ID: 1147960976

View in Genome Browser
Species Human (GRCh38)
Location 17:44167419-44167441
Sequence GAACCCTGTTGGCACCCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147960976_1147960979 -1 Left 1147960976 17:44167419-44167441 CCAAATGGGTGCCAACAGGGTTC No data
Right 1147960979 17:44167441-44167463 CATCAAGGCTGCATTTATAGAGG No data
1147960976_1147960980 14 Left 1147960976 17:44167419-44167441 CCAAATGGGTGCCAACAGGGTTC No data
Right 1147960980 17:44167456-44167478 TATAGAGGCATCTTTCTCTGAGG No data
1147960976_1147960981 23 Left 1147960976 17:44167419-44167441 CCAAATGGGTGCCAACAGGGTTC No data
Right 1147960981 17:44167465-44167487 ATCTTTCTCTGAGGACCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147960976 Original CRISPR GAACCCTGTTGGCACCCATT TGG (reversed) Intergenic
No off target data available for this crispr