ID: 1147960018

View in Genome Browser
Species Human (GRCh38)
Location 17:44161679-44161701
Sequence CAAGGGGAGCAGAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1376
Summary {0: 1, 1: 1, 2: 3, 3: 102, 4: 1269}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147960012_1147960018 -3 Left 1147960012 17:44161659-44161681 CCTTTTGTCATGTACGGGTACAA 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG 0: 1
1: 1
2: 3
3: 102
4: 1269
1147960005_1147960018 15 Left 1147960005 17:44161641-44161663 CCAGGGATTACGCCCCCGCCTTT 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG 0: 1
1: 1
2: 3
3: 102
4: 1269
1147960011_1147960018 0 Left 1147960011 17:44161656-44161678 CCGCCTTTTGTCATGTACGGGTA 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG 0: 1
1: 1
2: 3
3: 102
4: 1269
1147960004_1147960018 16 Left 1147960004 17:44161640-44161662 CCCAGGGATTACGCCCCCGCCTT 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG 0: 1
1: 1
2: 3
3: 102
4: 1269
1147960008_1147960018 2 Left 1147960008 17:44161654-44161676 CCCCGCCTTTTGTCATGTACGGG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG 0: 1
1: 1
2: 3
3: 102
4: 1269
1147960006_1147960018 3 Left 1147960006 17:44161653-44161675 CCCCCGCCTTTTGTCATGTACGG 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG 0: 1
1: 1
2: 3
3: 102
4: 1269
1147960003_1147960018 30 Left 1147960003 17:44161626-44161648 CCTCGTCAGAATGGCCCAGGGAT 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG 0: 1
1: 1
2: 3
3: 102
4: 1269
1147960010_1147960018 1 Left 1147960010 17:44161655-44161677 CCCGCCTTTTGTCATGTACGGGT 0: 1
1: 0
2: 0
3: 13
4: 46
Right 1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG 0: 1
1: 1
2: 3
3: 102
4: 1269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147960018 Original CRISPR CAAGGGGAGCAGAGGGAAGA TGG Intronic
900020366 1:183616-183638 GAAGGGGAGAAGAGGAAAGGGGG + Intergenic
900314031 1:2048283-2048305 GAAGGGGGGCAGAGAGTAGAGGG - Intergenic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900745348 1:4356910-4356932 CGAGGGGAGGAGGGGGGAGAAGG - Intergenic
900822739 1:4901776-4901798 CTAGTGGAGCTGTGGGAAGAAGG - Intergenic
900838998 1:5032183-5032205 ACAGGTAAGCAGAGGGAAGAGGG - Intergenic
900861040 1:5231581-5231603 CATAGGAAGCAGAAGGAAGAGGG + Intergenic
901095749 1:6678074-6678096 CAAGCGGAGCAGGGGGTTGATGG - Intronic
901129737 1:6954834-6954856 CCAGGCAAGCAGAGGGAAGGCGG - Intronic
901181167 1:7342675-7342697 TAAGGGGAGAATAGGGAAGAAGG + Intronic
901528523 1:9839265-9839287 CGAAGGGTGCAGAGGGGAGAAGG - Intergenic
901645877 1:10716462-10716484 CATGGGGAGCAGTGGGCAGAGGG + Intronic
901740338 1:11338069-11338091 GAGGGGGAGGAGAGGGAGGAGGG - Intergenic
901911600 1:12463281-12463303 CAAGTGGGGCAGAGGCAAGTAGG + Intronic
901936561 1:12630821-12630843 CAAGGGGGGCTGAGGGCAGCAGG + Intergenic
902084538 1:13848819-13848841 CTAGTGGAGCTGTGGGAAGAGGG + Intergenic
902375326 1:16027629-16027651 CAAGGGGCCCTGAGGGTAGAAGG + Intronic
902409317 1:16203608-16203630 GAAAGGCAGCAGAGGGAAGTTGG - Intronic
902793265 1:18783624-18783646 CAAAGGGTGGAGAGGGAGGAGGG + Intergenic
902936613 1:19769319-19769341 CAAGGAGAGCAGAGAGAGGAGGG - Intronic
903007252 1:20306983-20307005 CCAGGGGAGAAGAGGGAGGGAGG - Intronic
903189997 1:21651110-21651132 CAAGGGGTGCAGAGGTGGGATGG - Intronic
903218951 1:21858277-21858299 CATGGGAATCAGAGGGAAAAGGG - Intronic
903662294 1:24985507-24985529 CATGGGGAGAAGCAGGAAGAGGG - Intergenic
903674327 1:25054750-25054772 CATGGGGAGCAGGGGGAGCAGGG + Intergenic
904054036 1:27658691-27658713 CAACGTGGGCAGAGGGAAGGAGG + Intergenic
904058199 1:27686130-27686152 CCAGGGGAGCTGAGGGCAGGAGG + Intergenic
904848825 1:33441508-33441530 GAAGGGGAGGAGGAGGAAGAAGG - Intergenic
904914394 1:33959608-33959630 CAAGGGCAGCAGGAGGGAGAGGG - Intronic
904957546 1:34297617-34297639 AAAGGGGAGCTGAGGGCAGGGGG - Intergenic
905256416 1:36688390-36688412 GGAGGGGAGGAGAGGGAGGAGGG + Intergenic
905269638 1:36778989-36779011 GAAGGGGAGGGGAGGGAAGGGGG + Intergenic
905394836 1:37660614-37660636 GGAGGGGAGCCCAGGGAAGAAGG + Intergenic
905404626 1:37724551-37724573 GAAGGAGAGCAGAGGGAAACTGG + Intronic
905434201 1:37945912-37945934 GCAGGGGAACAGAGGGAAGGTGG - Intronic
905501940 1:38446328-38446350 CCAAGGTAGCAGATGGAAGAAGG - Intergenic
905542094 1:38767939-38767961 CAAGGGAGGCAGAGGGAAGCTGG - Intergenic
905871442 1:41406686-41406708 CAGGGGGAGAAGAGGAAAAAGGG - Intergenic
906034085 1:42740159-42740181 CAGGGGGAGCAGCGAGAAGGAGG + Exonic
906627827 1:47340009-47340031 GAAGGGGAGGGGAGGGAAGAGGG - Intronic
906670592 1:47651439-47651461 CAAGGAAAGCAGAGGCCAGAGGG + Intergenic
906832120 1:49044189-49044211 CAAGAGGAAGAGAGGGAAGTAGG + Intronic
906929643 1:50156458-50156480 AAGGGGGAGGAGAGGGAAGGTGG + Intronic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
907400577 1:54222536-54222558 AAAGGGGTGCAGAGAGGAGAGGG - Intronic
907412884 1:54294840-54294862 CAAGGACAGCAGAGGAAAAAGGG + Intronic
907466303 1:54640077-54640099 AAAAGGGAGCAGAGACAAGATGG + Intergenic
907525272 1:55050264-55050286 CAAGGTGGGCAGAGGCCAGATGG - Intronic
907552767 1:55318423-55318445 CAAGGAGAGGAAAGGGAAGCGGG - Intergenic
907716800 1:56933625-56933647 AAGGGGAAGCAGAGAGAAGATGG - Intronic
908004312 1:59712411-59712433 CTAGTGGAGCTGAGAGAAGAGGG - Intronic
908094402 1:60721722-60721744 CTAGGGGAGCTGTGAGAAGAGGG + Intergenic
908212233 1:61912678-61912700 GGAGGGGAGGGGAGGGAAGAGGG + Intronic
908768125 1:67572400-67572422 ACAGGAGAGCAGAGGGAAGGAGG + Intergenic
908804530 1:67916612-67916634 CAAGTAGAGCAGTGGGGAGAAGG - Intergenic
909004985 1:70265216-70265238 CAAGGTGACAAGAGTGAAGAGGG + Intronic
909538083 1:76760625-76760647 CCTGGGGAGCAGAGGGAAGTGGG + Intergenic
909736662 1:78970550-78970572 CAAGGACAGAAGAGGGAAAAAGG + Intronic
909741713 1:79037373-79037395 CTAGTGGAGCTGTGGGAAGAGGG + Intergenic
909774250 1:79464413-79464435 TTAGTGGAGCAGAGAGAAGAAGG - Intergenic
909953974 1:81754464-81754486 AAAGGGGAGGGGAGGGGAGAAGG - Intronic
910166850 1:84337200-84337222 CTAGTGGAGCTGAGAGAAGAGGG - Intronic
910305245 1:85754875-85754897 GAAGGGGAGGAGAGAGAAAAGGG + Intronic
910410004 1:86932718-86932740 CAAGGGGAGGAGACAGAAGAAGG + Intronic
911128251 1:94361677-94361699 CAAGAAGTGCAGAGCGAAGAGGG + Intergenic
911358090 1:96846003-96846025 GAGGGGGAGGAGAGGGAAGTGGG - Intergenic
911445387 1:97985638-97985660 AACGGTGAGCAGAAGGAAGATGG - Intergenic
911597851 1:99816936-99816958 CGAGTGGAGCAGAGGAAAGAGGG + Intergenic
911644114 1:100320466-100320488 CTAGTGGAGCTGTGGGAAGAGGG + Intergenic
912491443 1:110064857-110064879 CAAGGGCAGCTGGGGGAAGCTGG + Exonic
912614594 1:111085478-111085500 CAAGGGGGACAGGGGGAACATGG + Intergenic
912681936 1:111734310-111734332 AAAGGTGGTCAGAGGGAAGAGGG - Intronic
913090287 1:115472143-115472165 CAATGGGAGCAGAGGCAGGGAGG - Intergenic
913266072 1:117046019-117046041 CAAAGGCAGCAGAAAGAAGATGG + Intergenic
913402253 1:118449096-118449118 CTAGTGGAGCTGTGGGAAGAGGG + Intergenic
914829455 1:151160062-151160084 TGAGGGGAACAGATGGAAGAAGG - Exonic
915033644 1:152905004-152905026 CAAGAGGAGCAGAGGCATAAAGG - Intergenic
915212143 1:154318387-154318409 TAAGGGTTGCAGAGGGACGAAGG - Intergenic
915342998 1:155186380-155186402 GAAGGAGAGCAGAGGGAGGAGGG - Intronic
915461087 1:156070883-156070905 CAAGGGGAGAAGAGGGAGTGGGG + Intergenic
915597583 1:156904349-156904371 CAGGGGGAGCAAAGGAAACAGGG + Intronic
915722767 1:157996123-157996145 TGAGGGGAGCAGAGAGGAGAGGG + Intronic
915811861 1:158921296-158921318 AAATGAGAGCTGAGGGAAGAAGG - Intergenic
916197825 1:162241205-162241227 CAAGGGAAGCAGAGGAGAGGTGG + Intronic
916606021 1:166343156-166343178 CAGGGGGAGCAGGGGGAGCAGGG + Intergenic
916651125 1:166835662-166835684 GAAGGGGAGTAGAGGGAGGGAGG - Intergenic
916878135 1:168992282-168992304 ATAGGGGAGAAGAGGGAAGTAGG + Intergenic
917449625 1:175136324-175136346 AGAGGAGAGCAGAGGGAAAAGGG - Intronic
917905132 1:179580789-179580811 GAAGGGGTGGAGAGGGAAGAGGG + Intergenic
917949399 1:180015137-180015159 CAAGGGTGGCAGAGGCAAAAAGG + Intronic
918331391 1:183464233-183464255 AGAGGGGAGGGGAGGGAAGAGGG + Intergenic
918543538 1:185657609-185657631 GGAGGGGAGAAGGGGGAAGAGGG - Intergenic
918591370 1:186245134-186245156 CAAGTGGAGCTGTGAGAAGAGGG - Intergenic
918612068 1:186504225-186504247 CAAGGGCAGTGGAGGGAGGAGGG + Intergenic
918733119 1:188022996-188023018 GAAGGGGAGGGGAGGGGAGAAGG + Intergenic
918952748 1:191160690-191160712 GAAGGGAAGGAGAGGGGAGAGGG + Intergenic
919159329 1:193807898-193807920 TATGTGGAGCAGAAGGAAGATGG + Intergenic
919630364 1:199954871-199954893 GCTGGAGAGCAGAGGGAAGAGGG - Intergenic
919742722 1:200990462-200990484 CAAAAGGAGCAGAGGGAAGTGGG + Intronic
920111605 1:203591149-203591171 GCAGAGGAACAGAGGGAAGAAGG + Intergenic
920292048 1:204929982-204930004 CATGGGGATCAGAGGGCAGGAGG + Intronic
920578896 1:207086045-207086067 GAAGGGGAGCAGAGGGAGGCAGG + Intronic
920940459 1:210477348-210477370 CTAGGGAAACAGTGGGAAGAAGG - Intronic
920970901 1:210743128-210743150 CATGGGGAGTAGAAGAAAGAGGG + Intronic
921315758 1:213888578-213888600 GAAGGGGAGAAGAGGGGAGAGGG + Intergenic
921745798 1:218739581-218739603 CAAGGGGAGGAGTGGAAAGAGGG - Intergenic
922022131 1:221716036-221716058 GAAGGGTAGAAGAGGGGAGATGG - Intronic
922362964 1:224839849-224839871 CAAAGGGAGCTAAGGGAACAGGG - Intergenic
922574879 1:226654919-226654941 GAAGAGGAGAAGAGTGAAGAGGG + Intronic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
922920814 1:229301308-229301330 CAAGGAGAGGGCAGGGAAGAAGG + Intronic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923052059 1:230396037-230396059 AGAGGGAAGCAAAGGGAAGACGG - Intronic
923052065 1:230396065-230396087 AGAGGGAAGCAAAGGGAAGATGG - Intronic
923086656 1:230707786-230707808 TCAGACGAGCAGAGGGAAGACGG - Intronic
923274462 1:232384474-232384496 AGAGGGGAGGAGAGAGAAGAAGG - Intergenic
923482417 1:234397397-234397419 GATGGGGAGGAGGGGGAAGAGGG + Intronic
923784494 1:237054297-237054319 GGAGGGGAGAAGAGGGAGGAAGG - Intronic
923875813 1:238045776-238045798 CTTGGGGAGAAGAGGGGAGAGGG + Intergenic
923907504 1:238401778-238401800 CAGCCGGAGCAGGGGGAAGAGGG + Intergenic
923913979 1:238482181-238482203 CAAGGACAGCAGATGGAAAAAGG - Intergenic
924052407 1:240092217-240092239 GAAGGGGAGCGGGGGCAAGAAGG + Exonic
924641316 1:245836317-245836339 CGAGGGGAGCACAGGGATGCGGG - Intronic
924759201 1:246968532-246968554 CAAGTGGAGCTGTGAGAAGAGGG - Intronic
924946798 1:248851904-248851926 GAAGGGGCTCAGAGGGAAGATGG - Intronic
1063091677 10:2871026-2871048 AGTGGGGGGCAGAGGGAAGAAGG - Intergenic
1063223430 10:3992498-3992520 GAAGGGGAGGGGAGGGGAGAAGG - Intergenic
1063468263 10:6262772-6262794 CTAGAGGAGCAAAGGCAAGAGGG + Intergenic
1063687778 10:8254958-8254980 CAAAGAGGGGAGAGGGAAGATGG - Intergenic
1063688259 10:8258908-8258930 TAACTAGAGCAGAGGGAAGAAGG + Intergenic
1063847330 10:10145222-10145244 CATGGGGAGCAGTAGGAAGGAGG - Intergenic
1063987466 10:11520612-11520634 CAAGTGGAGGAGAAGAAAGAAGG + Intronic
1064048822 10:12042854-12042876 GAGGGGGAGCTGAGGGAAGGCGG - Intronic
1064279013 10:13933835-13933857 CTAGGGGAGCAGGGGGCAGGTGG + Intronic
1064443739 10:15375271-15375293 CTAGGGGAAGAAAGGGAAGAAGG - Intergenic
1064571238 10:16695391-16695413 AAAGCAGAGCAGAGGGAAGGAGG + Intronic
1064871279 10:19939635-19939657 CAAAGGGAGAAAAAGGAAGAGGG - Intronic
1065024108 10:21525620-21525642 GAAGGGGAGGAGAGAGGAGAGGG + Exonic
1065169106 10:23010180-23010202 GAAGGGAAGGAGAGGGAAGCTGG - Intronic
1065169243 10:23010628-23010650 AAAGGGAAGGAGAGAGAAGATGG - Intronic
1065725715 10:28666174-28666196 GAAGGGCTGCAGAGGGCAGAGGG - Intergenic
1065925057 10:30427822-30427844 AAAGGGGAGGAGAAGGAAAACGG + Intergenic
1066058765 10:31704290-31704312 AATGGGGAGCAGTGGGAAGGGGG + Intergenic
1066058982 10:31705965-31705987 AATGGGGAGCAGAGGGATGGGGG - Intergenic
1066334578 10:34463037-34463059 GAAGGGGAGGAAAGGGAAGGGGG + Intronic
1066569380 10:36754354-36754376 GAAGGGGAGGGGAGGGGAGAGGG + Intergenic
1068114525 10:52722755-52722777 CAGGAGGAACAGAGGGAACAGGG + Intergenic
1069567190 10:69471591-69471613 GGAGGGGAGGGGAGGGAAGAGGG - Intronic
1069755926 10:70774468-70774490 CGAGGGGACCTGAGGGCAGAAGG - Intronic
1069807087 10:71132801-71132823 ACAGGGGAGAAGAGGGAGGATGG - Intergenic
1069824079 10:71244661-71244683 CAAGAGGAGAGGAGGGAGGAGGG + Intronic
1069932133 10:71890029-71890051 GGAGGGGAGCAGAGGGCAGAGGG - Intergenic
1069943820 10:71972802-71972824 CAAGGGGAAAAGGGGGAAGGAGG - Intronic
1070483906 10:76911697-76911719 CAAGAGAGGCAGAGGGAAGCTGG - Intronic
1070500155 10:77065192-77065214 CAAGGTGAGCACTGTGAAGATGG - Intronic
1070566940 10:77610719-77610741 GACTGGGAGCAGAGGGAATAGGG + Intronic
1070655609 10:78269155-78269177 TATGGGGAGCTGAGGGAAGCAGG - Intergenic
1070982592 10:80661428-80661450 CAAGAGGAGCCAAGGGAAGGGGG + Intergenic
1071026196 10:81116605-81116627 CCAGGAGTGGAGAGGGAAGAGGG + Intergenic
1071531297 10:86391991-86392013 GAGAGGGAGCAGAGGGAAGCAGG + Intergenic
1071752472 10:88496062-88496084 CAAAGGGGACAGAAGGAAGAGGG + Intronic
1071888131 10:89972722-89972744 CAATGGGAGCAGAGAGGAGAAGG + Intergenic
1072019380 10:91383143-91383165 CTAGGGAAGCAGAGAGTAGAAGG - Intergenic
1072188201 10:93061504-93061526 CAGTGGGAGCCGGGGGAAGAAGG - Intronic
1072225634 10:93366084-93366106 CAAGGGAGGCAGTGGCAAGAAGG - Intronic
1072305903 10:94106982-94107004 CCAAGGAAGCAGAGGGGAGAGGG - Intronic
1072625636 10:97109563-97109585 AATGGGGTGAAGAGGGAAGATGG - Intronic
1072785036 10:98273562-98273584 CTGGGGGTGCAGGGGGAAGAGGG - Intergenic
1072794808 10:98346586-98346608 AAGGGGGAGGAAAGGGAAGAGGG + Intergenic
1072823555 10:98583028-98583050 CTAGGGGGGCATAGGGAAGCAGG + Intronic
1072908221 10:99474978-99475000 CAAGAAAAGGAGAGGGAAGAGGG + Intergenic
1072917237 10:99545556-99545578 GAGGGGGAGCAGTGGGAGGAGGG + Intergenic
1073053941 10:100687202-100687224 CCAGGGGACCAGAGGGCAGTTGG - Intergenic
1073065578 10:100757215-100757237 CAAGAGGAGAAAAGGGAGGAAGG + Intronic
1073081975 10:100866020-100866042 CAAAGGGTGCATGGGGAAGACGG + Intergenic
1073323330 10:102628605-102628627 CTGGGGGAGCAGAGGAAAGTAGG + Intronic
1073541838 10:104321381-104321403 CAACAGGGGCTGAGGGAAGATGG + Intronic
1073857803 10:107697518-107697540 GAAGGGGAGGGGAGGGAAGGGGG - Intergenic
1073937627 10:108652858-108652880 GGAGGGGAGGGGAGGGAAGAAGG + Intergenic
1074191773 10:111144411-111144433 GACGGGGAGGAGAGGGGAGAGGG - Intergenic
1074388287 10:113034964-113034986 AAAGGGGAGGAAAGGGAAGGAGG - Intronic
1074899558 10:117804406-117804428 GCAGGGGTGCAGAGAGAAGAGGG + Intergenic
1075224936 10:120620517-120620539 GAAGGGGAGCAGAGGATGGAAGG - Intergenic
1075312312 10:121424708-121424730 GAAGGAGGGTAGAGGGAAGAGGG + Intergenic
1075469612 10:122678217-122678239 CACAGGGAGGAGAGGGAAGTAGG + Intergenic
1075564562 10:123494126-123494148 AGAGGGAAGGAGAGGGAAGAGGG + Intergenic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1075813519 10:125246425-125246447 CAAGGGGAGGAGCGGGGAGATGG - Intergenic
1075923989 10:126235889-126235911 CAAGGGGAACACACGGAGGAGGG + Intronic
1076114604 10:127886574-127886596 AAAGGGGAGGAGAGAGAAAAGGG + Intronic
1076318930 10:129564336-129564358 GAAGGGGAGAAGAGGAAAGAGGG - Intronic
1076389378 10:130086947-130086969 CAAGGGGCGCAGGGGGCTGAAGG + Intergenic
1076594485 10:131617444-131617466 GAAGGTGGGCAGAGGGCAGAAGG + Intergenic
1076608867 10:131707915-131707937 CAGGGGGATCAGTGGGCAGAGGG + Intergenic
1076619652 10:131779044-131779066 CAAGTGGAGCAGAGGTCAGGAGG - Intergenic
1076667676 10:132102402-132102424 CATGGGGTACAGAGGGAGGAAGG - Intergenic
1076731819 10:132442962-132442984 CAGGCAGAGCAGAGGCAAGAAGG - Intergenic
1077057440 11:601674-601696 GAAGAAGAGAAGAGGGAAGAAGG + Exonic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077280433 11:1742538-1742560 CTAGGGGAGCAGCAGGAGGAAGG + Intronic
1077281215 11:1747113-1747135 CCAGGGCAGCCCAGGGAAGAGGG - Intronic
1077493051 11:2870947-2870969 CCAAAGGTGCAGAGGGAAGAGGG - Intergenic
1077497340 11:2892576-2892598 CAGGGGGAGCAGAGAGGAAATGG - Intronic
1077500335 11:2907150-2907172 CAAGGGGGACAGTGGAAAGAAGG + Intronic
1077531334 11:3097018-3097040 GAGGGGGAGGAGAGGAAAGAGGG + Intronic
1077708485 11:4512049-4512071 CAAGGGGAGCAGAGAAAAGCTGG + Intergenic
1078361306 11:10669951-10669973 AAAAGAGAGCAGAGGAAAGAGGG + Intronic
1078516084 11:12023579-12023601 CAAGTGGAGCTGTGAGAAGATGG + Intergenic
1079008809 11:16811813-16811835 CCAGGGCAGCAGAGGGGAGGTGG - Intronic
1079090057 11:17474666-17474688 CCAGGAGAGCAGAGGGAACACGG - Intronic
1079117960 11:17652574-17652596 CAGAGGGAGCAGTGGAAAGAAGG + Intergenic
1079318142 11:19427338-19427360 AAAGGGAAGCAGAAGGAAGAAGG - Intronic
1080428651 11:32178738-32178760 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1080682316 11:34488338-34488360 TAAGGGGAGCAAAGGCATGAAGG + Intronic
1080874869 11:36266130-36266152 CCAGGGAAGCTGAGGGAAGGTGG - Intergenic
1080915969 11:36659914-36659936 CAAGGAGAAAAGAGGGATGAAGG + Intergenic
1080931624 11:36817411-36817433 CAAGGGAATCAGTGGGGAGATGG - Intergenic
1081410991 11:42758401-42758423 AAAGGTGAGTAGAGAGAAGAAGG - Intergenic
1081737109 11:45411752-45411774 AAAGGAGGGGAGAGGGAAGAGGG - Intergenic
1081737836 11:45416717-45416739 CATGGGGAAGAGAGGGAGGAAGG - Intergenic
1081864675 11:46352948-46352970 CAGGGGGTGAAGAGGAAAGATGG - Intronic
1082143681 11:48641034-48641056 AAAGGAAAGGAGAGGGAAGAAGG - Intergenic
1082748474 11:56993866-56993888 CTAGTGGAGCTGTGGGAAGAGGG - Intergenic
1082777624 11:57259656-57259678 CAAAGGGAGAAGTGGGAAGAGGG - Intergenic
1083028378 11:59570092-59570114 AATGGAGGGCAGAGGGAAGAAGG - Intergenic
1083156742 11:60828047-60828069 ACAGGGGAGCCGAGGGAGGAGGG + Intergenic
1083246323 11:61430458-61430480 GAAGGGGAGCCCAGGGAAGTTGG - Intronic
1083250563 11:61464076-61464098 GAAGGGGAGGGAAGGGAAGAGGG - Intronic
1083429965 11:62609169-62609191 CAAGGGCAGGAGGAGGAAGAGGG + Intronic
1083735540 11:64678232-64678254 GATGGGGAGGAGAGGGAAGAGGG - Intronic
1084596154 11:70118190-70118212 GAGGGGGAGGAGGGGGAAGAGGG - Intronic
1084665204 11:70572545-70572567 CTAAGGGAGGAGAGAGAAGAGGG + Intronic
1084732051 11:71079926-71079948 GAAGGAGAGGAGAGGGAAGTGGG + Intronic
1084757533 11:71249266-71249288 AAAGGGAAGGAGAGGGGAGAAGG - Intronic
1084892187 11:72242036-72242058 CAATGGGCGCAAAGAGAAGATGG - Intronic
1084893570 11:72249707-72249729 CCAGGGGACCAGAGGGATGGGGG - Intergenic
1084937368 11:72594317-72594339 CAGAGGGTGCAGAAGGAAGATGG - Intronic
1084951222 11:72666652-72666674 CAATGTGAGCACAGGGATGAGGG - Intronic
1085086545 11:73671717-73671739 CAAGTGGAACTGTGGGAAGAGGG - Intergenic
1085418423 11:76335312-76335334 CTAGTGGAGCTGTGGGAAGACGG + Intergenic
1085447562 11:76610872-76610894 CAAGGCGAGCGGAGGGAGAAGGG - Intergenic
1085505416 11:77056088-77056110 AAAGGGGAGAAGAGGAGAGAAGG + Intergenic
1085738400 11:79058996-79059018 CAAGGAGAGCAGAGGATAAATGG + Intronic
1085831283 11:79903964-79903986 CCAGGAGAGCAGAGGTAAGGTGG - Intergenic
1085831922 11:79910768-79910790 AAAGGGGAGAAGAGGAAAAAGGG + Intergenic
1086931163 11:92694684-92694706 CCAGGGGAACAGAGGGCAAAGGG + Intronic
1087006665 11:93478384-93478406 AAAGGGAAGGGGAGGGAAGAGGG + Intergenic
1087086970 11:94229754-94229776 CAAGAGGTGCAGAGGGAATTGGG - Intergenic
1087138896 11:94746554-94746576 GAAAGGGAGAAGGGGGAAGAGGG - Intronic
1087255526 11:95948530-95948552 CTAGGGGAGCTGTGAGAAGAGGG - Intergenic
1087313756 11:96581526-96581548 AAAGGATAGCAGAGGGATGAGGG - Intergenic
1087474820 11:98622110-98622132 GAAGGGGAGGGGAGGGAAGGGGG - Intergenic
1087496255 11:98894068-98894090 CTAGTGGAGCTGTGGGAAGAGGG - Intergenic
1087575725 11:99986665-99986687 CAAGGAGAGCAGAGAAAAAAAGG - Intronic
1088325459 11:108596239-108596261 CAAGAAGAGTAGAGTGAAGATGG + Intergenic
1088995060 11:114989022-114989044 CAAGGGCAGCAAAGGGCAGATGG + Intergenic
1089116144 11:116096784-116096806 CAAGGGCAGGAAAGGGAAGTCGG + Intergenic
1089139241 11:116273085-116273107 CACAGGGAGCAAAGGGAAGGAGG + Intergenic
1089157489 11:116413672-116413694 AGAGGGGAGGGGAGGGAAGAGGG + Intergenic
1089276263 11:117338063-117338085 CAAGAGCAGCAGAAGGCAGAAGG - Intronic
1089457231 11:118632721-118632743 CAAGGGAAGCAGAGGCCCGAGGG - Intronic
1089636723 11:119818975-119818997 CACGCGGAGCTGAGGGGAGAGGG + Intergenic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1089750890 11:120650270-120650292 CAAGGGGTGCAGAGGGAGAGGGG + Intronic
1089785607 11:120904849-120904871 CAAGGAGGGCATTGGGAAGAGGG - Intronic
1089966027 11:122655741-122655763 CTAGGCGAGGAGAGGGAAGGGGG + Exonic
1090572964 11:128068071-128068093 CTAGGGGAGCTGTGAGAAGAGGG - Intergenic
1090749418 11:129732823-129732845 GAAGGGGAGGAGAGAGGAGAAGG + Intergenic
1090940575 11:131384599-131384621 CCAGGGAAGGAGAGGCAAGAAGG + Intronic
1091250740 11:134141756-134141778 CAAGGGGCACAGAGGGAGGCAGG + Intronic
1091373745 12:13224-13246 GAAGGGGAGAAGAGGAAAGGGGG + Intergenic
1091571635 12:1691496-1691518 GAAGGTGAGCAGAGGGCAGCAGG - Intronic
1091618970 12:2071213-2071235 AAAGGGAAGCAAAGGGAAGGAGG - Intronic
1091721998 12:2820565-2820587 CAAGGGTAGCAGCAGGAGGAAGG - Intronic
1092083472 12:5736863-5736885 AATGGGCAGCAAAGGGAAGAAGG - Intronic
1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG + Intronic
1092526434 12:9312740-9312762 GAAGGGGAGAACAGGAAAGAGGG + Intergenic
1092540841 12:9419045-9419067 GAAGGGGAGAACAGGAAAGAGGG - Intergenic
1092542143 12:9426657-9426679 CATGGGAAGAAGAGGGGAGAAGG + Intergenic
1092944273 12:13438711-13438733 CTAGGGGAGCTGTGAGAAGAGGG - Intergenic
1093014760 12:14144779-14144801 CAAGTGGAGCTGTGAGAAGAAGG - Intergenic
1093629773 12:21395006-21395028 CAAGGGGAGAGGAGCCAAGATGG + Exonic
1093926297 12:24911693-24911715 CGAGGGGTGGGGAGGGAAGAGGG - Intronic
1093980735 12:25472479-25472501 CAATGGGAGCAAATGGAAAAAGG + Intronic
1094270163 12:28605351-28605373 GAAGGGGAGGAGAAGGAATAGGG - Intergenic
1094331941 12:29303381-29303403 CAAGGAGAGCAGGAGAAAGAGGG - Intronic
1094510869 12:31095776-31095798 CATGGGAAGAAGAGGGGAGAAGG - Intronic
1094798433 12:34002318-34002340 CTAGTGGAGCTGTGGGAAGAGGG - Intergenic
1095111197 12:38296405-38296427 CTAGTGGAGCTGTGGGAAGAGGG - Intergenic
1095122594 12:38437115-38437137 CTAGTGGAGCTGTGGGAAGAGGG - Intergenic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1095960386 12:47830767-47830789 GAAGGGGAGGGCAGGGAAGATGG + Intronic
1096657163 12:53098804-53098826 CATGGGGGGCAGCGGGGAGATGG + Intronic
1096773252 12:53949750-53949772 CACAGGGAGCACAGGGAAGGGGG + Intergenic
1096816388 12:54204368-54204390 CAAGGGGAGATCAGGGAATATGG + Intergenic
1096968404 12:55646850-55646872 CCAGGGGAGTTGAGGGAAAATGG + Intergenic
1097277943 12:57825869-57825891 CAGGGGGAGCATGGGCAAGAGGG + Intronic
1097329171 12:58314609-58314631 CAGGGGGAGCTGAGGCCAGAGGG - Intergenic
1097501511 12:60409801-60409823 CTAGGGGAGCTGTGAGAAGAGGG - Intergenic
1097593344 12:61598532-61598554 TAAGGGGAGCATGGAGAAGAAGG - Intergenic
1097644588 12:62221172-62221194 GAAGGGGAGGGGAGGGGAGAAGG + Intronic
1097864697 12:64550297-64550319 GAAAGGGAGAAGAGAGAAGAGGG + Intergenic
1098009050 12:66031120-66031142 AAGGGGGAGCAGAGGGGAAATGG - Intergenic
1098060144 12:66553333-66553355 CAAGGGAGGGAGAGGGAAGGAGG - Intronic
1098524492 12:71470896-71470918 CAAGGGGAACATGGGTAAGATGG - Intronic
1099133207 12:78862784-78862806 GAAGGGGAGGAGAAGGAGGATGG - Intergenic
1099279716 12:80628814-80628836 AAAGTAGAACAGAGGGAAGAAGG + Intronic
1099336489 12:81366041-81366063 GAAGGGAAGGAAAGGGAAGAGGG - Intronic
1099724815 12:86412219-86412241 CTAGGGGAGCTGTGAGAAGAGGG + Intronic
1099778618 12:87165827-87165849 CTAGTGGAACAGTGGGAAGAGGG - Intergenic
1099845872 12:88027876-88027898 CAAGGGGGAGAGAGTGAAGATGG - Intronic
1099922083 12:88971248-88971270 AAAGGGGGTCAGTGGGAAGAGGG - Intergenic
1100405651 12:94270888-94270910 AAAGGGGAGCAGAGTGAAGAGGG + Intronic
1100600998 12:96111313-96111335 TAAGTGGAGCAGATGGAATAGGG + Intergenic
1100752701 12:97716716-97716738 CAAAGGGAGCAGAGGAGAGAAGG - Intergenic
1100898822 12:99215384-99215406 CAAGTGGAGCTGTGAGAAGAGGG + Intronic
1101102397 12:101407431-101407453 CAAGGGGAACCGAGAGAGGACGG + Intronic
1101222725 12:102657881-102657903 CTAGGGGAGCTGTGAGAAGAGGG - Intergenic
1101263348 12:103058029-103058051 CAAGGGAGGCAGAGGTTAGAGGG - Intergenic
1101673348 12:106896709-106896731 GAAGGGGAGGGGAGGGAGGAGGG + Intergenic
1101673364 12:106896740-106896762 GAAGGGGAGGGGAGGGAGGAGGG + Intergenic
1101843168 12:108342162-108342184 CAAGGGGAGGAGAGGGGAGAGGG + Intergenic
1102394197 12:112574036-112574058 AAAGGGGAGGAGGAGGAAGAGGG + Intronic
1102902249 12:116647443-116647465 GGAGGGGAGGAGAGGGAAGAAGG - Intergenic
1102921453 12:116794629-116794651 GAAGGGGAGGGGAGGGGAGAAGG + Intronic
1102924347 12:116815492-116815514 GAAGGGGACCAGAGGCAAGGAGG - Intronic
1102976087 12:117207967-117207989 GAAGGGGAGAAGAGAGGAGAAGG - Intergenic
1103859481 12:124000824-124000846 CAAAGGGTGAAAAGGGAAGAGGG - Intronic
1103964930 12:124632650-124632672 CAAAGAGAGGAGAGGGAGGAAGG - Intergenic
1104616365 12:130273330-130273352 TAAGGGGAGGAGGAGGAAGAGGG - Intergenic
1104895538 12:132161944-132161966 GGAGAGGAGCTGAGGGAAGAGGG - Intergenic
1105606563 13:21930897-21930919 GGAGGGGAGCAGAGGAAAAAGGG + Intergenic
1105831874 13:24169721-24169743 GAATGGGAGGTGAGGGAAGAAGG + Intronic
1105985401 13:25561278-25561300 CAAGAGATGCAGAGGGAACAGGG - Intronic
1106057746 13:26254379-26254401 GAAGGAGAGCCGAGGGACGAGGG - Exonic
1106196405 13:27497894-27497916 CAAGGGAAGCAAGGGGTAGAAGG - Intergenic
1106448928 13:29862429-29862451 AGAGGGAAGCGGAGGGAAGAGGG - Intergenic
1106576285 13:30978874-30978896 CAAAGAGAGCAGAGAGATGATGG - Intergenic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1107696787 13:43008127-43008149 AAAGGGCAGCAGAAGGAAAAGGG + Intergenic
1108392081 13:49956472-49956494 GAAGAGGAGGAGAAGGAAGAAGG - Intergenic
1108470097 13:50758906-50758928 CAAGGGGAGAAGATTGCAGAAGG + Intronic
1109169247 13:59075582-59075604 CTAGGGGAGCTGTGAGAAGAGGG - Intergenic
1110172907 13:72523853-72523875 CTAGGGGAGTAGAGAGAACAAGG + Intergenic
1110598302 13:77342520-77342542 CAAGTGGAGGAGAAGGAACATGG - Intergenic
1110669600 13:78161764-78161786 CAAGGTGAGGACAGGCAAGATGG + Intergenic
1110713038 13:78670962-78670984 AAAGGGTAGGAGAGGGAAGTAGG - Intergenic
1111101949 13:83599724-83599746 CAAGAGGAGCAGAGGCAAACAGG - Intergenic
1111111156 13:83711460-83711482 CAAGGGAAAAAGAGAGAAGAAGG + Intergenic
1111324252 13:86671049-86671071 CAAGTGAAGCATAGGGAAAATGG + Intergenic
1111420178 13:88000715-88000737 CATAGGGAGCAGAGAGATGAAGG - Intergenic
1111669447 13:91311373-91311395 CAGAGGGAGCAGACGAAAGAAGG + Intergenic
1111915048 13:94351939-94351961 CAAGGAGAGGAGAGAGAAGAAGG + Intronic
1111939116 13:94590592-94590614 GAAGGGGAGCAACGGGGAGATGG - Intronic
1112136279 13:96581808-96581830 CAAGGGGAGCAGGGAAAAAAAGG + Intronic
1112265572 13:97920352-97920374 TCGGGGGAGAAGAGGGAAGATGG - Intergenic
1112561722 13:100521280-100521302 CAAGGGGAGCACCAGGCAGACGG + Intronic
1112707287 13:102085105-102085127 CAAAGGGGGCAGAGGAAAGGTGG - Intronic
1113488795 13:110676310-110676332 CAAGGGGACCAGGGAGAAGGCGG + Intronic
1113784522 13:112995519-112995541 CCAGGAGAGCAGAGGGGAGCTGG + Intronic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114444039 14:22774320-22774342 CAGGTGGAGCAGAGGTAGGATGG + Intronic
1114630400 14:24155846-24155868 AAAGGGAAGCAGAGGGAGGGAGG + Intronic
1115106114 14:29763468-29763490 GGAGGGGAGGAGAGGGAGGAAGG + Intronic
1115113709 14:29855126-29855148 CAAGTGGAGCTGTGAGAAGAAGG + Intronic
1115205253 14:30896580-30896602 GGAGGGGAGGGGAGGGAAGAAGG + Intronic
1115359894 14:32488807-32488829 CAAGGGGAGCAGAAGCAGGGTGG - Intronic
1115465069 14:33706262-33706284 CAAGTGGTGGAGAGGGAGGATGG + Intronic
1115811296 14:37111270-37111292 CGAGGGGAGAAGACAGAAGACGG - Intronic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1116542285 14:46112992-46113014 CTAGTGGAGCTGAGAGAAGAGGG + Intergenic
1116931319 14:50694084-50694106 CAAGTGGAGCTGTGAGAAGAGGG - Intergenic
1117077508 14:52118978-52119000 AAAGGGGAGGAGAGAGAAAAAGG + Intergenic
1117197676 14:53356521-53356543 CGAGGGGGGCAAAGGGAAGGAGG + Intergenic
1117425711 14:55593974-55593996 TAAGTGCAGTAGAGGGAAGAAGG - Intronic
1117798224 14:59416513-59416535 CCAAGGGAGGAGAGAGAAGATGG + Intergenic
1118171781 14:63395727-63395749 GAGGAGGAGCAGAGGGAAAAGGG + Intronic
1118366446 14:65101696-65101718 CAAGGGGTGGGGAGGGAGGAAGG - Intronic
1118780529 14:69004842-69004864 CAGGGAGAGCTGGGGGAAGAGGG - Intergenic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1118896194 14:69947645-69947667 CAAGAGGAGAAGAGAGAGGAGGG - Intronic
1118910915 14:70061217-70061239 GAAGGGGAGGAGAAGGCAGAAGG + Intronic
1118995423 14:70831315-70831337 AAAGGAGAGCAGGAGGAAGAAGG - Intergenic
1119195503 14:72714346-72714368 CCAAGGAAGCACAGGGAAGAGGG + Intronic
1119205498 14:72790943-72790965 CACCAGGAGCAGAGGGAAGAGGG - Intronic
1119235766 14:73017967-73017989 GAAGAGGTGCAGAGGGAAGCAGG - Intronic
1119482271 14:74965455-74965477 CAAGGGGTGCAGAGGGGAGCCGG + Intergenic
1119651747 14:76388818-76388840 CAAGCTGAGAAGAGGGAAGTCGG - Intronic
1119799126 14:77427041-77427063 CTGGGGCAGCAGAGGGAAAATGG + Exonic
1119847437 14:77840895-77840917 GGAGGGGAGGGGAGGGAAGAGGG + Intronic
1119862683 14:77947899-77947921 CTAGGGGAGCTGTGAGAAGAGGG + Intergenic
1120056775 14:79933597-79933619 CAAGGGGTGGAGAGTGCAGAGGG + Intergenic
1120072902 14:80123351-80123373 CTAGTGGAGCTGTGGGAAGAGGG + Intergenic
1120405025 14:84083949-84083971 CTAGTGGAGCTGTGGGAAGAGGG - Intergenic
1120649557 14:87115421-87115443 CAGGGAAAGCAGAGGGAAAAGGG - Intergenic
1121209830 14:92199898-92199920 CAAGAAGAGCAGAGAGGAGAGGG + Intergenic
1121295020 14:92813522-92813544 CAAGGGGGCCAGAGAGAACATGG + Intronic
1121489128 14:94345535-94345557 CATGGTGGGAAGAGGGAAGAAGG - Intergenic
1121598135 14:95181519-95181541 CAAGGGCAGCAGGAGTAAGATGG - Intergenic
1121786598 14:96666184-96666206 AAAGGAGAGCAAAGGGAAGACGG - Intergenic
1122034085 14:98935004-98935026 CAAGGGGAGGACAGGGCAGAGGG + Intergenic
1122148125 14:99706268-99706290 CAACGGGAGTAGAGGGCAGGAGG + Intronic
1122508415 14:102247043-102247065 AGAGGGGAGCCAAGGGAAGAGGG - Intronic
1122612450 14:102994821-102994843 CAAGGGGAACGGATGGAAGTGGG - Intronic
1122647944 14:103207410-103207432 GGAGGGGAGGAGAGGGAGGAAGG - Intergenic
1122924010 14:104891571-104891593 TTGGGGGAGCATAGGGAAGAAGG + Intronic
1123155797 14:106224675-106224697 CATGGTGAGCAGGGGAAAGAAGG + Intergenic
1123402527 15:20002802-20002824 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1123434921 15:20247843-20247865 GGAGGGGAGGAGAGGGAGGAGGG + Intergenic
1123511865 15:21009456-21009478 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1124513603 15:30348067-30348089 AGAGGGGAGCAGAGGGGACAGGG - Intergenic
1124729318 15:32182698-32182720 AGAGGGGAGCAGAGGGGACAGGG + Intergenic
1124801230 15:32834818-32834840 CAAGGTGATCAGAGGGAACTAGG - Intronic
1124849364 15:33321429-33321451 CATGGAAAGCAGAGGGAAAAAGG - Intronic
1125230813 15:37453067-37453089 CAAGTGGAGCTGTGAGAAGAGGG + Intergenic
1125281231 15:38044351-38044373 GTAGGGGAGGGGAGGGAAGAAGG + Intergenic
1125281244 15:38044378-38044400 GGAGGGGAGGGGAGGGAAGAAGG + Intergenic
1125393289 15:39219171-39219193 GAAGGGTAGCTGGGGGAAGAGGG + Intergenic
1125407631 15:39370004-39370026 CTAGTGGAGCTGTGGGAAGATGG - Intergenic
1126141614 15:45444057-45444079 AAAGGGGAGAAGAGGAATGAAGG - Intronic
1126167656 15:45667106-45667128 GAAGGGGAGGGGAGGGAGGAAGG - Intronic
1126244117 15:46483799-46483821 TATGGTGTGCAGAGGGAAGATGG + Intergenic
1126957272 15:53947555-53947577 CAAGGTGATCAGAGGCATGATGG - Intergenic
1127479552 15:59365961-59365983 GAAGGGAAGAAGAGGGAAGGAGG - Intronic
1127681963 15:61306183-61306205 CAAAGGTAGCTGAGGGGAGATGG + Intergenic
1127966486 15:63926417-63926439 ATAGGGGAGCACAGGAAAGAGGG + Intronic
1128034073 15:64507775-64507797 AATAGAGAGCAGAGGGAAGATGG + Intronic
1128091479 15:64922041-64922063 CCAGGGGAGCCGAGGGGACAGGG - Intronic
1128341839 15:66827712-66827734 CAAGGAGAACAGAGGAAAGAAGG - Intergenic
1128355140 15:66921074-66921096 CCAGAGACGCAGAGGGAAGATGG + Intergenic
1128376074 15:67076891-67076913 CAAGGGGTGCAGGGGCATGAAGG + Intronic
1128457409 15:67839672-67839694 AGAGGGAAGCAGAGGCAAGATGG + Intergenic
1128669442 15:69563448-69563470 TAAGGGGAGAGGAGGGAACAGGG + Intergenic
1128705099 15:69832532-69832554 AAAGGGGAGGAGAGGGAAAGGGG + Intergenic
1128705105 15:69832548-69832570 AAAGGGGAGGAGAGGGAAAGGGG + Intergenic
1129082407 15:73052447-73052469 GGAGGGGAGGAGAGCGAAGAAGG - Intronic
1129174826 15:73832463-73832485 CTTTGGGAGCAGAGGGAATATGG - Intergenic
1129225710 15:74169261-74169283 TCAGGGGAGGGGAGGGAAGAAGG + Intergenic
1129252824 15:74318287-74318309 CAAGGGCAGGTGAGGGAGGAGGG + Intronic
1129281731 15:74490300-74490322 CAGGGTGAGCAGCCGGAAGAGGG - Intergenic
1129718581 15:77865639-77865661 CAAGGGAAACAGATGGTAGAAGG - Intergenic
1130069805 15:80636839-80636861 AAAGGGGAGCAGAGGGGAGGAGG + Intergenic
1130210695 15:81919061-81919083 CTAGCGGAGCTGAGAGAAGAGGG + Intergenic
1130460347 15:84155227-84155249 CAAGGGAAACAGATGGTAGAAGG + Intergenic
1130838200 15:87672487-87672509 CAGGGGGAGCAGAGGATGGAAGG + Intergenic
1130905703 15:88239631-88239653 TCAGGGGTGCAGAGAGAAGAGGG + Intronic
1131062532 15:89412720-89412742 CAAGGGGATGAGAGGGCTGAGGG + Intergenic
1131090893 15:89624375-89624397 CAGGGGGAGTTGAGGGAACAGGG - Exonic
1131297935 15:91168481-91168503 CAAGGCCAGCAGAGGAAAAAGGG + Intronic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131487524 15:92834048-92834070 CCAGGAGAGAAGAGGGAGGAGGG - Intergenic
1131545669 15:93313690-93313712 AAAAGGGAGGGGAGGGAAGAGGG - Intergenic
1131688109 15:94793204-94793226 CCTGGAGAGCAGAGGCAAGAGGG - Intergenic
1131867807 15:96730710-96730732 CCAGAGAAGCAGAGGGTAGAGGG + Intergenic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1131989484 15:98079722-98079744 AAAGGGAAGCATGGGGAAGAAGG - Intergenic
1132186423 15:99805888-99805910 CAAGGGGAGGAGGGGGCAGCCGG + Intergenic
1132235422 15:100216566-100216588 CAAGGAGAGCAAAGGTAAGGAGG - Intronic
1132406290 15:101543381-101543403 CAAGGGAAGCGGAAGGAGGAAGG - Intergenic
1132429255 15:101746822-101746844 CAAGGGGAGGAGGGGGCAGCCGG - Intergenic
1132537335 16:489025-489047 CACGGGAAGAAGAGGGAGGAGGG - Intronic
1132801704 16:1757868-1757890 CGATGGGAGCAGAGGGCAGCAGG + Intronic
1133070611 16:3244298-3244320 GAAAGGGAGCAGAGAGAAGCTGG + Intronic
1133270646 16:4609534-4609556 CAAGGGGTGCAGACAGAAAAGGG + Exonic
1133359279 16:5161062-5161084 CAAGGGGAGGAGATAGGAGAGGG - Intergenic
1133577480 16:7107618-7107640 GAAGGGGAGGAGCGGAAAGAAGG - Intronic
1133589541 16:7229517-7229539 AAAGGAGAGGAGAGGGAGGAAGG + Intronic
1133589596 16:7229725-7229747 CAAGGGAGGGAGGGGGAAGAAGG + Intronic
1133813193 16:9177246-9177268 GGAGGGGAGAGGAGGGAAGAGGG - Intergenic
1134131641 16:11654357-11654379 CCAGGGGAGCAGTGGGCAGATGG - Intergenic
1134212473 16:12289304-12289326 CCAAGGGAGAGGAGGGAAGAAGG - Intronic
1134330811 16:13249695-13249717 CAAGTGAAGGAGAAGGAAGAGGG - Intergenic
1135147989 16:19979733-19979755 GAAAGGGAGAAAAGGGAAGAGGG + Intergenic
1135187699 16:20329437-20329459 AAATGGGAGCAGAGGGAGAAAGG - Intergenic
1135325636 16:21523745-21523767 CAATGTGTGCAGAGGGAACACGG + Intergenic
1135603344 16:23801757-23801779 GGAGGGGAGGGGAGGGAAGACGG - Intergenic
1135671141 16:24376623-24376645 CATGGTGGGGAGAGGGAAGAAGG - Intergenic
1135722101 16:24826816-24826838 CCAGGGGAGCAGAGCAAGGAGGG - Intronic
1135913868 16:26586032-26586054 CATGGGAAGCAAGGGGAAGAGGG - Intergenic
1136774258 16:32863210-32863232 ATCGGGGAGCAGAAGGAAGAGGG + Intergenic
1136849699 16:33603145-33603167 GGAGGGGAGGAGAGGGAGGAGGG - Intergenic
1136872452 16:33820047-33820069 CTAGTGGAGCTGAGAGAAGAGGG - Intergenic
1136896353 16:33998304-33998326 ATCGGGGAGCAGAAGGAAGAGGG - Intergenic
1137406888 16:48196279-48196301 CAGGAGGAGGAGATGGAAGAAGG - Exonic
1137462788 16:48680529-48680551 CATTGGGAGCAGAAGGAAGGTGG - Intergenic
1137498418 16:48990395-48990417 GAAGGGGAAGGGAGGGAAGAAGG + Intergenic
1137540920 16:49361076-49361098 CAAGGGGACTAGAAGGGAGAGGG - Intergenic
1137719129 16:50617487-50617509 CAAAGGGAGCCGGGTGAAGATGG + Intronic
1137894365 16:52195091-52195113 GAAGGGGAGCAGTGGGCAGTGGG - Intergenic
1138260308 16:55615436-55615458 AAAGAGGAACAGAAGGAAGATGG + Intergenic
1138315464 16:56065923-56065945 CACAGGGAGCAGAGGGATGAAGG - Intergenic
1138891715 16:61150673-61150695 CAAGGAGAGCAGAGAGGAGCAGG - Intergenic
1138894822 16:61190803-61190825 GAAGGGGAAGAAAGGGAAGAAGG - Intergenic
1139589252 16:67924324-67924346 CTTGGGGAGCAGCGGGGAGAGGG + Intronic
1139908484 16:70382018-70382040 CAAGGGCTGCAAAGGGAAGGTGG - Intronic
1139959493 16:70709581-70709603 CAAGGGTACGAGAGGGAAGCAGG + Intronic
1140232288 16:73127284-73127306 CAGGCAGAGAAGAGGGAAGAAGG + Exonic
1140254351 16:73322125-73322147 CTCGGAGAGCAGAGGGAGGAAGG + Intergenic
1140686473 16:77438306-77438328 TAAGAGGAGCAGAGGGAGGGAGG + Intergenic
1141315680 16:82960469-82960491 CAAGGGGAGATGTGGGAAGCTGG + Intronic
1141413106 16:83849655-83849677 CCTGGGGTGCAGATGGAAGAGGG + Intergenic
1141486289 16:84342389-84342411 CTAGGTCAGGAGAGGGAAGAGGG + Intergenic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141529457 16:84636154-84636176 TTTGGGGAGCAGGGGGAAGATGG + Intergenic
1141667758 16:85474655-85474677 AAAGGAGAGGAGGGGGAAGAGGG - Intergenic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1141835550 16:86536721-86536743 CAAGGCGTGCAGATGGAAGCTGG - Intronic
1141846286 16:86611150-86611172 GAAGGGGAGCTGAGAGCAGAAGG - Intergenic
1141891769 16:86930911-86930933 GAGGGGGAGGAGGGGGAAGAAGG - Intergenic
1142035672 16:87861033-87861055 AAAGGGCAGCAGCGGGAAGAGGG + Intronic
1142137826 16:88459731-88459753 GAAGGGGAGGAGGAGGAAGAGGG - Intronic
1142158336 16:88543566-88543588 AAAGGAGAGCAGAGGGAATGGGG - Intergenic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142359516 16:89619622-89619644 GGAGGGGAGCAGAGGGAGCAGGG - Intronic
1142368442 16:89663695-89663717 GAAGGGCAGCAGGAGGAAGATGG + Intronic
1203076682 16_KI270728v1_random:1125329-1125351 ATCGGGGAGCAGAAGGAAGAGGG + Intergenic
1203099720 16_KI270728v1_random:1296021-1296043 CTAGTGGAGCTGAGAGAAGAGGG + Intergenic
1142489081 17:266348-266370 TGAGGGGAGCACAGGGATGACGG - Intronic
1142545299 17:697378-697400 CCAGGGGAGCATAGGTAATATGG + Intronic
1142766549 17:2067660-2067682 CATGGGGAGGGGAAGGAAGACGG + Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1143141740 17:4745088-4745110 GGAGGGGAGCAGGGGGAGGACGG - Intronic
1143173624 17:4944358-4944380 AAAGAGAAGCAGAGGTAAGAAGG - Intronic
1143233030 17:5373770-5373792 CTAGGGGAGGAGGGGGAATAAGG - Intronic
1143420357 17:6786357-6786379 TAGGGGGTGCAGAGGGAAGTGGG + Intronic
1143520646 17:7442428-7442450 CAAAGGGAGGACAAGGAAGAGGG - Intronic
1143550885 17:7629883-7629905 CTAGAGGAGGAGAGGGGAGATGG + Intronic
1143569064 17:7743161-7743183 GAAGGGGAGTATAGGGAAAAGGG - Intronic
1143900388 17:10170137-10170159 AGGGGGGAGCAGAGGGTAGAAGG - Intronic
1143916196 17:10295180-10295202 CTAGAAGAGCAGAGGGAAGGAGG - Intergenic
1143921742 17:10335864-10335886 CACCGGGAGCAGAGAGAAAAAGG + Intronic
1144478417 17:15609289-15609311 GAGAGGGAGCAGAGGAAAGAGGG - Intronic
1144521252 17:15953564-15953586 CAAGTGGGGCATAGGGGAGAAGG - Intronic
1144765111 17:17728341-17728363 CTTGGAGACCAGAGGGAAGACGG - Intronic
1144834840 17:18151365-18151387 CAAGGGGCGCGGTGGGAACAGGG - Intronic
1144919873 17:18754422-18754444 GAGAGGGAGCAGAGGAAAGAGGG + Intronic
1145046163 17:19618327-19618349 AAAGCGGAGGAGAGGGAAGAGGG + Intergenic
1145813857 17:27781542-27781564 CTGGGAGAGCAGGGGGAAGATGG - Intronic
1145868844 17:28257345-28257367 GAAGGGGAGGAAAGGAAAGAAGG + Intergenic
1145983410 17:29027838-29027860 CAAGGGAAGGAGGGGGAAAATGG - Intronic
1145994352 17:29096968-29096990 GAAGGTGAGGAGAGGGAAGTGGG + Intronic
1146144495 17:30401271-30401293 AAAGAGGAGGAGAAGGAAGAAGG - Intronic
1146272948 17:31496458-31496480 CCAAGGGAGCAGAGGGAAACTGG + Intronic
1147759578 17:42788649-42788671 CAAAGTCAGCAGAGGGGAGAAGG - Intronic
1147879304 17:43643634-43643656 CCAGGAGAACAGAGGGAAGCCGG - Exonic
1147909837 17:43848927-43848949 CAGGAGCTGCAGAGGGAAGAGGG + Intronic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1147990493 17:44329604-44329626 CAAGTGGAGAAAAGGGAATAAGG + Intergenic
1148029376 17:44608985-44609007 CAAAGGGAGCAAGAGGAAGAAGG + Intergenic
1148206700 17:45784171-45784193 GAAGGGGAGCGGAGGGGAGAGGG + Intergenic
1148820803 17:50358487-50358509 CAAGGGCAGCACAAGGAAGCGGG - Exonic
1149107088 17:52982606-52982628 AAAGGGGAGGAGAAGGAGGAGGG - Intergenic
1149304630 17:55335827-55335849 GGGAGGGAGCAGAGGGAAGAGGG - Intergenic
1150132391 17:62676190-62676212 CAAGGGGTGCAGAGAATAGAAGG + Intronic
1150149484 17:62797596-62797618 CCAGGGGAGCAAGGTGAAGAAGG + Intronic
1150627718 17:66852821-66852843 AAAGGGAAGCGAAGGGAAGAAGG - Intronic
1150712840 17:67546451-67546473 CTACAGGAGCACAGGGAAGAGGG - Intronic
1150784656 17:68152622-68152644 TAAGGGGAGGAGAGGGGAGGGGG - Intergenic
1150987437 17:70214054-70214076 CTAGTGGAGCTGTGGGAAGATGG + Intergenic
1151161775 17:72172112-72172134 GGAGGGGAGGAGAGGGGAGAGGG - Intergenic
1151266436 17:72959569-72959591 GAAGGGTGGCAGAGGGAGGAGGG + Intronic
1151337307 17:73447530-73447552 CCAGGGGATCATTGGGAAGATGG - Intronic
1151345799 17:73500499-73500521 GAAGGAGAACAGAAGGAAGATGG - Intronic
1151529401 17:74695015-74695037 TGAGGGGAGCAGGGGGCAGACGG + Exonic
1151887787 17:76933323-76933345 GGAAGGGAGCAGAGGGTAGAGGG - Intronic
1152163694 17:78686713-78686735 CAAAGGCAGGGGAGGGAAGATGG + Intronic
1152214926 17:79026613-79026635 CAAGAGGAGGAGAGGGAGGCGGG - Intronic
1152322021 17:79613018-79613040 CATGGGGAGCTGAAGGGAGACGG - Intergenic
1152400809 17:80065164-80065186 AGAGGGGAGGAGAGGGAGGAGGG - Intronic
1152867386 17:82732357-82732379 CCAGGGGAGCCGAGAGGAGATGG + Intergenic
1152992615 18:377080-377102 AAAGGGGAGGAAAGGGAAGAGGG + Intronic
1153947272 18:10029049-10029071 GAAGAGGAGGAGAGTGAAGAAGG + Intergenic
1154236785 18:12613459-12613481 CTAAAGGAGCAGAGAGAAGAAGG - Intronic
1155048946 18:22129962-22129984 CAAGGGAAGGGAAGGGAAGAGGG - Intergenic
1155053921 18:22169365-22169387 CGAGGGGAGGAGAGAAAAGAGGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156035385 18:32760879-32760901 CAAGGGCATCAGAAGGAAGTGGG - Intronic
1156077783 18:33301427-33301449 CCAGTGGAGCTGTGGGAAGATGG + Intronic
1156723509 18:40099469-40099491 CACAGGGATCAGAGGGAAGGTGG + Intergenic
1156791755 18:40984096-40984118 CAGGGGGAGGAGGAGGAAGAGGG - Intergenic
1156976149 18:43223818-43223840 CAAGGGGAGGAGTGAGAGGAGGG - Intergenic
1157301676 18:46484016-46484038 CTTGGAGAGCAGAGGGAGGAGGG + Intronic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157726722 18:49970077-49970099 CAAGGGGAGGAGAGGTATAAAGG + Intronic
1157801138 18:50622301-50622323 GAAAGGGGGAAGAGGGAAGAAGG + Intronic
1158544501 18:58384676-58384698 CCAGGGGAGCAGAGGTATCAGGG - Intronic
1158813658 18:61068338-61068360 AAGGGGGAGCCCAGGGAAGAAGG - Intergenic
1158898008 18:61933714-61933736 CAATGGGAGCACAGGGAATAGGG + Intergenic
1159020968 18:63142730-63142752 CAAGGGGAGCTGACGGATGGTGG + Intronic
1159261290 18:66016239-66016261 CTAGTGGAGCTGAGAGAAGAGGG - Intergenic
1159759578 18:72408091-72408113 CTAGTGGAGCTGTGGGAAGAGGG + Intergenic
1160146704 18:76371418-76371440 CAAGGGGAGCAGAGGAAGAGGGG - Intronic
1160701430 19:509239-509261 AACGGGGAGCAGGAGGAAGATGG + Intronic
1160878741 19:1310088-1310110 CAATGGGATCACAGGGAAGGCGG - Intergenic
1160983295 19:1826515-1826537 AAAGGGGAGGCGAGGGGAGAGGG + Intronic
1161026427 19:2039350-2039372 GAAGGTGAGCAGAGGGTAGGTGG - Exonic
1161083683 19:2324034-2324056 CGAGGGGGGCAGTGGGACGAGGG - Intronic
1161085419 19:2332902-2332924 GCAGGGGAGCAGAAGGAAGGTGG + Intronic
1161290295 19:3490516-3490538 CAACAGGAGCTGGGGGAAGACGG + Intergenic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161370583 19:3908772-3908794 GAAGAGGAGGAGAAGGAAGAGGG - Intronic
1161374667 19:3933350-3933372 GAAGGGGAGGAGAGGGGAGGAGG + Intronic
1161664214 19:5565143-5565165 CAAGGGGGAGAGAGGGAGGAAGG - Intergenic
1161792804 19:6370748-6370770 CAAGGGGAGCAGAGGGTGGGGGG + Intergenic
1161926426 19:7303597-7303619 GGAGGGGAGGAGAGGGAGGAAGG + Intergenic
1161961780 19:7527423-7527445 CTGGGGAAGCACAGGGAAGAAGG + Intronic
1162080482 19:8214939-8214961 GAGGGGGAGGAGAGGGAGGAGGG + Intronic
1162085614 19:8247254-8247276 CAAGGGGGAGAGAGGGAGGAGGG - Intronic
1162516198 19:11149283-11149305 CAAGGAGAGCAGAGAGAAGGTGG + Intronic
1163351305 19:16777810-16777832 GAAGGGGAGGGAAGGGAAGAGGG + Intronic
1163415063 19:17181317-17181339 CACGGGGAGGAGACGGAGGATGG - Intronic
1163548471 19:17952442-17952464 AAAGGGGAGCTGCGGGAGGAGGG + Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163752458 19:19085828-19085850 CAAGAGGAGAGGAGGGGAGAGGG + Intronic
1163760805 19:19135436-19135458 AAAGGGAAGAAGAGGGAGGAGGG - Intronic
1163864894 19:19764828-19764850 GAAGGGGAGGGGAGGGGAGAAGG - Intergenic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1164322149 19:24158944-24158966 GAAAGGGAGAATAGGGAAGAAGG - Intergenic
1164463232 19:28465880-28465902 GAAGGAGAGAAGAAGGAAGAAGG + Intergenic
1164597421 19:29539402-29539424 CCAGGGGAGAAGTGGGGAGAAGG + Intronic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165367746 19:35379624-35379646 AAAGGGGAGGGGAGGGAAAAGGG - Intergenic
1165719574 19:38069503-38069525 CAGAGAGAGCAGAGAGAAGAGGG - Intronic
1166184226 19:41128891-41128913 GAAGAGGAGGAGAAGGAAGAAGG + Intergenic
1166326857 19:42056394-42056416 CACAGGAAGCAGGGGGAAGAGGG + Intronic
1166504213 19:43361423-43361445 GCTGGGGAGCAGAGGGAAGGTGG - Exonic
1166506246 19:43373335-43373357 GCTGGGGAGCAGAGGGAAGGTGG + Intergenic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1167153227 19:47722267-47722289 CATGGGGCGGGGAGGGAAGAAGG - Intronic
1167349642 19:48966444-48966466 CAAAGGGAGCAGAGGCTTGAGGG - Intronic
1167435028 19:49474345-49474367 CAGGGGGAGCAGAGGGTGGGGGG + Intronic
1167461028 19:49624871-49624893 CAAGTGGAGCAGAGTGGGGAGGG + Exonic
1167621631 19:50564012-50564034 CAAGGGAAGGAGAGTGGAGAGGG + Intronic
1168042242 19:53768040-53768062 AAAGGGGAGCAAAGGGAAAACGG - Intergenic
1168153607 19:54461589-54461611 CACTGGGGGCAGAGGGAGGAGGG - Exonic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
1168688204 19:58361244-58361266 AACGGGGAGCAGAGGTAGGAGGG + Intronic
925402887 2:3588323-3588345 GAAGCGGGGCAGAGGGAAGGGGG - Intergenic
925663552 2:6228542-6228564 GGAGGGGAGGAGAGGGAGGAAGG - Intergenic
925828716 2:7875535-7875557 CAAGAGGAGGATTGGGAAGAAGG + Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926166162 2:10523082-10523104 CAGGGGCAGCAGAGGGCAGTGGG + Intergenic
926210537 2:10866167-10866189 CAGGAGGAGGAGAGGGAAGAGGG - Intergenic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
926384880 2:12326226-12326248 AAAGGGCAGCATTGGGAAGAGGG + Intergenic
926456488 2:13073927-13073949 CAAGGAGAGCTGTGAGAAGAGGG - Intergenic
926828229 2:16931287-16931309 CAAGGGAAGAATAGGGGAGAAGG - Intergenic
927515141 2:23667876-23667898 AAAGAGGAACAGAGGGAGGACGG - Intronic
929246746 2:39710475-39710497 AAAGGGGAGGGGATGGAAGAGGG + Intronic
929380009 2:41338035-41338057 AAAGAGGAACAGAGGGAAGGAGG + Intergenic
929419810 2:41779092-41779114 CCAGGGAAACAGATGGAAGAGGG + Intergenic
929559444 2:42946643-42946665 CAAGGGGAGGGTGGGGAAGAAGG - Intergenic
929811409 2:45192116-45192138 TAAGTGGGGGAGAGGGAAGAAGG - Intergenic
930000304 2:46856700-46856722 CAAGGGGAGGTGAGAGAAGGAGG + Intronic
930288109 2:49459473-49459495 GAAAGGAAGAAGAGGGAAGAAGG + Intergenic
930542515 2:52724678-52724700 CAAGGGGATTAGTGGGCAGAAGG - Intergenic
930755371 2:54967555-54967577 CAAGAGGACCACAGGGAACAGGG + Intronic
931064689 2:58572104-58572126 CAGGAGGGGCAAAGGGAAGATGG - Intergenic
931423754 2:62152109-62152131 GGAGGTGAGCAGAGGGAAGATGG - Intergenic
931597695 2:63967766-63967788 AAGGGGTAGCAGAGGGATGAGGG + Intronic
931992797 2:67807892-67807914 CAAGTGGAGGAGGAGGAAGAAGG - Intergenic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932459631 2:71873840-71873862 CAAGGAGAGCAGAGAGTTGAGGG + Intergenic
932496936 2:72150214-72150236 CAAGGGGGGCTGAGGGAAGCAGG - Intergenic
932528236 2:72496617-72496639 GGAGGGGAACAGAGGGAAGGTGG + Intronic
932668608 2:73718106-73718128 AAAAGGGAACAGAGGGAGGAGGG - Intergenic
932834448 2:75023185-75023207 CAGGGGGAGTAGAGGGAGCAAGG + Intergenic
933267684 2:80199920-80199942 CAGGGAGAGCAGAGGGCAGGAGG + Intronic
933441107 2:82315400-82315422 GAGGGGGAGGAGAAGGAAGAGGG - Intergenic
933620539 2:84534686-84534708 CAAGAGGAAAAGAGGAAAGAAGG - Intronic
933663468 2:84946095-84946117 CGAGGGGAGGGGAGGGGAGAGGG + Intergenic
933699853 2:85246844-85246866 CAAGTGGACAAGAGGGAAGGAGG - Intronic
933837788 2:86259842-86259864 CTAGGGGAGAAGTGGGAAGAGGG + Intronic
933855710 2:86412260-86412282 GAAAGGGAGAAGAAGGAAGAAGG - Intergenic
933977777 2:87525683-87525705 CAAAGGGAGCAAAGGCAAGCAGG + Intergenic
934512486 2:94956967-94956989 CAGGGGGAGCAGAAGGAAATGGG - Intergenic
934818957 2:97355366-97355388 CAAGGGAAGCAGATGTATGAGGG + Intergenic
934891896 2:98078027-98078049 CTAGTGGAGCTGTGGGAAGAGGG - Intergenic
934947135 2:98550196-98550218 TATGGGGAGCAGGGGGGAGACGG - Intronic
934962314 2:98687503-98687525 GAAAGTGAGAAGAGGGAAGAAGG - Intronic
935362247 2:102256482-102256504 CAAGTGGAATAGAGGGTAGATGG - Intergenic
935876401 2:107512612-107512634 AAAGGGCAGCACAGGGAAGCAGG - Intergenic
936316053 2:111425124-111425146 CAAAGGGAGCAAAGGCAAGCAGG - Intergenic
936407095 2:112214545-112214567 CAAGGGGAGCAGAGGGAAGTAGG + Exonic
936549821 2:113427485-113427507 CTAGTGGAGCAGTGAGAAGAGGG + Intergenic
936569071 2:113600319-113600341 GAAGGGGAGAAGAGGAAAGGGGG - Intergenic
936918218 2:117661585-117661607 CCTGGGGACCCGAGGGAAGAGGG + Intergenic
937150511 2:119682828-119682850 CAAGGAGAGCAGAGGGGTGGAGG + Intronic
937257243 2:120564282-120564304 CGAGGCGGGCAGAGGGAAGGAGG + Intergenic
937259218 2:120574776-120574798 CAAGGGCAGTAGGGGGCAGATGG - Intergenic
937629591 2:124085544-124085566 CAAAGGTAGCAGAAGGAAGAGGG - Intronic
937726765 2:125175976-125175998 CTAGGGGAGCTGTGGGAAGAGGG + Intergenic
937827950 2:126388409-126388431 CTAGTGGAGCTGTGGGAAGAGGG + Intergenic
937854708 2:126663821-126663843 CCAGGTGAGCCGAGGGAAGGAGG - Intronic
938062289 2:128263038-128263060 CAAGGGGAGCAGTGGGGAGCAGG + Intronic
938371543 2:130771664-130771686 CAAGGGGAGGTGGGGGAACAGGG + Intergenic
938944127 2:136195582-136195604 CAAAGTGAGCTGGGGGAAGATGG - Intergenic
939404061 2:141732890-141732912 CAAAGGAAGCAGAGGAAAAATGG + Intronic
939447977 2:142334497-142334519 CTAGTGGAGCTGAGGGAAGGAGG - Intergenic
939623251 2:144446413-144446435 AAAGGGGAGCAGAGGGGATGTGG - Intronic
939731709 2:145792921-145792943 CCAGGGAAGTAGGGGGAAGATGG + Intergenic
940408824 2:153336230-153336252 CTAGTGGAGCTGTGGGAAGAGGG + Intergenic
941194315 2:162428332-162428354 GAAGGGGAGAAGGAGGAAGAGGG - Intronic
941272561 2:163448692-163448714 CAAGGGGAGGGGAGGGGAGGGGG + Intergenic
941376452 2:164737234-164737256 CCAGGAAAGCAAAGGGAAGAGGG + Intronic
941489699 2:166127613-166127635 GAAGAGGAGGAGAGGGAGGAGGG + Intronic
941809207 2:169738935-169738957 GAGGGGGAGGAGAGGGAAGGAGG - Intronic
941809214 2:169738953-169738975 AAGGGGGAGGAGAGGGAGGAGGG - Intronic
941918568 2:170828149-170828171 CGAGGACAGCAGAGGGAGGAGGG - Intronic
941918704 2:170828733-170828755 CGAGGACAGCAGAGGGAGGAGGG - Intronic
941918735 2:170828853-170828875 CAAGGACCGCAGAGGGAGGAAGG - Intronic
942581522 2:177424105-177424127 CAAGGGGAGCAGTAGAAGGAGGG - Intronic
942733329 2:179082610-179082632 CTAGGGGAGCTGTGAGAAGAGGG - Intergenic
942787863 2:179720544-179720566 CAAGGGGAGGAGAGGGAGGGAGG + Intronic
942807298 2:179946475-179946497 GAAGGGGAGGGGAGGGAGGAAGG + Intronic
943124798 2:183782932-183782954 CTAGGGGAGCTGTGAGAAGAGGG + Intergenic
943591636 2:189804848-189804870 CAAGGAAAGCATTGGGAAGAAGG - Intronic
943748046 2:191482842-191482864 GATGGGGAGCTGAGGGGAGAGGG + Intergenic
943801130 2:192059390-192059412 CATGGGGATAAGAGGGAAGCTGG + Intronic
943806214 2:192130263-192130285 GAAGGGGAGAAGAAGGAAAAAGG - Intronic
944832732 2:203549124-203549146 AGAGGGGAGGGGAGGGAAGAAGG - Intergenic
946037682 2:216756702-216756724 CAGGGGGAGCTGCCGGAAGAAGG + Intergenic
946340132 2:219061108-219061130 CAGGGGGCGCAGAGGGCAGCGGG - Intergenic
946399375 2:219460669-219460691 GAGGGGGAGGAGAGGGGAGAGGG - Intronic
946552845 2:220822547-220822569 GAAGGGGATCAGGGAGAAGAAGG - Intergenic
946856065 2:223951026-223951048 GAAGGGGAGCAGGGGGAGGTTGG - Intergenic
946892320 2:224290542-224290564 AAAGGGGAAGAGAGGAAAGATGG - Intergenic
947118898 2:226797585-226797607 GAAGGCGAGCAGCGGGAAGCCGG + Exonic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947492910 2:230611253-230611275 CCAGGGCAGCAGAGGGTGGAGGG - Intergenic
947521609 2:230850067-230850089 AGAGGGGAGGAGAGGGCAGAGGG + Intergenic
947522822 2:230861735-230861757 CAGGAGGAGCAGTGGGCAGAAGG + Intergenic
947568924 2:231215673-231215695 GAAGGGCAGCAGAGGCAAGCTGG + Intronic
947718592 2:232354088-232354110 CATGGGGAGCTGAGTGGAGAAGG + Intergenic
947731076 2:232432126-232432148 CACGGGGAGCTGAGTGGAGAAGG + Intergenic
947909212 2:233790572-233790594 AAAGGGGAGGGGAGGGAGGAAGG - Intronic
948027604 2:234790360-234790382 GAAGGTGAGGAGAGGGAGGAAGG + Intergenic
948262243 2:236613018-236613040 CACATGGAGCAGAGGGAGGAGGG - Intergenic
948386937 2:237586301-237586323 CATGGGGTGCAGAGGGAAGCAGG - Intronic
948571532 2:238920805-238920827 GAAGGGGAGCAGAGAGCACAGGG - Intergenic
948603471 2:239120573-239120595 CAAGGGGAGAAGGAGGAAGGTGG + Intronic
948683869 2:239658669-239658691 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948683881 2:239658701-239658723 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948683892 2:239658733-239658755 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948683922 2:239658827-239658849 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948683934 2:239658859-239658881 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948683945 2:239658891-239658913 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948683976 2:239658985-239659007 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948683988 2:239659017-239659039 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948683999 2:239659049-239659071 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948684029 2:239659143-239659165 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948684041 2:239659175-239659197 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948684053 2:239659207-239659229 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948684064 2:239659239-239659261 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948840114 2:240644686-240644708 GAAGGGGAGAGGAGAGAAGAGGG - Intergenic
1169027537 20:2383329-2383351 CAAGGGCAGGAGGAGGAAGATGG + Intronic
1169259710 20:4127441-4127463 ATAAGGGAGCAGAGGGGAGATGG + Intronic
1169767485 20:9163109-9163131 GAAGGGGAGCAGTGGCTAGAAGG + Intronic
1169993064 20:11525069-11525091 CAGCTGGAGCAGAGGGAATAAGG + Intergenic
1170602224 20:17849562-17849584 GAAGGGAAGGAGAGGGAAAAGGG + Intergenic
1170728294 20:18948878-18948900 CCAGGGAAGGAGAGGGAACAAGG + Intergenic
1171174656 20:23042446-23042468 GAGGGGGAGCAGAGAGCAGAGGG - Intergenic
1171471899 20:25378872-25378894 TAATGAGAGCAGAGGGCAGATGG - Intronic
1171749879 20:29038573-29038595 CTAGTGGAGCTGAGAGAAGACGG - Intergenic
1172157005 20:32834024-32834046 CAAGGGGAATAGGGGCAAGAAGG - Intronic
1172173847 20:32960701-32960723 TAAGGGGACCACAGGGAGGAGGG - Intronic
1172720281 20:36994757-36994779 CTAGTGGAGCTGAGAGAAGAGGG + Intergenic
1172984843 20:38976758-38976780 TAGGGGCTGCAGAGGGAAGAGGG - Intronic
1173002014 20:39111560-39111582 GAAGAGGAGGAGAGGGAGGAGGG + Intergenic
1173042172 20:39474906-39474928 CAAGGCAAGCACAGGGAACAGGG - Intergenic
1173078831 20:39846672-39846694 CATTGGGAGCAGAGGGAGAAAGG - Intergenic
1173141567 20:40489466-40489488 CAAGTTGAGCAAAGGGTAGATGG - Intergenic
1173532741 20:43782846-43782868 TAAGGGTTGCAGAGGGACGAAGG + Intergenic
1174267297 20:49341102-49341124 GAAGGGGGGGAGAGGGAAGTGGG - Intergenic
1174638543 20:52023020-52023042 CAAAGAAAGCAGAAGGAAGAAGG - Intergenic
1175120085 20:56710598-56710620 GAAGGGGAAGAGGGGGAAGAAGG - Intergenic
1175252281 20:57616790-57616812 AGAGGGGAGTAGAGGGCAGAAGG + Intronic
1175627016 20:60497328-60497350 AGAGGGGAGGGGAGGGAAGAAGG + Intergenic
1175902190 20:62364358-62364380 CACGAGCAGCAGAGGGAAGCTGG + Intronic
1175943384 20:62548038-62548060 GAAGGGGAAGAGAGGGGAGAAGG - Intergenic
1175999314 20:62824983-62825005 AAAGGCGAGCAGGGGGAAGTCGG + Exonic
1176240785 20:64074975-64074997 CCAGGGGAGCAGAGGCAGAAGGG - Intronic
1176315345 21:5237343-5237365 CTAGTGGAGCTGAGAGAAGAGGG + Intergenic
1176358651 21:5973988-5974010 CTAGGGGAGCTGTGAGAAGAGGG + Intergenic
1176521196 21:7825784-7825806 CCAGGGGAGAAGAGGGCAGTGGG + Exonic
1176925590 21:14745334-14745356 CTAGTGGAGCTGTGGGAAGAAGG - Intergenic
1176947779 21:15004590-15004612 CAAGGGGAGCAGATCCAATATGG + Intronic
1177187070 21:17808490-17808512 CTAGTGGAGCTGTGGGAAGAGGG + Intronic
1177259193 21:18706945-18706967 AAAGGGGAAAAGGGGGAAGAGGG - Intergenic
1177655998 21:24018707-24018729 CAAGGGAAGAGCAGGGAAGAAGG - Intergenic
1177952161 21:27552113-27552135 CTAGTGGAGCTGTGGGAAGAAGG - Intergenic
1177956707 21:27606823-27606845 CAAGGGGATCAGGGCCAAGATGG - Intergenic
1178032679 21:28545729-28545751 AAATTGGAGCAGAGGAAAGAAGG + Intergenic
1178246902 21:30961617-30961639 CATTGGGAGATGAGGGAAGAAGG - Intergenic
1178582407 21:33847848-33847870 CCAGGAGATCAGAGGAAAGATGG - Intronic
1178655216 21:34455796-34455818 CCAGGGGAGAAGAGGGCAGTGGG + Intergenic
1179099773 21:38346422-38346444 TCAGGGGAGCAGAGAGCAGAAGG + Intergenic
1179229543 21:39489037-39489059 CAAGAAGACCAGAGGGAAGAAGG + Intronic
1179432659 21:41334732-41334754 CTAGTGGAGCTGTGGGAAGAGGG + Intronic
1179489128 21:41728708-41728730 GAAGGCGGGTAGAGGGAAGAAGG + Intergenic
1179635070 21:42703553-42703575 CGCTGGGAGCAGAGGAAAGAGGG + Intronic
1179764867 21:43564562-43564584 CTAGGGGAGCTGTGAGAAGAGGG - Intronic
1179819911 21:43930692-43930714 TGAGGGGAGCAGAGGGAAGCAGG + Intronic
1180146990 21:45927291-45927313 GAAGGGGAGGGGAGGGAGGAGGG - Intronic
1180156216 21:45978352-45978374 GAGGGGGAGAGGAGGGAAGAGGG + Intergenic
1180251428 21:46592633-46592655 CTAGTGGAGCAGTGAGAAGAGGG + Intergenic
1180393129 22:12303298-12303320 CTAGTGGAGCTGAGAGAAGAGGG + Intergenic
1180406621 22:12561470-12561492 CTAGTGGAGCTGAGAGAAGAGGG - Intergenic
1181415004 22:22753073-22753095 CAAGGTGAGCACTGGGAGGACGG + Intronic
1181535018 22:23537296-23537318 AAAGAGGAGCAGAGAGAAGGAGG + Intergenic
1181860339 22:25813146-25813168 GAAGAGGAGGAGAAGGAAGAAGG - Intronic
1181883389 22:25999552-25999574 GAAGAGGAGGAGGGGGAAGAGGG - Intronic
1182358821 22:29734936-29734958 CCGCGGGAGCAGAGGGAAGGTGG + Intronic
1182515249 22:30854946-30854968 CAAGGAGAACAGAGCGAAGTTGG + Intronic
1183080691 22:35454202-35454224 GAAGGGGAGCAGAGGGAGCCAGG - Intergenic
1183091792 22:35527210-35527232 GGAGGGGGGCAGAGGAAAGAGGG + Intergenic
1183284490 22:36953534-36953556 CAAGGGGAGCAGGAGGAGGGTGG + Intergenic
1183320866 22:37164312-37164334 GGAGGGGAGCAGAGTGAGGAGGG + Intronic
1183368154 22:37417959-37417981 GAAGGGGAGGAGAGGGAGGGGGG + Intronic
1183487391 22:38096928-38096950 CAGGGAGGGAAGAGGGAAGAAGG + Intronic
1183583304 22:38738269-38738291 CAAAGAGAGCGGAGGGAAGTGGG + Intronic
1183906978 22:41049078-41049100 CAGAGAGAGCAGAGGCAAGATGG + Intergenic
1183909704 22:41069236-41069258 CATGGGGGGCAGAAAGAAGAAGG - Intergenic
1184064126 22:42106354-42106376 GAAGGAGAAGAGAGGGAAGAGGG + Intergenic
1184133465 22:42531899-42531921 CAAGGGGAGCAGGGTAAGGAGGG - Intergenic
1184186509 22:42868693-42868715 GCAGGGCAGGAGAGGGAAGATGG + Intronic
1184298159 22:43539273-43539295 TAAGTAGAGCAGAGGGAAGAGGG - Intronic
1184335491 22:43850590-43850612 GAGGGAGAGCAGAGGGAACAGGG - Intronic
1184456679 22:44614868-44614890 GAAGGGGAGGAGGAGGAAGAGGG - Intergenic
1184531454 22:45058354-45058376 GAAGGGGAGAGGGGGGAAGAGGG + Intergenic
1184542050 22:45132610-45132632 AAAGGAGGCCAGAGGGAAGAAGG + Intergenic
1184685501 22:46094993-46095015 CCAGGGGAGGGGAGGGGAGACGG - Intronic
1184883819 22:47329815-47329837 GAAGAGGAGCAGAAGGAGGAAGG + Intergenic
1184916887 22:47575427-47575449 CAAGGGAAGGACAGGGAGGAGGG - Intergenic
1184925976 22:47637686-47637708 CTAGGGGAGAAGAAGAAAGATGG + Intergenic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
1185088447 22:48753114-48753136 CATGGGGAGCAGAGGGAGCTTGG - Intronic
1185312402 22:50163294-50163316 CAAGGGAAGCAAAGGCAAGTGGG + Intergenic
1185339292 22:50284393-50284415 CCAGGGAGGCAGAGGGCAGAGGG + Intronic
1185342580 22:50298258-50298280 CAAGGGCAGCACAGGGATGCTGG + Intronic
1185382409 22:50516001-50516023 TGAGGGGAGCAGAGGAAGGATGG + Intronic
949413510 3:3792567-3792589 CAAGGGAAGCAGAGGAATGTAGG - Intronic
949737845 3:7194938-7194960 GAAGAGGACCTGAGGGAAGAGGG + Intronic
949749086 3:7330391-7330413 CAAGGGGGACAGAGAGAAGAGGG - Intronic
950466387 3:13157640-13157662 CCAGGGGAGCAAAGGAAGGAAGG + Intergenic
950468534 3:13170434-13170456 CAAGTGGAGCTGTGAGAAGAAGG + Intergenic
950520153 3:13493308-13493330 TGAGGGGAGGAGAGGGAAGAGGG - Intronic
950525914 3:13523184-13523206 CACGGGAAGCAGGGGGAAGCTGG - Intergenic
950662942 3:14477863-14477885 CAAGGGAAGCAAAGAGCAGAAGG + Intronic
950671313 3:14527425-14527447 GGAGGGGAGGGGAGGGAAGAGGG + Intronic
951180337 3:19652258-19652280 CAATGGGAGCAGAGGGGATTAGG + Intergenic
951241170 3:20287811-20287833 CTAGTGGAGCTGTGGGAAGAGGG - Intergenic
951365998 3:21783346-21783368 CCAGTGGAACAGAGGGAAAAAGG + Intronic
951412264 3:22379489-22379511 AAAGGAGGGGAGAGGGAAGAAGG + Intergenic
951717676 3:25665485-25665507 TGAGGGGAGGAGACGGAAGAAGG - Intergenic
951794047 3:26518055-26518077 CTAGTGGAGCTGTGGGAAGAGGG + Intergenic
952105502 3:30065396-30065418 CAAGTGGAGCTGTGAGAAGAGGG - Intergenic
952262549 3:31754389-31754411 CAAGATGAGCGGAAGGAAGAGGG + Intronic
952295272 3:32056696-32056718 CAAGGGTTGCAGAGGGACGAAGG - Intronic
952568892 3:34689938-34689960 TAAGGAGAGGAGGGGGAAGAGGG + Intergenic
952707453 3:36393668-36393690 GAGGGAGAGCAGAGAGAAGAAGG - Intronic
952872913 3:37918043-37918065 GATGGGGAGCAGAGGCAAGGAGG + Intronic
952985055 3:38771533-38771555 CAAGGTGATGAGGGGGAAGAAGG + Intronic
953036516 3:39216409-39216431 CTAGGGGAGCAGATGGAATGGGG - Intergenic
953142043 3:40238145-40238167 GAAGGGAAGGAGAAGGAAGAAGG - Intronic
953184001 3:40621317-40621339 CTTGGGCAGCAGTGGGAAGAGGG + Intergenic
953772622 3:45790619-45790641 CAAGGAGAGCAGAGAACAGATGG - Intronic
953821205 3:46208887-46208909 CTTGGGGAGCAGAGAGCAGAGGG - Intronic
953855565 3:46497168-46497190 CAAGAGGAGGAGAGGAAGGAAGG - Intergenic
954072235 3:48151409-48151431 AAAGGGGAAAAAAGGGAAGAGGG - Intergenic
954214711 3:49117946-49117968 CAAGAGGAGCAGACCAAAGAGGG - Exonic
954264561 3:49462219-49462241 AAAGGGGATGAGAGGGAAGGGGG - Intergenic
954396467 3:50295928-50295950 CAAGGTGGGCAGAGGAAAGAAGG - Intronic
954414248 3:50385182-50385204 AAGGGGGAGGGGAGGGAAGATGG + Intronic
954692515 3:52403188-52403210 CACGGACAGCAGAGAGAAGACGG - Exonic
954756010 3:52840376-52840398 CAAGAGGAGCAGAGGTAGAAAGG + Exonic
954916147 3:54149973-54149995 GAGGGGGAGGGGAGGGAAGAAGG - Intronic
955027372 3:55182821-55182843 CAAGGGGAGAAGGGGGAGGTAGG - Intergenic
955339257 3:58112326-58112348 CCAGGGGAGCAGAGGGGAGAAGG - Intronic
955666636 3:61355991-61356013 CAAGCAGAGCAGGGGGAAGTGGG + Intergenic
956142342 3:66158738-66158760 GTAGAGGGGCAGAGGGAAGAAGG + Intronic
956347835 3:68300056-68300078 CTAGTGGAGCTGAGAGAAGAGGG + Intronic
956558775 3:70550907-70550929 CTAGTGGAGCTGTGGGAAGAGGG - Intergenic
956626662 3:71273443-71273465 CAAGGGGATTAGAGGAGAGAAGG - Intronic
956637305 3:71379071-71379093 TAATGAGGGCAGAGGGAAGAAGG - Intronic
956750985 3:72343837-72343859 CAAGAGGGACAGAGGCAAGAGGG - Intergenic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
956796014 3:72719389-72719411 GAAGGGGAGGGGAGGGAGGAAGG + Intergenic
957064525 3:75510584-75510606 CAAGGGGAGGAGATAGGAGAGGG - Intergenic
957863944 3:85998051-85998073 GAAGGAGAGGTGAGGGAAGAGGG + Intronic
958100275 3:88999750-88999772 GAAGGGGAGCACAGGTGAGAGGG - Intergenic
958160809 3:89815222-89815244 CTAGTGGAGCTGTGGGAAGAGGG - Intergenic
959348448 3:105229480-105229502 CAAGAGCAGCTAAGGGAAGAGGG - Intergenic
960052105 3:113248950-113248972 CACCGGGAGCAGAGAGAAGTGGG + Intronic
960564374 3:119118132-119118154 CAAGTGGAGCTGTGAGAAGAGGG - Intronic
961185425 3:124910809-124910831 CAAAGGCAGCAGAGGTAAGGAGG - Intronic
961288829 3:125828816-125828838 CAAGGGGAGGAGATAGGAGAGGG + Intergenic
961532275 3:127547100-127547122 CAAGAGGAGAGGAGGGGAGAGGG + Intergenic
961816047 3:129550943-129550965 CCAGGGGACCAGAGAGAAGGTGG - Intronic
961852488 3:129835167-129835189 CAAGAGGATCAAAGGAAAGAGGG - Intronic
961904098 3:130244472-130244494 AAAGGGAATAAGAGGGAAGAGGG + Intergenic
962583695 3:136820002-136820024 TGAGAGGAGGAGAGGGAAGAAGG + Intronic
962747891 3:138411002-138411024 CAACGGGAGCAGAGGAGAGATGG + Intergenic
963076674 3:141353562-141353584 GAAGGGGAGAAGGGGGAAGAAGG + Intronic
963112335 3:141697946-141697968 AGAGGGGAGCCAAGGGAAGAGGG + Intergenic
963475132 3:145794659-145794681 CTAGTGGAGCTGAGAGAAGAGGG - Intergenic
963716715 3:148811850-148811872 CTAGGGGAGCTGTGAGAAGAGGG + Intronic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
963981488 3:151543237-151543259 CAAGGGGAGGAGTGGGTCGATGG + Intergenic
964494918 3:157278404-157278426 CAAAGAGAGCAGAGGGAATGTGG + Intronic
965084505 3:164077476-164077498 CAGGGAAAGCAGAGGGAAAAAGG + Intergenic
965342391 3:167506147-167506169 GAAGGGAGGCAGAAGGAAGAGGG - Intronic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
965809800 3:172579560-172579582 CTAGGGGAGCTGTGAGAAGAGGG + Intergenic
966468209 3:180256232-180256254 TGAGGTGAGGAGAGGGAAGAGGG + Intergenic
966754513 3:183355934-183355956 CAAGGGGAGGGGAGGGGGGAAGG - Intronic
966960939 3:184938058-184938080 CAAATGGAGGAGAGAGAAGAAGG + Intronic
967048038 3:185755455-185755477 CTAGTGGAGCTGTGGGAAGAGGG + Intronic
967169837 3:186814415-186814437 CTAGGGCAGCTGAGGGAAGAAGG - Intergenic
967596788 3:191334695-191334717 GAAGGGGAAGAGAGGGAAGGAGG - Intronic
967748291 3:193084060-193084082 CTAGTGGAGCTGTGGGAAGAGGG + Intergenic
968136669 3:196224725-196224747 AGAGGGGAGGAGAGGGGAGAGGG + Intronic
968503103 4:960270-960292 CAAGGGGCTCAGTGGGGAGAGGG + Exonic
968663700 4:1809655-1809677 GGAGGAGAGCAGAGGGAGGACGG - Intergenic
968913430 4:3486923-3486945 CCCGGGGAGCAGAGGGAAGCAGG + Intronic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
968937118 4:3617268-3617290 GAATGGGATGAGAGGGAAGAAGG - Intergenic
969089976 4:4686322-4686344 TAAGGGGAGCAATGGGAAGCAGG + Intergenic
969262796 4:6044208-6044230 CAAGGGGGGCAGCGGGGTGAGGG - Intronic
969301368 4:6299271-6299293 CAAGAGGAGCAGAGGGCTGAGGG - Intronic
969365900 4:6694167-6694189 CAAGGGGCTCAGAGGCAAGAGGG + Intronic
969477788 4:7431253-7431275 CAAGGGGTGGGTAGGGAAGAGGG + Intronic
969515710 4:7647084-7647106 CCAGGGGACGAGAGGGAAGTAGG + Intronic
969664344 4:8548468-8548490 CTATGGGTGCAGAGGGAACAAGG + Intergenic
969804544 4:9596718-9596740 CAAGGGGAGGAGACAGGAGAGGG + Intergenic
970151315 4:13093439-13093461 AAAGGGGAGCAGAGGGACCAGGG - Intergenic
970166843 4:13247550-13247572 AAAGGGGAGGAGAGAGAAAAAGG - Intergenic
970449059 4:16149053-16149075 CAAAGGGTACAGAGGAAAGAGGG - Intergenic
970701504 4:18745969-18745991 CCAGGGGCTGAGAGGGAAGAAGG - Intergenic
970758104 4:19450762-19450784 CTAGTGGAGCAGTGAGAAGAGGG - Intergenic
971277877 4:25215341-25215363 CAAGTGGAGCTGTGAGAAGAGGG - Intronic
971309741 4:25515051-25515073 GGAGGAGAGCAGAGGGAAGCGGG + Intergenic
971412124 4:26384985-26385007 GGAGGGGAGGAGAGGGGAGAGGG - Intronic
971570924 4:28209965-28209987 GAAGGGGAGGAGGGGGAGGAGGG - Intergenic
971769845 4:30882158-30882180 GAAGGGGAAGAGAGGGAGGAAGG - Intronic
971977531 4:33710131-33710153 CTAGTGGAGCTGTGGGAAGAGGG - Intergenic
972576230 4:40354409-40354431 CAAGGGGAGTGAATGGAAGAAGG + Exonic
972576632 4:40357931-40357953 CAAATGGAGGAGAGGAAAGATGG - Intergenic
972644463 4:40954373-40954395 CACGGGGTGGAGAGGAAAGAGGG + Intronic
972897760 4:43644465-43644487 CTAGGGGAGCTGTGAGAAGAGGG - Intergenic
973580740 4:52341879-52341901 CTAGTGGAGCTGTGGGAAGAGGG - Intergenic
974013069 4:56624899-56624921 CTAGTGGAGCTGAGAGAAGAGGG + Intergenic
974020548 4:56688320-56688342 GAAGGGGAAGGGAGGGAAGAAGG + Intergenic
974097567 4:57381259-57381281 GAAGAGGGGGAGAGGGAAGAGGG + Intergenic
974117503 4:57598143-57598165 CTATGGGAGCAGAGAGAAAAGGG + Intergenic
975170552 4:71227601-71227623 AAAGAAGAGCAAAGGGAAGAAGG - Intronic
975253942 4:72212877-72212899 CTAGGGGAGCTGTGAGAAGAGGG - Intergenic
975609909 4:76193407-76193429 CTAGTGGAGCTGTGGGAAGAAGG + Intronic
975831032 4:78369014-78369036 CAAGGGGGTCAGAGCGGAGATGG + Intronic
976830937 4:89313008-89313030 AAAGGGGTGGAGAGAGAAGAAGG - Intergenic
977348209 4:95845130-95845152 GAATGGGAGCAGAGTGAAGGGGG + Intergenic
977476718 4:97519786-97519808 AAAGGGGAGAAGAGGAGAGAAGG + Intronic
977591044 4:98827588-98827610 CAAGGACAACAGAGGGCAGAGGG - Intergenic
978213134 4:106162426-106162448 CTAGTGGAGCAGTGAGAAGAGGG - Intronic
979562563 4:122116908-122116930 CAATGGAAGCAGAGTGAGGAAGG + Intergenic
979775189 4:124581611-124581633 CTAGTGGAGCTGAGAGAAGAGGG - Intergenic
979916871 4:126446137-126446159 CAAGGGCAGCATCGAGAAGATGG - Intergenic
980018922 4:127684643-127684665 GAAGAGGAGGAGAAGGAAGAAGG - Intronic
980299178 4:130965491-130965513 CTAGTGGAGCTGAGAGAAGAGGG + Intergenic
980467224 4:133201934-133201956 CTTTGGGAGCAGAGTGAAGAAGG + Intronic
981038770 4:140200245-140200267 GAAGGAGAGGAGTGGGAAGAGGG + Intergenic
981042646 4:140237698-140237720 GAAGGGGAGGAGCGGGACGAGGG - Intergenic
981611417 4:146597508-146597530 CTAGGGGAGCTGTGAGAAGAGGG - Intergenic
982197867 4:152934743-152934765 CAAGGAGATCAAAGGGATGAGGG + Intergenic
982506057 4:156219068-156219090 CCAGTGGAGCTGAGAGAAGAGGG + Intergenic
982524939 4:156466643-156466665 CTAGGGGAGCTGTGAGAAGAAGG - Intergenic
982628816 4:157805156-157805178 AAGAGGGAGCAGAGGAAAGAGGG - Intergenic
983026709 4:162746803-162746825 GAAGGGGAGGAGAGGGGAGGCGG + Intergenic
983308210 4:166021368-166021390 GGAGGGAAGCAGAGGGAGGAAGG - Intronic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
984305099 4:177979404-177979426 CAAGAGGAGTTGAGGGAACATGG + Intronic
984705303 4:182843415-182843437 CAAGGGGAAGAGAGTGAACAGGG + Intergenic
984858906 4:184219717-184219739 GAAGGGAAGAAAAGGGAAGAAGG + Intronic
984859094 4:184220366-184220388 GAAGGGAAGAAAAGGGAAGAAGG + Intronic
985431790 4:189888230-189888252 CTAGTGGAGCTGAGAGAAGACGG - Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985573987 5:665300-665322 CAAGAGGAGCAGGAGGAAGGGGG + Intronic
986152430 5:5140107-5140129 AGCGGGGAGCAGAGGGAAGGCGG - Intergenic
986169174 5:5301942-5301964 CAAGGGGATGAGAGGGGAGCTGG - Intronic
986174053 5:5336963-5336985 CATGGGCAGCACAGGGAGGAGGG + Intergenic
986240436 5:5955171-5955193 CAAGGGGAGAAGGGGAAGGAGGG - Intergenic
986372817 5:7097831-7097853 CAATTGGAGGAGAGAGAAGAGGG + Intergenic
986822507 5:11482916-11482938 AAAGGGGAGGAGAAAGAAGACGG + Intronic
987075770 5:14380430-14380452 CCAGGGCAGCAGTGGGAAGCGGG - Intronic
987488429 5:18548652-18548674 CAAGTGGAGCTGTGAGAAGAGGG - Intergenic
987497615 5:18668677-18668699 CAAGGGAAGGTGGGGGAAGAAGG + Intergenic
987650367 5:20733066-20733088 CTAGGGGAGCTGTGAGAAGAGGG - Intergenic
987845432 5:23277321-23277343 CTAGTGGAGCTGCGGGAAGAGGG + Intergenic
988366803 5:30310571-30310593 CTAGTGGAGCAGTGAGAAGAGGG + Intergenic
988737587 5:34038267-34038289 TAAGGTGAGCACAGGGAGGATGG + Intronic
988792346 5:34620207-34620229 GAAGGTGAGCACAGAGAAGAGGG + Intergenic
988959333 5:36353923-36353945 AAAAGAGAGCAGAGGGCAGAAGG + Intergenic
989268283 5:39502880-39502902 CAAAGGGGGCTGAGGGAAGCAGG - Intergenic
989639253 5:43567233-43567255 CAAGTGGAGAACAGAGAAGAAGG + Intergenic
990288283 5:54322736-54322758 AAAGGGCAGCAGAGAGATGATGG + Intergenic
990407233 5:55503809-55503831 GAAGGGGAGGGGAGGGAAGAGGG + Intronic
990480653 5:56207089-56207111 GAAGGGGAGGAGAGGATAGAAGG - Intronic
990484286 5:56242826-56242848 CTAGTGGAGCTGAGAGAAGATGG + Intergenic
990499554 5:56381950-56381972 AAAGGGGAGCAAAGGGAAAACGG + Intergenic
990516945 5:56539208-56539230 CATGGGGTGGAGAAGGAAGAGGG + Intronic
990583735 5:57189864-57189886 CAAGGGAAGAACAGAGAAGAGGG - Intronic
990754574 5:59054875-59054897 AAAGGGAGGAAGAGGGAAGAGGG - Intronic
990953832 5:61324209-61324231 GAAGGGGAGGGGAGGGAAGTGGG + Intergenic
991119392 5:62994010-62994032 CTAGGGGAGCTGTGAGAAGAGGG - Intergenic
991504604 5:67311053-67311075 GGAGGGGAGGAGAGGGGAGAGGG + Intergenic
991734413 5:69618658-69618680 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991780565 5:70128067-70128089 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
991810847 5:70473793-70473815 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991859853 5:71003490-71003512 TAGGGGCAGCAGAGGGAAGCTGG + Intronic
991873013 5:71128386-71128408 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
993130830 5:83896244-83896266 CAGAGGGAGCAGAGGGAGCAGGG + Intergenic
993332170 5:86614676-86614698 AGAGGGAAGAAGAGGGAAGAAGG - Intergenic
993463861 5:88220209-88220231 GAAGGGAAGAAAAGGGAAGAGGG + Intronic
993826774 5:92697892-92697914 CAATGTGAGCTGAGGGAAGGAGG + Intergenic
993835301 5:92812476-92812498 AAAGAGGAGCAAAAGGAAGAAGG + Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994626348 5:102224896-102224918 CAAGGAAAAGAGAGGGAAGAAGG + Intergenic
994696108 5:103074904-103074926 CTAGTGGAGCAGTGAGAAGAGGG + Intergenic
995105141 5:108369080-108369102 TTAGGTGAGCAGAGGGATGATGG - Intronic
995125355 5:108573258-108573280 CTAAGGGAGAAGAGGGAGGAAGG + Intergenic
995243177 5:109908355-109908377 GATAGGCAGCAGAGGGAAGATGG - Intergenic
995591570 5:113705585-113705607 CTAGTGGAGCTGAGAGAAGAGGG - Intergenic
995815038 5:116158278-116158300 AGAGGGGAGGAGAGGGGAGACGG - Intronic
995997829 5:118322572-118322594 CTAGTGGAGCTGAGAGAAGAGGG - Intergenic
996295420 5:121909163-121909185 TAAGGGGAACAGTGGGGAGAGGG - Intergenic
996344173 5:122471810-122471832 CAGGGGGAGTAGAAGGATGAGGG - Intergenic
996606736 5:125331483-125331505 CTAGGGGAGCAGAGAGCAAAAGG + Intergenic
997178393 5:131802397-131802419 GATGGGGAGCAGAGAGGAGATGG + Intergenic
997515958 5:134490130-134490152 CAAGGGCCACAGAGGGAAAACGG - Intergenic
997599545 5:135130042-135130064 CATGGGGAACAAAGGGAAGGAGG - Intronic
998080935 5:139274342-139274364 CCTAGGGAGAAGAGGGAAGAGGG - Intronic
998794199 5:145800275-145800297 GAAGGGGAGGAAAGGGAAGGGGG - Intronic
999081879 5:148852251-148852273 AAAGAGGACCAGAGGGGAGAAGG + Intergenic
999082092 5:148854331-148854353 AAAGAGGACCAGAGGGGAGAAGG + Intergenic
999174451 5:149622027-149622049 CAAGTGCTGCAGAGGGCAGAGGG + Exonic
999533528 5:152489418-152489440 CAAGGGGAGAAGGTTGAAGAAGG + Intergenic
999774238 5:154799566-154799588 GAAGGGGAGGAGAAGGAAGAGGG - Intronic
1000226569 5:159267043-159267065 CTAGTGGAGCTGAGAGAAGAGGG + Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000419311 5:161020341-161020363 CAAAGGACGGAGAGGGAAGATGG - Intergenic
1000543811 5:162573978-162574000 CAAGAGAAGCAAAGGCAAGAAGG + Intergenic
1000630756 5:163587878-163587900 CCAGGGAAGCAGATGGCAGAAGG - Intergenic
1001133015 5:169079928-169079950 CAAAGGGAAGAGAGAGAAGAGGG + Intronic
1001255956 5:170183770-170183792 CAAGGTGAGCAGAGGCCAGAGGG + Intergenic
1001303479 5:170554793-170554815 GAAGGGGAGAAGAGGAGAGAGGG - Intronic
1001400591 5:171444132-171444154 GAAGTGGAGCTGAGGGAAGGTGG + Intronic
1001436551 5:171703780-171703802 CATGGGGAGCAGAGGAAAAGAGG - Intergenic
1001877872 5:175216779-175216801 TAAAGGGATCAGAGGGAAGCAGG + Intergenic
1001905577 5:175470042-175470064 CCAGGGGAGCAGGAGGAAGCTGG + Intergenic
1002402946 5:179002239-179002261 CAAGAGGAGTAGAGAGAAGGGGG + Intergenic
1002963117 6:1936257-1936279 CAATGTGAGCAGTGGCAAGAGGG + Intronic
1003440658 6:6138371-6138393 CAAGGGCAGGAGAGGGAATGTGG + Intergenic
1003494614 6:6653387-6653409 CAAGCGGAGCAGAGGGACTGTGG - Intronic
1003518473 6:6837135-6837157 AGAGGGGAGGAGAGGGGAGAAGG + Intergenic
1003974101 6:11326656-11326678 CAGGAGGGGCAGAGGGAAGCTGG - Intronic
1004127391 6:12887014-12887036 CAAGGGGAAGAGGAGGAAGAGGG - Intronic
1004250784 6:14021726-14021748 GAGGGGGAGGGGAGGGAAGAAGG - Intergenic
1004423254 6:15489871-15489893 AAGGAGGAGGAGAGGGAAGAGGG - Intronic
1004627792 6:17393490-17393512 AAAGGGGAGCAGAGAGGAGAAGG - Exonic
1004725658 6:18308968-18308990 GGAGGGGAGGGGAGGGAAGAAGG - Intergenic
1004975873 6:20965331-20965353 GGAGGGGAGGGGAGGGAAGAGGG + Intronic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1005108365 6:22250528-22250550 GAAGGGGATGAGGGGGAAGAGGG - Intergenic
1005316105 6:24604268-24604290 CAATGGCTGCAGATGGAAGATGG - Intronic
1005821773 6:29604745-29604767 CAAGGGGAGGAGTGAGAGGAGGG + Intronic
1005844509 6:29766951-29766973 CAAGGGGATGAGTGGAAAGATGG - Intergenic
1005856620 6:29867754-29867776 CAAGGGGATGAGTGGAAAGATGG - Intergenic
1005873907 6:29997082-29997104 CAAGGGGATGAGTGGAAAGATGG - Intergenic
1005990503 6:30899041-30899063 AGAGTGGAGGAGAGGGAAGATGG + Intronic
1006067166 6:31470432-31470454 CAAGGGGATGAGTGGAAAGATGG + Intergenic
1006173453 6:32108420-32108442 GAAGGGGCACAGAGTGAAGACGG + Intronic
1006388860 6:33747053-33747075 AAAGAGGAGGAGAGAGAAGAGGG + Intergenic
1006575779 6:35044517-35044539 CAAAGTGAGGAGAGGGAACAGGG - Intronic
1006823379 6:36916089-36916111 GAAGGGGAGAAGAGAGAAGGAGG - Intronic
1006854587 6:37124094-37124116 GAAGGGGAGCAGAGGGGAAGGGG + Intergenic
1006854592 6:37124110-37124132 GAAGGGGAGCAGAGGGAGAGGGG + Intergenic
1006970821 6:38043381-38043403 GAAGGGGAGCAGAGGAGAGGGGG - Intronic
1007116956 6:39349557-39349579 CAGGGGGAGCAGTGGGTGGAAGG + Intronic
1007718438 6:43870611-43870633 AAAGGGGAGGGGAGGGGAGAAGG - Intergenic
1007730751 6:43944122-43944144 CATGGAGAGCAGAGAGAGGAAGG - Intergenic
1007939461 6:45765478-45765500 AAAGGGGAGAGGAGGGAAGAAGG - Intergenic
1008132325 6:47733103-47733125 CAGGGGGTGTAGAGGGAAAAAGG - Intergenic
1008548610 6:52605829-52605851 GGAGGGGAGAGGAGGGAAGAAGG - Intergenic
1009408138 6:63333446-63333468 GAAGGGGAGGAGAGGGGAGGGGG + Intergenic
1009530569 6:64808105-64808127 GAAGGGAAGGAAAGGGAAGAAGG - Intronic
1009890698 6:69677507-69677529 AAAGGGGAACAGAAGAAAGAAGG + Intronic
1010022064 6:71171872-71171894 CAAGGCAAGCAGAAGGAAGAAGG - Intergenic
1010116446 6:72317090-72317112 CATGGGGAGCAGTGGGGAGGAGG - Intronic
1010517365 6:76789797-76789819 CTAGTGGAGCTGTGGGAAGAGGG - Intergenic
1010686937 6:78864276-78864298 CAAGAGGATCAGAGGTGAGATGG - Intergenic
1011137606 6:84116962-84116984 GAAGGGAAGAAAAGGGAAGAAGG - Intergenic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1012019846 6:93904926-93904948 CAAGTGGAGCTGTGAGAAGAGGG - Intergenic
1012431481 6:99168311-99168333 GAAGGGGAGGGGAGGGAAGAAGG + Intergenic
1012817182 6:104039096-104039118 AAACGGGAGCAGAAGGCAGAAGG + Intergenic
1013219093 6:108060897-108060919 CAAGTGCAGCAGTGAGAAGAGGG - Intronic
1013871435 6:114766536-114766558 TCAGGTGAGCAGAGGGATGATGG + Intergenic
1014166966 6:118236214-118236236 AAAGAGAAGGAGAGGGAAGAAGG - Intronic
1014826372 6:126052539-126052561 AAAGGGGGGCAGAGGGAAATTGG - Intergenic
1014999171 6:128192871-128192893 GGAGGGGAGGAGAGGGAGGAAGG + Intronic
1015013149 6:128376109-128376131 CTAGTGGAGCAGTGAGAAGAGGG - Intronic
1015185896 6:130415159-130415181 CAAGGGAAGCAGAAGGAAAGGGG + Intronic
1015658456 6:135546545-135546567 GAAGGGGAAAAGAGGGAACAGGG + Intergenic
1015857460 6:137640587-137640609 CAAAGGGAATAGAGAGAAGAGGG - Intergenic
1015893986 6:137998624-137998646 GTAGGGGAGGAGAGGGAAAAAGG + Intergenic
1016030959 6:139337588-139337610 TATGGGGAGCAGGGAGAAGAAGG - Intergenic
1016505711 6:144776642-144776664 CCGGTGGAGCAGAGGGAAGGAGG - Intronic
1016605490 6:145918616-145918638 CCAGGGGGACAGAGGAAAGAAGG - Intronic
1016633817 6:146264672-146264694 GTAGGGTAGCAGAGGGATGAGGG - Intronic
1016828846 6:148413756-148413778 TAAGGGGAGAAGAGGGAGGAAGG - Intronic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1017294287 6:152776152-152776174 CAGGGGGTGCAGTGGGAGGAGGG + Intergenic
1017485765 6:154900714-154900736 CAAGGAAAGGAGGGGGAAGATGG + Intronic
1017570817 6:155742365-155742387 AAAGGGGTGTTGAGGGAAGAGGG - Intergenic
1018527499 6:164729104-164729126 CTAGTGGAGCTGTGGGAAGAGGG + Intergenic
1018674360 6:166206185-166206207 CAATGCCAGAAGAGGGAAGAGGG - Intergenic
1018784732 6:167099117-167099139 CAATGGGAGCAAGAGGAAGAAGG + Intergenic
1018867734 6:167758941-167758963 GACGGGGGGCAGAGGGAGGAGGG - Intergenic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019223438 6:170492967-170492989 CAAGGGGCCCAGAGGGGACAGGG + Intergenic
1019234395 6:170597537-170597559 GAAGGGAAGCAAAGGGAGGAAGG + Intergenic
1019508412 7:1404943-1404965 GAGAGGGAGGAGAGGGAAGAGGG + Intergenic
1019517547 7:1446524-1446546 GAAGGGGAGGAGAGGGGAGGAGG + Intronic
1019621406 7:1994228-1994250 CCAGGGCAGCACAGGGACGATGG + Intronic
1019660163 7:2219667-2219689 CAAGGGGGGCAGAGGGCAGGGGG + Intronic
1020026837 7:4905424-4905446 GAAGGGGAAGAAAGGGAAGAAGG + Intergenic
1020080008 7:5282160-5282182 AGAGGGGAGGAGGGGGAAGATGG + Intronic
1020273815 7:6613118-6613140 CAAGGGCAGGAGAGAGAAGTGGG + Intergenic
1020479951 7:8646974-8646996 GGAGGGGAGGAGAGAGAAGAAGG + Intronic
1020633907 7:10672813-10672835 TTAGGGGAGCAGTGGCAAGATGG - Intergenic
1021098654 7:16562669-16562691 CCAGGGGAGCAGAGGGATTCTGG + Intronic
1021289401 7:18824164-18824186 TGAGGGTGGCAGAGGGAAGACGG + Intronic
1021382453 7:19984196-19984218 TGAGGAGAGGAGAGGGAAGAGGG - Intergenic
1021638684 7:22716992-22717014 CAAGGGAAACAGAGAGGAGAAGG - Intergenic
1022473389 7:30695046-30695068 AACGGGGAGGAGGGGGAAGAGGG + Intronic
1022813398 7:33890864-33890886 GGAGAGGAGCAGAGGGAAGCAGG + Intergenic
1023156405 7:37256606-37256628 AAAGGGGAGGGGAGGGCAGAGGG + Intronic
1023450439 7:40278747-40278769 AAAGGGAGGGAGAGGGAAGAAGG - Intronic
1023937009 7:44747548-44747570 GAAGGGAAGGGGAGGGAAGAAGG + Intergenic
1023979887 7:45062937-45062959 GAAGGGCAGGAGAGGGAAGGGGG + Intronic
1024242785 7:47448236-47448258 GAGGGGGAGCACAGGGAGGAGGG + Intronic
1024323883 7:48093775-48093797 CAGGGGGAGCAGCGGGGACAGGG - Intronic
1024639576 7:51317775-51317797 GCAGGGGATCAGAGGGAGGAAGG - Intergenic
1024845481 7:53636880-53636902 CTAATGGAGCAGAGAGAAGAAGG + Intergenic
1025110743 7:56214104-56214126 CAAGGGGAAGAGTGGGAAGGGGG - Intergenic
1025198906 7:56950056-56950078 AGAGGGGAGGAGGGGGAAGATGG - Intergenic
1025301359 7:57821599-57821621 CGAGGGGCGCAGAGGGCTGATGG + Intergenic
1025673040 7:63626877-63626899 AGAGGGGAGGAGGGGGAAGATGG + Intergenic
1026015831 7:66669909-66669931 CAACGAGAACAGAGGGAAGTGGG - Intronic
1026287692 7:68977665-68977687 CTGGGGGAGAAGAGGGCAGAAGG + Intergenic
1026509954 7:71019484-71019506 CACTGGGAACAGAGGGGAGATGG - Intergenic
1026552755 7:71381898-71381920 AAAGGGGAGAAGAGGCAAGTGGG + Intronic
1026622426 7:71961770-71961792 CAAGGGCAGCAGAAGAGAGAGGG + Intronic
1027357713 7:77375469-77375491 GAAGGAGAGCAGAGGGCAGGAGG + Intronic
1027441591 7:78224968-78224990 TGAGGTGAGCAGAGGGAAGGCGG - Intronic
1028011351 7:85648606-85648628 CTAGTGGAGCTGTGGGAAGAGGG - Intergenic
1028905753 7:96152327-96152349 CCTAGGGAGCAGAGGGGAGAGGG + Intronic
1029043382 7:97600911-97600933 CAAGGTGAGCAAGGGGAAGAAGG + Intergenic
1029364993 7:100111044-100111066 ACAAGGGGGCAGAGGGAAGAGGG - Intronic
1029457610 7:100679011-100679033 CCAGGGCAGCAGAAGGATGAGGG - Exonic
1030095532 7:105895195-105895217 CAAGGAGAGAAGAGAGAAGCAGG + Intronic
1030102222 7:105956523-105956545 TAAAGGGAGAAGGGGGAAGAAGG + Intronic
1030162015 7:106518614-106518636 GAAGGAGAGGAGAGGGAGGAAGG - Intergenic
1030162023 7:106518640-106518662 GAAGGAGAGGAGAGGGAAGAAGG - Intergenic
1030357287 7:108556764-108556786 CTAGTGGAGCTGTGGGAAGAGGG - Intronic
1030783098 7:113625787-113625809 GGAGGGGAGGAGAGGGGAGAAGG - Intergenic
1031052128 7:116954367-116954389 CGAAGGGACCGGAGGGAAGAGGG + Intronic
1031186019 7:118481317-118481339 CAAGTGGAGCTGTGAGAAGAAGG - Intergenic
1031242637 7:119266174-119266196 CTAGGGGAGCTGTGAGAAGATGG - Intergenic
1031360646 7:120844828-120844850 CTAGTGGAGCAGTGTGAAGAGGG - Intronic
1032330538 7:130975094-130975116 CTAGTGGAGCAGTGAGAAGAGGG + Intergenic
1032410738 7:131692023-131692045 AAAGGAGAGCAGGGGGAGGAGGG - Intergenic
1032547518 7:132756128-132756150 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1032760206 7:134933487-134933509 CAAGAGGAGGAGAGGGAACAAGG + Exonic
1032789761 7:135233641-135233663 AAAAGGGAGGAGAGAGAAGAGGG - Intronic
1033266152 7:139888901-139888923 GAAGGGGTGCAGGGGGAGGATGG + Intronic
1033554403 7:142476040-142476062 CAAGAGGAGCAAAGGGTAGATGG + Intergenic
1033559033 7:142513597-142513619 CAAGAGGAGCAAAGGGTAGATGG + Intergenic
1033582702 7:142751619-142751641 CATGGGCAGCAGAGGGATGTGGG - Intronic
1033825648 7:145186860-145186882 GAAGGGGAGGGGAGGGAGGAAGG - Intergenic
1033872875 7:145778020-145778042 CAAGTGGAGCAAAGGAATGATGG - Intergenic
1034422069 7:150995646-150995668 CAGGGGTGGGAGAGGGAAGAGGG - Intronic
1034422210 7:150995997-150996019 GGATGGGAGCAGAGGGAGGAGGG - Intronic
1034435140 7:151059792-151059814 CCAGGGCCGCAGAGGGAGGAAGG + Intronic
1034491744 7:151396518-151396540 GTAGGGGAGCAGCGGGAAGCGGG + Intronic
1034649169 7:152675965-152675987 CGAGGGGAGCCGAGGGAACCCGG - Intronic
1034674736 7:152884315-152884337 CCAGGGGAGCAGGAGGCAGAAGG + Intergenic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1035495991 7:159326607-159326629 CAAAGGGAAAAGGGGGAAGACGG - Intergenic
1035770404 8:2142686-2142708 GAAGGGGAGGGGAGGGAGGAAGG - Intronic
1036229727 8:6989666-6989688 CAAGGTAGGCAGAGTGAAGAGGG + Intergenic
1036232178 8:7008769-7008791 CAAGGTAGGCAGAGTGAAGAGGG + Intronic
1036659940 8:10701439-10701461 CAAGGGGTGCAGCAGGCAGATGG - Intronic
1036810997 8:11867738-11867760 GGAGGGGAGCGGAGGGCAGAGGG + Intronic
1037826350 8:22162815-22162837 CAAGGGGAGTGGAGGGGAGGAGG + Intronic
1037876116 8:22549384-22549406 CAAGGGGAGCTGACGCTAGAGGG + Intronic
1038078579 8:24105983-24106005 CATGTGGAGCCAAGGGAAGAAGG + Intergenic
1038546723 8:28431283-28431305 CAAGATGGGCTGAGGGAAGATGG + Intronic
1039777621 8:40752317-40752339 CAAGAGGAGTAGGGGGAAGGAGG - Intronic
1040006834 8:42628132-42628154 CAGGGGGAGCAGAGGGACCAGGG - Intergenic
1040303006 8:46197706-46197728 AGAGGGGAGAAGAGGCAAGACGG + Intergenic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1040772501 8:50994575-50994597 CCAGGGGAGCAGAGAAAATAAGG - Intergenic
1041030425 8:53730857-53730879 GAAGGGGAGCAGTAGGATGAAGG + Intronic
1041095252 8:54343164-54343186 GAAGGAGAAGAGAGGGAAGAAGG - Intergenic
1041527521 8:58823798-58823820 CTAGGGGCGAAGAGGGAAGAAGG + Intronic
1041669156 8:60475611-60475633 GAAGGGGAGGAGAGGGGAGGAGG - Intergenic
1041746147 8:61211308-61211330 AAAGGGGAAGAGAAGGAAGAGGG - Intronic
1041966667 8:63686322-63686344 CTAGGGGAGAAGAAGGAATAAGG - Intergenic
1042215275 8:66424952-66424974 CTAGAGGAGCAGGAGGAAGATGG + Intergenic
1042564566 8:70099063-70099085 GAAGGGGAGGGGAGGGGAGAAGG + Intergenic
1042854264 8:73249840-73249862 AAAGGAAAGCTGAGGGAAGATGG + Intronic
1043251133 8:78074645-78074667 CAAGGGGAACACAAGGAAGTGGG - Intergenic
1043469157 8:80544835-80544857 GAAAGTGAGCAGAGGGAAGCTGG + Intergenic
1044030569 8:87230109-87230131 CAGGAGGAACAGAGAGAAGAGGG + Intronic
1044803182 8:95977965-95977987 GAAGGGGAGGAAAGGGAGGAGGG + Intergenic
1045015050 8:97994187-97994209 GGAGGGGGGAAGAGGGAAGAGGG + Intronic
1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG + Intergenic
1046489360 8:114929382-114929404 CAAGGAGAGGAGAAAGAAGATGG - Intergenic
1046656375 8:116899422-116899444 CTAGTGGAGCTGTGGGAAGAGGG + Intergenic
1046780649 8:118211086-118211108 CCAGGGGAGCAGAAGGGAGGGGG + Intronic
1046906457 8:119578807-119578829 CAAAGGGAGAAGTGGGATGATGG + Intronic
1047174601 8:122528564-122528586 CAAGGGGAGCAGAAGGCCAAGGG + Intergenic
1047610811 8:126518973-126518995 CCAGCTGAGCAGAGGGGAGAAGG + Intergenic
1048006334 8:130422235-130422257 GAAGGGGAGGAAAGGGAAGAAGG + Intronic
1048007661 8:130432085-130432107 AAGGGGGAGGAAAGGGAAGAGGG + Intronic
1048325508 8:133436134-133436156 CAAGGTGGGCAGAGGACAGAAGG + Intergenic
1048348541 8:133596977-133596999 CAGGGGGAGCAGAGGGTAAACGG - Intergenic
1048382775 8:133882685-133882707 CAAGGGGCACACAGGGAAGAAGG - Intergenic
1048397328 8:134026503-134026525 CAAAGGGATCAGAAGGAAGTTGG - Intergenic
1048443099 8:134474450-134474472 AAAGGGGTGGAGAGGGGAGATGG + Intergenic
1048722737 8:137345060-137345082 CAAGGGAAACAAAGGAAAGAAGG - Intergenic
1048748103 8:137637965-137637987 CAAAGGGAGAAAAGTGAAGATGG - Intergenic
1048821200 8:138382310-138382332 TAAGCAGAGCACAGGGAAGACGG - Intronic
1049095207 8:140544601-140544623 CAGAGGGAGTAGAGGGTAGAAGG - Intronic
1049165374 8:141122293-141122315 TGAGGGGAGCAGCAGGAAGAGGG - Intronic
1049311757 8:141937310-141937332 AAAGAGGAGGAGAGGGAGGAGGG - Intergenic
1049367035 8:142244818-142244840 GCAGGGGAGCAGAGGGAGCAGGG + Intronic
1049702903 8:144023142-144023164 AAAGGGGTCCTGAGGGAAGAGGG - Intronic
1049706238 8:144044198-144044220 ACAGGGGAGCAGAGAGAAGGTGG + Intronic
1049737723 8:144218727-144218749 AGAGGGGAGGGGAGGGAAGAGGG - Intronic
1049883459 9:13210-13232 GAAGGGGAGAAGAGGAAAGGGGG + Intergenic
1049903123 9:189342-189364 CTAGTGGAGCAGTGAGAAGAGGG - Intergenic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050163664 9:2742916-2742938 AATGGGGTGCAGAGGAAAGAAGG - Intronic
1050372938 9:4940867-4940889 CCAGCGGAGCAGAAGGCAGATGG + Intergenic
1051020272 9:12534760-12534782 CTAGTGGAGCTGTGGGAAGAGGG - Intergenic
1051132850 9:13882001-13882023 CAAGGGAAGCAGAAAGAAAAGGG + Intergenic
1051260093 9:15255392-15255414 AAAGGGGGAAAGAGGGAAGAAGG + Intronic
1051743858 9:20276577-20276599 CCAGTGGAGCAGTGAGAAGAGGG - Intergenic
1052583979 9:30400552-30400574 CAGAAGGAGCAGAGAGAAGAGGG - Intergenic
1052626042 9:30978569-30978591 CTAGGGGAGCTGTGAGAAGAGGG + Intergenic
1052763912 9:32620818-32620840 CATGGGGAGAAGGGGGATGAAGG - Intergenic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053096178 9:35329855-35329877 CCATGGCAGAAGAGGGAAGAGGG + Intronic
1053193739 9:36098037-36098059 CAGGAGGAGGAGAGAGAAGAGGG + Intronic
1053219101 9:36296671-36296693 GAAGGGAAGCAGAGGGTGGAAGG + Intronic
1053293133 9:36895177-36895199 CGAGAGGCGCAGAGGGAAGCAGG + Intronic
1053463083 9:38285576-38285598 CAAGGTGAGGAGAATGAAGAAGG - Intergenic
1053746139 9:41199624-41199646 CTAGTGGAGCAGTGAGAAGAGGG - Intergenic
1054345034 9:63905887-63905909 CTAGTGGAGCTGAGAGAAGAGGG + Intergenic
1054481131 9:65665593-65665615 CTAGTGGAGCAGTGAGAAGAGGG + Intergenic
1054682206 9:68231656-68231678 CTAGTGGAGCAGTGAGAAGAGGG + Intergenic
1054805881 9:69395630-69395652 ATACGGGTGCAGAGGGAAGAGGG - Intergenic
1055225458 9:73989791-73989813 CTAGTGGAGCTGTGGGAAGAGGG - Intergenic
1055442934 9:76354272-76354294 CAATGGGAGCAGAGGGAGGGGGG + Intronic
1055786962 9:79881548-79881570 GAAGGAGAGGGGAGGGAAGAGGG - Intergenic
1055884430 9:81043820-81043842 CAAAGGGAGTAAAGGAAAGATGG + Intergenic
1056350270 9:85742082-85742104 CAAGGGACGCGGCGGGAAGAGGG - Intergenic
1056428663 9:86504847-86504869 CAAGGTGAGCAGAAGGTAGAGGG - Intergenic
1056754673 9:89374234-89374256 GTAGGGGAGCTGAGGGAGGAGGG - Intronic
1057185272 9:93053958-93053980 CAAGGCGCCCAGAGGGCAGAAGG - Intergenic
1057931312 9:99195955-99195977 GAGGAAGAGCAGAGGGAAGAGGG - Intergenic
1058086427 9:100753058-100753080 CTAGTGGAGCTGTGGGAAGAGGG - Intergenic
1058426088 9:104876291-104876313 AACGGGGAACAGAGGGAAGCTGG + Intronic
1058804351 9:108576848-108576870 CAAGTGCTGCAGAGGGAAGGTGG - Intergenic
1058844629 9:108944678-108944700 CCAGGGGAGTAAAGGGAGGAAGG + Intronic
1059124235 9:111668422-111668444 GGAGGGGAGGGGAGGGAAGAAGG - Intronic
1059341304 9:113599016-113599038 GCCGGGGAGCAGAGGGAAGGGGG - Intergenic
1059424865 9:114214700-114214722 AGATGGGAGCAGAGAGAAGAGGG - Intronic
1059438079 9:114288452-114288474 CAGGGGGAGCAGGGCGAGGACGG + Exonic
1059438709 9:114290807-114290829 CAGGGGGAGCAGGGAGACGATGG + Exonic
1059456254 9:114402178-114402200 CTGGGGGTGCAGAGGGAAGCTGG + Exonic
1059528989 9:115018421-115018443 GAAGGGGAGCAGATGAGAGAAGG + Intergenic
1059542520 9:115144366-115144388 GAAGGGGAGGGGAGGGGAGAAGG - Intronic
1059842210 9:118230275-118230297 CAATGGAAGGAGAGGAAAGAAGG - Intergenic
1060102905 9:120856197-120856219 CCAGGGAAGCAGAGGAAAGTGGG + Exonic
1060188572 9:121578358-121578380 TAGGGGGAGAGGAGGGAAGAGGG - Intronic
1061147525 9:128808640-128808662 TCAGGGGAGCAGAGGCAAGCGGG - Exonic
1061219640 9:129242767-129242789 CAAGGACAGCTGAGGGAGGATGG + Intergenic
1061237555 9:129351550-129351572 TAAGGGGAGAAGAGGGTAGGAGG + Intergenic
1061715429 9:132515651-132515673 CAAGGAGGGGAGAGAGAAGAGGG - Intronic
1061807538 9:133144701-133144723 CTAGGGGAGCAGCGGGGAGTCGG - Intronic
1061840663 9:133356820-133356842 TCAGGGGAGGAGAGGGAAGGGGG + Intronic
1062291631 9:135797858-135797880 CTTGGGAAGCAGAGGAAAGAGGG - Intergenic
1062464649 9:136675670-136675692 CTGGGAGAGCAGAGGGGAGACGG - Intronic
1062729287 9:138100177-138100199 GAGGTGGGGCAGAGGGAAGAGGG + Intronic
1062731358 9:138111888-138111910 CAAGGAGAGCAGAGCGGGGAAGG - Intronic
1202782269 9_KI270718v1_random:10397-10419 CTAGTGGAGCAGTGAGAAGAGGG - Intergenic
1185511620 X:668215-668237 AAAGGGGAGGAGAGGGAGGAGGG - Intergenic
1185595090 X:1301489-1301511 CCAGTGGAGCAGAGGGAGGTGGG - Intronic
1185603620 X:1355037-1355059 GAAGGGGAGCAGATGGAGGAAGG + Intronic
1185688341 X:1948485-1948507 GAGGGGGAGGAGAGGGTAGAAGG + Intergenic
1185688619 X:2134007-2134029 GAGGGGGAGGAGAGGGTAGAAGG + Intergenic
1185734857 X:2488911-2488933 CTTGGGCAGCAGGGGGAAGAGGG + Exonic
1185746759 X:2579648-2579670 CAAGAAGAGTTGAGGGAAGAGGG - Intergenic
1185910678 X:3977719-3977741 AAAGGCGAGGAGAGGGAAAAGGG + Intergenic
1185915011 X:4025715-4025737 AGAGGGGAGGGGAGGGAAGAAGG - Intergenic
1186061917 X:5718180-5718202 CGAGGGGGGAAGAGGGAGGAGGG + Intergenic
1186604707 X:11078064-11078086 CAAAGAGAGCTGAGTGAAGAGGG - Intergenic
1187404744 X:18993174-18993196 CCAGGGGAGCGGGGAGAAGAAGG - Intronic
1187565332 X:20443964-20443986 CATGGCAAGGAGAGGGAAGAAGG + Intergenic
1187704273 X:21993902-21993924 CAGGAGGAGGAGAGGGAAGGAGG - Intronic
1187772148 X:22711512-22711534 GAAGGGGAAGAGAGGGATGAGGG + Intergenic
1188016980 X:25116748-25116770 CAAGGGGAGCAGAAAGACCATGG + Intergenic
1188134927 X:26483666-26483688 CTAGTGGAGCTGTGGGAAGAGGG + Intergenic
1189011382 X:37048930-37048952 CTAGTGGAGCAGTGAGAAGAGGG + Intergenic
1189158980 X:38791134-38791156 GAATGTGAGCAGAGAGAAGATGG - Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189253526 X:39619945-39619967 GAAGGCGATCAGAGGGAACAAGG + Intergenic
1189578194 X:42377657-42377679 CAAGGGAAGCAGAATGAAAAAGG - Intergenic
1189697563 X:43680530-43680552 GGAGGGGAGGAGAGGGGAGAAGG - Intronic
1190089680 X:47426987-47427009 GAAAGGGGGAAGAGGGAAGAGGG - Intergenic
1190098191 X:47499594-47499616 GGAGGGAAGAAGAGGGAAGATGG + Intergenic
1190144149 X:47875120-47875142 CAAGGGGAACAGAGTGAATGGGG + Intronic
1190203117 X:48381225-48381247 GAAGGGAAGGAAAGGGAAGAAGG - Intergenic
1190207421 X:48414184-48414206 GAAGGGAAGGAAAGGGAAGAAGG + Intergenic
1190452513 X:50595763-50595785 TAAGGCGAGAAGAGGGAAGTTGG - Exonic
1190512839 X:51191900-51191922 CTAGTGGAGCTGTGGGAAGAGGG - Intergenic
1191783980 X:64897639-64897661 CAAGTGGAGCTGTGAGAAGAGGG - Intergenic
1191904812 X:66076991-66077013 GAAGGGAAGGAAAGGGAAGAAGG - Intergenic
1191904851 X:66077112-66077134 GAAGGGGAGGGAAGGGAAGAAGG - Intergenic
1192134655 X:68585899-68585921 CATGGGGAGCAGGAAGAAGACGG + Intergenic
1193066417 X:77265046-77265068 CCAGGGGAGCTGTGAGAAGAGGG + Intergenic
1193850524 X:86531754-86531776 CTAGTGGAGCTGAGAGAAGAGGG + Intronic
1194495836 X:94615886-94615908 CTAGTGGAGCTGAGAGAAGAGGG - Intergenic
1194499211 X:94659001-94659023 CAAGTGGAGCTGTGAGAAGAGGG + Intergenic
1194952664 X:100145293-100145315 CTAGTGGAGCAGTAGGAAGAGGG + Intergenic
1195010371 X:100727854-100727876 CAGGGAGTGCTGAGGGAAGAGGG + Intronic
1195903206 X:109819529-109819551 CTGAGGGAGCACAGGGAAGATGG + Intergenic
1195920381 X:109977739-109977761 CATGTGGGGCAGAGGTAAGAAGG - Intergenic
1195933967 X:110107644-110107666 GGAGGGGAGGGGAGGGAAGAAGG - Intronic
1196083743 X:111661422-111661444 CAAGAGGAAGAGAGGGAAGGGGG - Intergenic
1196098857 X:111827930-111827952 CCAAGGGAGGAGAGGGAAGTAGG - Intronic
1196124282 X:112082691-112082713 GAACAGGAGCAGAGGGAAGCCGG - Exonic
1196847195 X:119905615-119905637 CAAGTGTGGCCGAGGGAAGAAGG - Intronic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1197499119 X:127222360-127222382 CTAGTGGAGCAGTGAGAAGAGGG + Intergenic
1197590009 X:128397061-128397083 CAAGAGGAGGGGAGGGAAGTGGG - Intergenic
1197890207 X:131262787-131262809 CAATGGGCTCATAGGGAAGAAGG - Intergenic
1198160916 X:134007320-134007342 CAATGGGAGAAGAAAGAAGATGG + Intergenic
1198330058 X:135614142-135614164 CAAGAGGAGGAGATGGAAAATGG + Intergenic
1198336860 X:135674852-135674874 CAAGAGGAGGAGATGGAAAATGG - Intergenic
1198411925 X:136379437-136379459 GAAGGGGAGGAGAGGGCAGGGGG - Intronic
1198660850 X:138966208-138966230 CTAGGGGAGCTGTGAGAAGAGGG + Intronic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1198966915 X:142237173-142237195 CCAGTGGAGCAGTGAGAAGAGGG + Intergenic
1199599885 X:149535568-149535590 AAAGGAGAGGAGAGGGATGAGGG - Intergenic
1199650755 X:149944683-149944705 AAAGGAGAGGAGAGGGATGAGGG + Intergenic
1199671621 X:150152570-150152592 CAAGGGCAGGAAAGAGAAGAGGG - Intergenic
1199671987 X:150155344-150155366 CAGGTGGAGAAGGGGGAAGATGG - Intergenic
1199845830 X:151692653-151692675 CAAGGCTTGCAGAGGGGAGAAGG + Intergenic
1200105699 X:153710865-153710887 ATCGGGGAGCAGAAGGAAGAGGG - Intronic
1200402357 X:156026939-156026961 GAAGGGGAGAAGAGGAAAGGGGG - Intergenic
1201146263 Y:11067016-11067038 GGAGGGAAGGAGAGGGAAGAGGG + Intergenic