGG + Intergenic
988705099 5:33718299-33718321 GGGCCCCAACCTCCAGGCCATGG + Intronic
991535735 5:67667605-67667627 CCACTCCAAACTCCAACCCTAGG + Intergenic
996918603 5:128739686-128739708 GTTCCCCAAACTCCAGCCCCAGG - Intronic
1002409325 5:179061316-179061338 GCTGCCCAAACACCAACCCCAGG - Intronic
1003405858 6:5826714-5826736 GCCCCCCAACCCCCAACCCCTGG - Intergenic
1006248844 6:32763300-32763322 ATCCCCCATACTCCAACCCAAGG + Intronic
1006730218 6:36230802-36230824 GTGCCAAAAACTCCCACCCAAGG + Exonic
1007744766 6:44036739-44036761 GGGCACCCAACTACAACCCACGG + Intergenic
1019017217 6:168888564-168888586 GGGCCACAAACTCCAATCCATGG - Intergenic
1019600085 7:1877179-1877201 GGTCATCAAACTCCAACCCATGG + Intronic
1024945697 7:54805524-54805546 TCGCCCCAAACTCAAACCCCTGG + Intergenic
1029604452 7:101590263-101590285 ACGCCCCTATGTCCAACCCAGGG + Intergenic
1032648525 7:133852743-133852765 GTTCCCCAATCTCCACCCCAAGG - Intronic
1034345614 7:150383707-150383729 GCTCCCCAAACCCCAGCCAAAGG - Intronic
1035813674 8:2515159-2515181 GGGCCCCCACCTCCATCCCAGGG - Intergenic
1036396640 8:8376637-8376659 GGGCCCCAGCCTCCATCCCAAGG - Exonic
1038886372 8:31667309-31667331 GAGCCACAAACTCCAACCTCTGG - Intronic
1040296537 8:46151892-46151914 CAGCCCCAAACTCCAACCCAGGG - Intergenic
1040899795 8:52406497-52406519 GGGCCCCAAACTCTTACCCTAGG - Intronic
1044429499 8:92092077-92092099 GCCCACCAAACTGCAATCCAAGG + Intronic
1044938422 8:97315650-97315672 GGGCCCCTGACTCCTACCCAGGG + Intergenic
1047976220 8:130133353-130133375 GAGTGCAAAACTCCAACCCAGGG + Intronic
1048953387 8:139514425-139514447 GCTCCCCAATCTCCAGCCCTAGG + Intergenic
1049458240 8:142705848-142705870 GCTCCCCAAACTCAAGCCCAGGG - Intergenic
1051736162 9:20201216-20201238 TTGCCCCAAACTTCATCCCATGG + Intergenic
1052966120 9:34341870-34341892 GGGCCCCCATCTCCAAACCAAGG + Intronic
1057222757 9:93266710-93266732 GCACCCCAGACCCCAACCCCAGG - Intronic
1057892008 9:98876526-98876548 GTGCCCCAAAATCCAACCGCAGG - Intergenic
1059417365 9:114170204-114170226 GCACCCCAAACTCCTACCGGGGG - Intronic
1061776854 9:132971392-132971414 GCACCCCAAACCTCACCCCATGG + Intronic
1062279770 9:135746757-135746779 TCGCCCCACACTCCACTCCAAGG - Intronic
1062326556 9:136015266-136015288 GCGCCCCAGAGCCCAACCCCAGG + Intronic
1062528080 9:136986207-136986229 GCGCTCCCAACTCTGACCCAGGG + Intronic
1192509990 X:71715961-71715983 GCGCCCCAAACTCCCAACTCTGG - Intronic
1192516707 X:71765592-71765614 GCGCCCCAAACTCCCAACTCTGG + Intronic
1195520512 X:105823080-105823102 CCGCACCAAACTCCAACGAAAGG + Intronic
1195698937 X:107687581-107687603 GCTCCCCATACCCCAACCCTGGG + Intergenic
1197718323 X:129726506-129726528 CCAACCCCAACTCCAACCCAGGG + Intergenic