ID: 1147966202

View in Genome Browser
Species Human (GRCh38)
Location 17:44195524-44195546
Sequence CAGAGAAAAGAGAAGGACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1399
Summary {0: 1, 1: 0, 2: 7, 3: 130, 4: 1261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147966195_1147966202 2 Left 1147966195 17:44195499-44195521 CCAGAGGTACAGGTTAGAGATGG 0: 1
1: 0
2: 0
3: 18
4: 289
Right 1147966202 17:44195524-44195546 CAGAGAAAAGAGAAGGACAGGGG 0: 1
1: 0
2: 7
3: 130
4: 1261
1147966191_1147966202 30 Left 1147966191 17:44195471-44195493 CCAGTTGAATTGTTATACTGCAG 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1147966202 17:44195524-44195546 CAGAGAAAAGAGAAGGACAGGGG 0: 1
1: 0
2: 7
3: 130
4: 1261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147966202 Original CRISPR CAGAGAAAAGAGAAGGACAG GGG Intronic
900678304 1:3901874-3901896 AAAAGAAAAGAAAAGAACAGTGG - Intergenic
900840310 1:5043537-5043559 GAAAGAAAAGACAAGGAGAGAGG - Intergenic
901175194 1:7293809-7293831 CAGAGAAAAGCGAGGGGCACGGG - Intronic
901181646 1:7346192-7346214 CTGAGAAGAGAAAAGGACACTGG + Intronic
901243389 1:7708495-7708517 CAAAAAAAAGAAAAAGACAGTGG + Intronic
901315698 1:8306408-8306430 CAGAAAAAAGAAAAGAAAAGAGG + Intergenic
901493123 1:9606692-9606714 CAGAGGGAAGAGAGGGACAGAGG - Intronic
901551023 1:9996455-9996477 CAGAGAAAAGCAAAGGAGAAGGG - Intergenic
901736647 1:11316742-11316764 CAGGGGCAAGAGAAGGAGAGAGG - Intergenic
901842249 1:11961006-11961028 CAGAGAAAGAGGAAGGACTGGGG + Intronic
902114891 1:14113277-14113299 CAGAGAACAGAGATGTTCAGTGG + Intergenic
902483573 1:16725922-16725944 CAGAGTAAAGCGAAGCCCAGCGG - Intergenic
902651635 1:17841328-17841350 CAGGGACAAGAGAAGGGCACGGG - Intergenic
902689715 1:18103019-18103041 CAGAGAAAAGGGATGGACCCAGG - Intergenic
902997378 1:20237165-20237187 CAGAGAAAAGCTCAAGACAGTGG - Intergenic
903057110 1:20643809-20643831 CCCAGAGAAGATAAGGACAGAGG + Intronic
903772149 1:25770717-25770739 CAGAGAGGGGAGAAGGAAAGTGG - Intronic
904272050 1:29356545-29356567 CAGAGCTAAGAGAAGGAAGGAGG + Intergenic
904485886 1:30824386-30824408 GAGAGAGAGGAGAAGGACAGAGG + Intergenic
905274748 1:36809999-36810021 AAGACAGAAGACAAGGACAGTGG - Intronic
905800736 1:40840611-40840633 CAGAGAACTGAGAAGTCCAGGGG + Intergenic
906245681 1:44272082-44272104 CAGGGACAAGCGAAGGGCAGGGG + Intronic
906387614 1:45384948-45384970 CTGAGAAAAGAGAGAGACTGAGG + Intronic
906693064 1:47805484-47805506 CTAAGGAAAAAGAAGGACAGGGG - Intronic
906952941 1:50349305-50349327 GAGAGAAAAGAGCAGGGGAGAGG - Intergenic
907022286 1:51080000-51080022 GAGAGAAAAGGAAAGGAAAGGGG - Intergenic
907063405 1:51454370-51454392 CAGAGAATAGAGTAGGAAAAGGG + Intronic
907774505 1:57500207-57500229 CAGAGAAATGAGAAAAAAAGAGG + Intronic
908445175 1:64192771-64192793 TTGAGGAAAGAGAAGGACATGGG - Intergenic
908719305 1:67107325-67107347 CAGAGAAACAAAAAGCACAGGGG + Intronic
909225837 1:73021148-73021170 GAGACAGCAGAGAAGGACAGGGG - Intergenic
909283338 1:73785368-73785390 CAGTGTCAAGAGCAGGACAGAGG + Intergenic
909684483 1:78331857-78331879 AAGAAGAAAGAGAAGGAGAGAGG - Intronic
909738692 1:79000470-79000492 CTTTGAAAAGAGAAGGAAAGGGG - Intronic
909979114 1:82077395-82077417 CAGAGTTAGGATAAGGACAGCGG - Intergenic
910133380 1:83936352-83936374 CAGAAAAAAAAGAATGCCAGAGG + Intronic
910262720 1:85307651-85307673 CAGAGGACAGAGGAGGAGAGAGG - Intergenic
910854404 1:91680450-91680472 CAGAGAAAAGAATACAACAGGGG + Exonic
911358096 1:96846020-96846042 GAGAGAGAAAAGAAGGAGAGGGG - Intergenic
911475847 1:98371328-98371350 CAGAGGAATGAGATGGACACAGG + Intergenic
911523989 1:98962564-98962586 CAGAGAAAATGGAAGCACAAAGG - Intronic
911697508 1:100907839-100907861 CAAAGACAAGAGAAGGAAAAGGG - Intronic
912111199 1:106345298-106345320 GAGAGAATAGAGAAGGAGAAAGG + Intergenic
912323053 1:108732715-108732737 AAGAGAAAAGAGAGGGAGGGAGG - Intronic
912390937 1:109302429-109302451 CAGAAAAAATAAAAGGACATAGG + Intronic
912423797 1:109567941-109567963 GAGAAAAAAGAGAAGGACTCAGG + Intronic
912438519 1:109679918-109679940 CAGAGAGGAGAAAAAGACAGAGG + Intronic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
912980574 1:114368067-114368089 CAGAGAGGAGAGAAAGAGAGGGG - Intergenic
913090680 1:115474734-115474756 CAGAAAAGAAACAAGGACAGTGG - Intergenic
913276284 1:117141237-117141259 CAGATAAAAGGGAAGGTGAGAGG + Intergenic
913310994 1:117493115-117493137 AGGAGAAAACAGAAGGATAGAGG - Intronic
913476623 1:119244535-119244557 CAGAGGGAAAAGAAGGAAAGAGG - Intergenic
913569515 1:120106083-120106105 GAAAGAAAAGAGAAGAGCAGTGG - Intergenic
914000548 1:143691145-143691167 GAGAGAAAAGAAAAGAAAAGAGG + Intergenic
914290326 1:146267073-146267095 GAAAGAAAAGAGAAGAGCAGTGG - Intergenic
914392658 1:147236298-147236320 GAGAGAAGAGAGAAGGAGAGAGG - Intronic
914476642 1:148029063-148029085 AAAAGAAAAGAGAAGAAAAGAGG - Intergenic
914551369 1:148717856-148717878 GAAAGAAAAGAGAAGAGCAGTGG - Intergenic
914730695 1:150367504-150367526 AAGAAAAAAGAGAAGCAAAGTGG - Intronic
915190440 1:154146158-154146180 TAAAGAAAAGATAAGGACAAAGG + Intronic
915303948 1:154967368-154967390 CAGAGAAATGAGCAAGAAAGAGG + Intronic
915800333 1:158784576-158784598 CAGAGACTAGAGAAGAAAAGGGG - Intergenic
916049287 1:161023863-161023885 CAAAGAAAAGAGAGAGAGAGAGG - Intronic
916149333 1:161771129-161771151 AAGAGAAGAGAGAAGGAGAGAGG - Intronic
916446943 1:164881282-164881304 CAGAGAGAAAGGAAGGAAAGAGG + Intronic
916572886 1:166042460-166042482 AAAAGAAAAAAGAAGAACAGAGG - Intergenic
916954099 1:169813674-169813696 CAGAAAAAGGAGAAGGTTAGCGG + Intronic
916981122 1:170138195-170138217 GACAGAAAAGAGAAGAAAAGAGG - Intergenic
917159323 1:172040027-172040049 CAGAGAAAACAGAGGGCCTGTGG + Intronic
917212500 1:172644721-172644743 GTGAGAAAAGAGGAGGACAGAGG - Intergenic
917249787 1:173045922-173045944 AAGAGAAAATAGAAGTACGGAGG - Intronic
917303850 1:173607278-173607300 CTTAGAAAATAGAAGGTCAGAGG + Intergenic
917444216 1:175093141-175093163 CAGGGAAGTGAGAGGGACAGTGG - Intronic
917505141 1:175620580-175620602 CAGAGAGAAAAGAAGCAGAGGGG + Intronic
917931373 1:179824892-179824914 CAGAGTTAAGAGAAGGGCGGGGG - Intergenic
918374478 1:183895395-183895417 GAGAGGGAAGAGAAGGGCAGAGG + Intronic
918430489 1:184454935-184454957 AAGAGAAAAGAGAAAGAAAGAGG + Intronic
918682183 1:187369352-187369374 CAGAGCAGAGAGTAGGGCAGAGG + Intergenic
918688088 1:187444821-187444843 GAGAGAAGAGAGAAAGAAAGAGG - Intergenic
918993221 1:191725600-191725622 GAGAAAAAAGAGAAAGAGAGAGG + Intergenic
919303996 1:195806663-195806685 CAGACAAAAGAGAAGGCCATGGG + Intergenic
919500358 1:198330596-198330618 AAGAGAAAAGGTGAGGACAGGGG - Intergenic
919533399 1:198754512-198754534 TAGAGAAGAGAAAAGGAAAGGGG - Intronic
919573882 1:199282477-199282499 CACAGAAAAGAAATGGACAGAGG + Intergenic
919728053 1:200896389-200896411 TAGAGATAAGAACAGGACAGAGG - Intronic
919973056 1:202593098-202593120 CAGAGGAAAGGGAAGGGAAGGGG + Exonic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920088902 1:203438235-203438257 AAAAGAAAAGACAGGGACAGGGG + Intergenic
920369292 1:205467752-205467774 CAGAGAACACTGAAGTACAGAGG + Intergenic
920705246 1:208245561-208245583 CGGAGAAAAGAGAGAGAGAGAGG + Intergenic
920824651 1:209413993-209414015 CTGAGCAAAGAGAAGGAAAACGG + Intergenic
920978380 1:210807877-210807899 TAGAGATAAGGGAAGGACTGAGG + Intronic
921233214 1:213095251-213095273 CAGAGTAAAAAGAAAGAGAGAGG - Intronic
921671350 1:217927265-217927287 GAGAGCAAAGAGAAGGAGAGTGG + Intergenic
921821754 1:219624609-219624631 CATGGAAAAGTGAAGGACAGGGG - Intergenic
922038459 1:221872895-221872917 CAAAGAAAAGAGAGGAACTGAGG - Intergenic
922241201 1:223756428-223756450 CAGAGAAAAGAGATGGGCTTTGG - Intronic
922570304 1:226630823-226630845 AAGAGAAAAGAAAAGAAAAGAGG + Intergenic
922875932 1:228939965-228939987 CAGAGGACAGGGAAGGAAAGAGG + Intergenic
922964987 1:229682039-229682061 AAGAGAAGAAAGAAGGAGAGAGG - Intergenic
922979414 1:229813044-229813066 CAAAGAATAGGGAGGGACAGAGG - Intergenic
923057100 1:230435087-230435109 AAGAGAAAAGAAAAGAACATAGG + Intergenic
923142698 1:231174593-231174615 CAGAGAAGGGAGAGGGAGAGGGG - Intronic
923226098 1:231940165-231940187 CAGAGAGAGGGGAAGGACAGAGG - Intronic
923310228 1:232727940-232727962 CATAGCAATCAGAAGGACAGTGG - Intergenic
923486641 1:234438686-234438708 GAAGGAAAAGAGAAAGACAGTGG + Intronic
923693180 1:236217417-236217439 CAGTGAAAAGAAAAGGTGAGGGG + Exonic
923847706 1:237754934-237754956 CAGAGAAAAGAAAAAAAAAGAGG - Intronic
924035647 1:239933862-239933884 CAAAGAAAAGAAAAGGACAATGG + Intergenic
924096571 1:240557714-240557736 AACAAAAAAGAGAAGGACAAGGG + Intronic
924197503 1:241623750-241623772 CAGAGCAAAGGGAATGAAAGAGG - Intronic
924481157 1:244435555-244435577 GAGGAAGAAGAGAAGGACAGAGG - Intronic
924481164 1:244435593-244435615 GAGGAAGAAGAGAAGGACAGAGG - Intronic
924750958 1:246889252-246889274 AAGAGAAAAGAAAAGGAAATAGG - Intronic
924917591 1:248589398-248589420 CAAACAAAAGAGAGGGAAAGTGG + Intergenic
1063075175 10:2709387-2709409 GAAAGAAAAGAGAGGGGCAGTGG - Intergenic
1063159786 10:3410730-3410752 CAAAGAAAAGAAAAGAAAAGAGG + Intergenic
1063799787 10:9561706-9561728 AAGAGAATAGGGAAGGAAAGTGG - Intergenic
1063860483 10:10302053-10302075 CAGAGCAAAGAGAAGTATACAGG - Intergenic
1063861304 10:10310747-10310769 CAGAGGAGAGGGAAGGACTGAGG + Intergenic
1063877020 10:10490664-10490686 CAGAAAAAAGTGAAGAACATAGG + Intergenic
1063886113 10:10580768-10580790 CAGAGAAAAGGGAATCAAAGTGG + Intergenic
1063901266 10:10734668-10734690 AAGAGAAAAGGGAAGGAAATAGG + Intergenic
1063957399 10:11280170-11280192 CAGAAAAGAGAGAGCGACAGAGG + Intronic
1063960061 10:11299534-11299556 AAGAGAAAGGGCAAGGACAGGGG - Intronic
1064620933 10:17216737-17216759 CAGAGAAAAGAGGAGCAGATTGG + Intergenic
1064697018 10:17976895-17976917 CAGAGAAAGGAGAAAGAGAAAGG - Intronic
1065242739 10:23724010-23724032 CAGAGACAAGAGAAAGCAAGCGG + Intronic
1066022133 10:31314387-31314409 CAGAGAAAGGAAAAAGAGAGAGG - Intergenic
1066129221 10:32374439-32374461 TAGAGAAAAGAGATGAAGAGAGG - Intronic
1066253951 10:33660842-33660864 CAGAGAAGAGAGCAGGGGAGGGG - Intergenic
1066463583 10:35633753-35633775 CAGAGACAAGAGGAGCACTGTGG - Intergenic
1067097589 10:43312729-43312751 CAGAGAAAGAAGGAGAACAGGGG - Intergenic
1067798714 10:49341290-49341312 CACAGAAAAAAGAAAGAAAGAGG + Intergenic
1068052517 10:51968356-51968378 CAGAAGAAAGAGCAGGACTGTGG + Intronic
1068086637 10:52381696-52381718 CAGTGGAGAAAGAAGGACAGAGG + Intergenic
1068357217 10:55924053-55924075 GAGAGAAAAGAAAAGGAAGGAGG + Intergenic
1068459185 10:57304447-57304469 CATAGAAAAGAGAAAGATAGGGG + Intergenic
1069180017 10:65347285-65347307 CATAGCAAAAAGAAGGAAAGAGG + Intergenic
1069276463 10:66596594-66596616 AAGAGAAAAGAGAAATAGAGTGG + Intronic
1069683538 10:70301552-70301574 CAGACAGAAAAGAAGGACAATGG + Intronic
1069889736 10:71645453-71645475 CAGAGGAAGGAGGAGGAGAGAGG - Intronic
1069916700 10:71791033-71791055 GAGAGAGCAGAGAAAGACAGGGG - Intronic
1070158578 10:73851607-73851629 CAAAGGAAAGAAAAGGGCAGAGG + Intronic
1070258354 10:74829025-74829047 AAAAGAAAAGAGAGAGACAGAGG + Intronic
1070357478 10:75654560-75654582 TAGAATAAAGAGAAGGAGAGGGG - Intronic
1070614842 10:77961712-77961734 GTGAGAAAAGCGAAGCACAGAGG + Intergenic
1070676585 10:78415993-78416015 GAGAGAAGAGAGGAAGACAGAGG - Intergenic
1071301325 10:84258037-84258059 CAGAGAACAAAGATGGAGAGGGG - Intronic
1071490597 10:86133996-86134018 CAGAGGAAACAAAAGGAAAGAGG + Intronic
1071710858 10:88047833-88047855 CAGAGAAAGGAAAAGGAAAGGGG - Intergenic
1071807741 10:89142766-89142788 AAGAGAAAGGAGAAGGGGAGGGG + Intergenic
1072826559 10:98612649-98612671 GAAAGGAAAAAGAAGGACAGAGG + Intronic
1073112684 10:101072018-101072040 CAGATAAAAGAGATGGATGGAGG - Intergenic
1073466761 10:103698804-103698826 CAGAGAAAAGAGAGGTCCTGGGG + Intronic
1073740748 10:106403697-106403719 CAGAGCAAAGCGAAAGAAAGTGG + Intergenic
1074133900 10:110610208-110610230 CATAGAAAATTGAAGGACACGGG + Intergenic
1076098238 10:127751233-127751255 CAGATAAGAGAAAAGGACATTGG + Intergenic
1076304952 10:129459548-129459570 CAGAGAAATGAGAAGTCCAGGGG + Intergenic
1076409916 10:130241216-130241238 CAGAGAAAAAATATGAACAGAGG - Intergenic
1076542908 10:131225420-131225442 CTGAGAAGGGAGGAGGACAGAGG + Intronic
1076564167 10:131386823-131386845 CAGAGAAAGGAGAGGAGCAGAGG + Intergenic
1077284567 11:1759923-1759945 CACGGAAAAGACAAGGCCAGAGG + Intronic
1077523696 11:3051251-3051273 CCAAGGAAAGAGAAAGACAGGGG + Intronic
1077553899 11:3216834-3216856 AAGAGAAGAGAGAAGGGGAGGGG - Intergenic
1077761900 11:5110560-5110582 AAGAGAACAGAGGAGGAGAGAGG + Intergenic
1077838151 11:5943184-5943206 TAGAGAAAATAGAAGGAAAAAGG + Intergenic
1077948196 11:6925904-6925926 GAGAGAAAATAGAAGGAAATGGG - Intergenic
1077985319 11:7345819-7345841 GTGATAAAAGAGGAGGACAGAGG + Intronic
1078001860 11:7503254-7503276 CAAAGAAAAGAGGAGGCCTGAGG + Intronic
1078151088 11:8760194-8760216 CTGAGAAGATAGAAGGAAAGGGG - Intronic
1078327736 11:10394150-10394172 GAGAGAAAAGAAAGGGGCAGGGG - Intronic
1078401247 11:11029274-11029296 CAGAGGAAAGTGGAGGGCAGAGG + Intergenic
1078425030 11:11242954-11242976 CATAGAAACTAGGAGGACAGAGG + Intergenic
1078564156 11:12399190-12399212 CAGAGAAAAGTAAATGTCAGTGG - Intronic
1078587152 11:12601675-12601697 AAGAGAAAAGAGATGGAAAGAGG - Intergenic
1078652836 11:13211934-13211956 TAGAGAAGAGAGAATGACATGGG + Intergenic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078827992 11:14950231-14950253 CTGAGAAACTAGAAGGACAAAGG - Intronic
1078914717 11:15768674-15768696 AAGAGGAAAGAGCAGGACAAAGG - Intergenic
1078969461 11:16390589-16390611 CAGATCAAAGGAAAGGACAGTGG - Intronic
1079115249 11:17636459-17636481 CACAGAACAGAGTAGGAGAGGGG + Intronic
1079492403 11:21003586-21003608 CAGAGTATAGAGAAGGAGACAGG - Intronic
1079530932 11:21452113-21452135 AAAAGAAAAGAGAAGGAGAGAGG + Intronic
1079834148 11:25310350-25310372 AAGAAAAAAGAGAAAGAAAGAGG + Intergenic
1079940602 11:26675540-26675562 GTGAGAAAAGAGAAGGTCAAAGG + Intronic
1079960596 11:26918556-26918578 GAGAGAGGAGAAAAGGACAGAGG + Intergenic
1080232922 11:30037868-30037890 AAGAGACAAGAGAAGGAGGGAGG + Intergenic
1080795607 11:35560214-35560236 AAGGGAAAGGAGGAGGACAGAGG + Intergenic
1080825205 11:35842538-35842560 GAGATAAATGAGAAGGAGAGAGG + Intergenic
1080851256 11:36072316-36072338 CATACAAAAGAGCTGGACAGAGG - Intronic
1081354809 11:42099565-42099587 GAGAGCAAGGAGAAGGAGAGTGG + Intergenic
1081651643 11:44827823-44827845 CAGAGAAAGGAGAGGGACATGGG + Intronic
1081653274 11:44839788-44839810 CAGAGGACAGAGAAGGCCAGTGG + Intronic
1081727172 11:45338500-45338522 CAGATAAGAAAGAAGGCCAGCGG + Intergenic
1081823606 11:46024312-46024334 CAAGAAAAAGAGAAGGACAGAGG - Intronic
1081842512 11:46213297-46213319 TAAAAAAAGGAGAAGGACAGAGG - Intergenic
1082151109 11:48739808-48739830 CAGAGAGAACACATGGACAGAGG + Intergenic
1082850665 11:57761655-57761677 AAGAGAGGAGAGAAAGACAGGGG - Intronic
1083508452 11:63183818-63183840 CTGAGCAAAGAAGAGGACAGAGG + Intronic
1084046876 11:66574094-66574116 CGGAGCAAAGAACAGGACAGGGG - Intergenic
1084534100 11:69746645-69746667 CCCATAAAAGAGAAGGAAAGAGG - Intergenic
1084563593 11:69917570-69917592 AAGAGAAGAGAGAAGGGGAGGGG - Intergenic
1084680735 11:70664760-70664782 CATAGACTAGAGAAGGGCAGGGG + Intronic
1084975899 11:72798126-72798148 CAGAGTAAAGAGAGGGTCTGTGG - Intergenic
1085062756 11:73462923-73462945 AAGAGAAAAGAGAAGAGAAGAGG + Intronic
1085136081 11:74090029-74090051 CAGAGAAAACAGCAAGACAAAGG + Intronic
1085256371 11:75175896-75175918 CACAGAGAAGAGCAGGACATGGG + Intronic
1085338608 11:75717002-75717024 GAGAGAAAAGAGAAGTCCCGAGG + Intergenic
1085349987 11:75792208-75792230 CAGAGATGTGAGAAGGACACAGG - Intronic
1085380859 11:76116568-76116590 CTTTGAAAAGAGAAGGAGAGAGG + Intronic
1085520025 11:77132242-77132264 CAGAGAAAGGAGGAGGACTGTGG - Intronic
1085583826 11:77681430-77681452 CAGGGAAGAGGGAAGGAAAGGGG - Intronic
1085658284 11:78337533-78337555 CAGGGAAAAGAGAAAGAAGGTGG + Intronic
1086103143 11:83122452-83122474 CAAAGAAAATAGAAGGGCTGGGG - Intergenic
1086118445 11:83280401-83280423 CAGATAAAAGAGAGGCTCAGAGG - Intronic
1086134976 11:83436043-83436065 CAGAGCAAAGAGCAGGACAGGGG + Intergenic
1086144161 11:83533273-83533295 CAGAGATGACAGAAGGACATTGG - Intronic
1086168430 11:83807602-83807624 AACAGAAAAGAAAAGGAGAGAGG + Intronic
1086219009 11:84419113-84419135 TACAGAAAAGAGAAGGCGAGAGG + Intronic
1086284109 11:85225660-85225682 GAGAGAAGAGAAAAGGAAAGAGG - Intronic
1086307128 11:85493669-85493691 CAGAGAGGAGAGAAGGGGAGGGG + Intronic
1086369656 11:86143736-86143758 CAGAGAAACAGGAAGAACAGTGG - Intergenic
1086510659 11:87554380-87554402 CAGAGAAGAGATAAGCACAAAGG - Intergenic
1087078552 11:94148504-94148526 TATAGAGAAGAGATGGACAGTGG - Intronic
1087386998 11:97483759-97483781 CAGAAAACAAAAAAGGACAGGGG + Intergenic
1087419644 11:97905551-97905573 CAGAGAAAAGAGAAATAATGAGG + Intergenic
1087473632 11:98608618-98608640 TAGAGAAAAAAAAATGACAGGGG + Intergenic
1087684328 11:101245964-101245986 CAGAGGAGAGAGAGAGACAGAGG + Intergenic
1087684336 11:101246053-101246075 CAGAGGAGAGAGAGAGACAGAGG + Intergenic
1087684341 11:101246108-101246130 CAGAGGAGAGAGAGAGACAGAGG + Intergenic
1087684350 11:101246182-101246204 CACAGAAGAGAGAGAGACAGAGG + Intergenic
1087684355 11:101246235-101246257 CACAGAAGAGAGAGAGACAGAGG + Intergenic
1087684360 11:101246288-101246310 CACAGAAGAGAGAGAGACAGAGG + Intergenic
1087766037 11:102155140-102155162 CAGAAAAGAGGGCAGGACAGTGG - Intronic
1088506505 11:110532640-110532662 CAAGGAAAAGAGAACGAGAGTGG - Intergenic
1088887289 11:114017846-114017868 CAGAGGTAAGAGAAGGGCATAGG - Intergenic
1088916358 11:114230872-114230894 CAGAAAAGAGAGAGAGACAGAGG - Intronic
1089119073 11:116119102-116119124 CAGGGAGAAGGGAAGGAAAGGGG - Intergenic
1089135290 11:116244270-116244292 GAGAGATGAGAGAAGGAGAGGGG - Intergenic
1089357269 11:117862120-117862142 CAAAGGAAAGAGAAAGAAAGAGG + Intronic
1090410887 11:126508897-126508919 GAGAGAAGAGAGAAGGGCAAGGG - Intronic
1090566306 11:127995632-127995654 CAGAGAACAGAGAAGATGAGTGG - Intergenic
1090585942 11:128213406-128213428 CAGAGCAGAGAGATGGTCAGTGG - Intergenic
1090918035 11:131183989-131184011 CTGAGAAAAGAGTAGCCCAGAGG - Intergenic
1090943654 11:131410537-131410559 AAAAAAACAGAGAAGGACAGAGG + Intronic
1091050003 11:132358834-132358856 AAGAGAAGAGAGAGGGACGGGGG - Intergenic
1091153470 11:133351395-133351417 CTGAGAAGAGAGAAATACAGTGG - Intronic
1091287496 11:134415836-134415858 CTGAGAAGAGAGGAGGGCAGAGG - Intergenic
1091592024 12:1848243-1848265 CAAGGAAAAGAGAAGGGGAGAGG - Intronic
1091694920 12:2622042-2622064 GAGAGGAAGGAGAAGGAAAGGGG + Intronic
1091936140 12:4435815-4435837 CAGAGGAAAGAGGAGGACTTGGG - Intronic
1091957271 12:4657018-4657040 AAGGGAAAAGAGAAAGAAAGTGG - Intronic
1092147107 12:6222340-6222362 CAGAGAAAAGGGAGGGCCAGGGG - Intronic
1092306046 12:7302187-7302209 GGGAGAAAAGAGAAGCAGAGTGG - Intergenic
1092367972 12:7892769-7892791 AAGAGAAAAGGGAAGGAGAGAGG + Intergenic
1092629343 12:10361671-10361693 AAGAGCAAAGAGAAGGTTAGAGG + Intergenic
1092724146 12:11468541-11468563 AAGAAAAAAGAGAATGAAAGGGG - Intronic
1093318288 12:17678938-17678960 AAAAGAAAAGAGAAGGAGGGAGG + Intergenic
1093482962 12:19624190-19624212 CAGGGAAGATAGAAGGCCAGAGG - Intronic
1093576841 12:20741076-20741098 CACAGGAGAGAGAAGTACAGAGG + Intronic
1093626617 12:21356497-21356519 GAGAGAAAAAGGAAGGAGAGAGG + Intronic
1093739872 12:22672681-22672703 CAAACTAAAGAGAAGGAAAGGGG + Intronic
1093841254 12:23904234-23904256 TAGAGAAAAGAGAAGAAAAATGG - Intronic
1094079384 12:26516147-26516169 CGAAGAAAAGAGAAGGGGAGAGG + Intronic
1094086636 12:26600465-26600487 CAGAGAGGAAAGGAGGACAGAGG - Intronic
1094303221 12:28989498-28989520 CAGAGAATAGAAAAGGAAACAGG - Intergenic
1094622455 12:32093142-32093164 CAGAAAAAATGGAGGGACAGTGG + Intergenic
1094628422 12:32148405-32148427 GAGAGGTCAGAGAAGGACAGTGG - Intronic
1095334617 12:41010458-41010480 GAAGCAAAAGAGAAGGACAGAGG - Intronic
1095817887 12:46444322-46444344 CAGAGATAAGAGAAGATCAAGGG + Intergenic
1096436318 12:51592882-51592904 TGGAGAAAAGAGAAGTGCAGAGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096581240 12:52586848-52586870 AAGAGAAATCAGAATGACAGAGG - Intronic
1096586148 12:52621272-52621294 CAGAAAAGAGAGAAAGAAAGGGG + Intergenic
1097200414 12:57273447-57273469 GAGAGATGAGAGAAGGAGAGAGG + Intronic
1097519287 12:60647382-60647404 AAAACACAAGAGAAGGACAGAGG - Intergenic
1097533212 12:60832288-60832310 AAAAGAAAAGAAAAAGACAGAGG - Intergenic
1097577241 12:61410074-61410096 CAGAGAAAAGATATTGAAAGTGG + Intergenic
1097743869 12:63277577-63277599 AATAGAAAAGAGAATTACAGAGG + Intergenic
1097834135 12:64256667-64256689 AAGAGGAAAGAGAAGGGAAGAGG + Intergenic
1097973290 12:65657962-65657984 CAGAGAAAAGAGGAGAACCAAGG - Intergenic
1098014527 12:66090417-66090439 CAGAGAAAAGATAGAGAAAGAGG + Intergenic
1098249763 12:68557229-68557251 GGGAGATAAGAGAAGGAGAGAGG - Intergenic
1098599521 12:72314265-72314287 AAAAGAAAAGAGAAAGAGAGAGG - Intronic
1098619544 12:72577516-72577538 CAGAGGATATAGAAGGACTGAGG + Intronic
1098800952 12:74957192-74957214 CATAGCTAAGAGAAGAACAGAGG + Intergenic
1099060288 12:77900025-77900047 GAGAGAGGAGAGAGGGACAGGGG - Intronic
1099872585 12:88368523-88368545 CGGAGCAAAGAGCAGGACAGGGG - Intergenic
1100035309 12:90243666-90243688 CAAAGAAAAGAGAAGAGAAGGGG - Intergenic
1100181393 12:92090407-92090429 CATAGAAAAAAGAAAGTCAGAGG + Intronic
1100242809 12:92726768-92726790 AGGAGAAAGGAGAAGGGCAGAGG + Intronic
1100393801 12:94167080-94167102 CAGAAATCAGAGAAGGACACCGG + Intronic
1100782753 12:98046950-98046972 AGGGGAAAAGAGAAGGAAAGCGG - Intergenic
1100887867 12:99092323-99092345 GAGCTAAAAGAGTAGGACAGAGG - Intronic
1100958082 12:99931355-99931377 AAAAAAAAAGAGAATGACAGAGG + Intronic
1101008889 12:100429936-100429958 CAGAAGAAAGAGAAGGGAAGAGG - Intergenic
1101065843 12:101019511-101019533 CATGGAAAAGGTAAGGACAGAGG + Intronic
1101287464 12:103329733-103329755 CAAAGAAAAGACAAGGAAAAGGG + Intronic
1101645934 12:106630956-106630978 CAGAGCAAAGACAAGGACCCAGG - Intronic
1101682042 12:106978567-106978589 CAAAGAAAATACAAGAACAGTGG - Exonic
1101731360 12:107429025-107429047 CAGGGGAAAGAGAGGGAGAGAGG + Intronic
1101802172 12:108032013-108032035 CCGAGAAAAGAGAAGGACCCAGG + Intergenic
1101834108 12:108283010-108283032 CAGGGAAAAGAAAAGGCCAAGGG + Intergenic
1101842848 12:108340462-108340484 AAAAGAAAAGGGAAGGGCAGGGG + Intergenic
1102030603 12:109738092-109738114 GAGAGGAAAGAGACAGACAGTGG + Intronic
1102552507 12:113702094-113702116 GAGAGAAAAGGGAAGGAGAAAGG - Intergenic
1102852254 12:116259534-116259556 GAGAGAAAAGAGAATGGGAGAGG + Intronic
1103006409 12:117423853-117423875 CAGAGAAAGGGGAAGAACAAAGG + Intronic
1103501249 12:121404351-121404373 CAGACACAAGAGAAGTATAGGGG - Intronic
1103677246 12:122665551-122665573 AAGAGAAAAGAGAAGAAAAGAGG - Intergenic
1104086018 12:125474785-125474807 CAGAGCCCAGAGACGGACAGAGG - Intronic
1104165943 12:126229956-126229978 CAGAGTAAACAGAAGTACAGGGG + Intergenic
1104238780 12:126966407-126966429 AAGAGAATAAAGAAGGACTGAGG - Intergenic
1104301424 12:127568537-127568559 GAGAGAGAAGAGAGGGAGAGAGG + Intergenic
1104301430 12:127568575-127568597 GAGAGAGAGGAGAAGGAGAGAGG + Intergenic
1104379636 12:128295862-128295884 CAGAGCAGAGAGAAAGACAGAGG - Intronic
1104451875 12:128875876-128875898 CAGAGAAAGGAGAAGATGAGGGG - Intronic
1104455948 12:128912384-128912406 GAGAGAAAAGAAAAGTACATTGG - Intronic
1104684203 12:130773800-130773822 GAGAGAAATAAGAAGGCCAGTGG + Intergenic
1105031918 12:132890018-132890040 CGGAGCAAAGAGTAGGACAGGGG - Intronic
1105438995 13:20400284-20400306 GAGAGAAAACAGAAGGGCAGAGG - Intergenic
1105572846 13:21620348-21620370 AAGAGAAAGGAGAAGGAGATTGG - Intergenic
1106395877 13:29380453-29380475 CAGAGAAATGAGTAGGGCAGAGG - Intronic
1106400517 13:29425453-29425475 CAAAGAAAAAAGAAAGACAAGGG + Intronic
1106519187 13:30482251-30482273 AAGAGAAAAGAGAAAGGGAGAGG - Intronic
1106646782 13:31643556-31643578 CAGAGAAAACAGAAGTATATAGG + Intergenic
1106682736 13:32024997-32025019 AAAAGAGAAGAGAAGGAAAGAGG - Intergenic
1106769643 13:32949353-32949375 CAGAGAACAGAAAAGGGCGGGGG + Intergenic
1106999514 13:35527025-35527047 GAGAGAAGAGAGAAGGAGAGAGG - Intronic
1108942560 13:55976135-55976157 CAGAGAACAGAGAATGAAAAAGG + Intergenic
1109506472 13:63309019-63309041 CAGAGGATAAAGAAGCACAGAGG + Intergenic
1109556870 13:63987536-63987558 AAGAGAAAGGAGAAGAAAAGTGG - Intergenic
1109576927 13:64271935-64271957 GAGAGAAAAGAAAAAGACATGGG - Intergenic
1109664892 13:65521257-65521279 CAGAGAAAAGTGAAAGACAGAGG - Intergenic
1109734909 13:66470044-66470066 CACAGAGAAGAAAAGGAAAGAGG - Intronic
1109977643 13:69860370-69860392 CAGAAAAAAGAGAATGTTAGTGG + Intronic
1110046287 13:70836260-70836282 AAGAAAAAAGAGATGGAGAGAGG - Intergenic
1110086110 13:71382009-71382031 AAAAGAAAAAAGAAGGACAAAGG - Intergenic
1110098437 13:71562387-71562409 CAGAGAGAAGAGATGGGAAGAGG + Intronic
1110103993 13:71646977-71646999 TAGAGAAAAGAGAAAGGCATGGG + Intronic
1110120040 13:71868394-71868416 AAAAGAAAAGAAAAGGAAAGAGG - Intergenic
1110297365 13:73884233-73884255 CTGAGAAAAGAGAAGAATATAGG - Intronic
1110347590 13:74465939-74465961 CAGTGAGAAGCCAAGGACAGCGG - Intergenic
1110572718 13:77024041-77024063 GAGAGAAAATAGAATGACAGAGG + Intronic
1111363975 13:87216320-87216342 AAGAGAATAAAGAAGGAAAGAGG - Intergenic
1111504864 13:89174232-89174254 AAGAGAAAAGGGAAGGGCAAGGG - Intergenic
1111592405 13:90367185-90367207 CAGAGAAAAGAAAAGAAGAGGGG + Intergenic
1111728862 13:92047106-92047128 CAGACAAAAGAAAAGGTAAGAGG - Intronic
1111773428 13:92628129-92628151 ATTAGAAAAGAGAGGGACAGAGG + Intronic
1111948890 13:94694072-94694094 CACAGCAAAGAGAAAGAGAGAGG + Intergenic
1112106770 13:96249047-96249069 GAGAGGAAAGAGAAGACCAGAGG - Intronic
1112235353 13:97630962-97630984 CAGAGGAATGAGAAGAAAAGTGG + Intergenic
1112527701 13:100168033-100168055 GAGAGAAAAGAGGGGGTCAGTGG - Intronic
1112554248 13:100452154-100452176 AAGAAAAAAGAGAAGGAGAGAGG - Intronic
1112628558 13:101135316-101135338 CAGAGACAAAAGAAGGTGAGTGG + Intronic
1112652221 13:101412324-101412346 CAAAGAAAAGAGATGAAAAGAGG - Intronic
1112844680 13:103625549-103625571 CAGAGAAAGGAGAATGACTTTGG - Intergenic
1112999721 13:105620057-105620079 CATAGTAATGAGAAGGACTGGGG + Intergenic
1113108816 13:106799866-106799888 CAGATAAGAGAAAAGGAGAGTGG + Intergenic
1113292509 13:108922250-108922272 GAGAGGAAAGAGGAGGAAAGAGG + Intronic
1113625441 13:111792921-111792943 AAGAGAAGAAAGAAAGACAGAGG - Intergenic
1113975188 13:114222725-114222747 CAGTGAAGAGAGGAAGACAGCGG - Intergenic
1114281273 14:21194275-21194297 CTTAGAAAAGAGAAAGAGAGTGG + Intergenic
1114290921 14:21287641-21287663 CAGAGAAAAGGGATGGTCATCGG + Intergenic
1114672494 14:24418796-24418818 CAGAGGAAAGAGGATCACAGAGG + Exonic
1114693422 14:24606137-24606159 CAGAGAATGGAGCAGGGCAGTGG - Intergenic
1114708940 14:24757479-24757501 CAGAGAAAAGAAAGGGATAGAGG + Intergenic
1114782284 14:25551182-25551204 CAGAGAAGAGAGAGGGAATGGGG + Intergenic
1114976382 14:28105747-28105769 CAGGGACAAGAGAAACACAGAGG - Intergenic
1115096145 14:29638119-29638141 GATTGAAATGAGAAGGACAGAGG + Intronic
1115161397 14:30399601-30399623 CAGAGAAAGATGAAGGCCAGAGG + Intergenic
1115726535 14:36223303-36223325 CAGAGGAAGGATAAGGAAAGAGG + Intergenic
1115790968 14:36877732-36877754 CACAGAAAAAAGAAGAAAAGAGG + Intronic
1116060034 14:39911868-39911890 GAGAGAAGAGAGAGGGACACAGG - Intergenic
1116113290 14:40614175-40614197 CAGGCGAAAGAGAAGGGCAGTGG + Intergenic
1116215674 14:42014150-42014172 AAGATAAAAGAGATGGACAAGGG - Intergenic
1116237675 14:42300185-42300207 TAGAGAATAAAGAAGGAGAGAGG + Intergenic
1116682279 14:47987472-47987494 CACATCTAAGAGAAGGACAGTGG + Intergenic
1116803831 14:49471637-49471659 GAGAGAACAGAGAAAAACAGAGG + Intergenic
1116895430 14:50311437-50311459 CAGAGGACAGAGAAAGACAATGG + Intronic
1117218633 14:53578738-53578760 GAGAGAAAAGAAGAGCACAGAGG + Intergenic
1117296228 14:54381875-54381897 CAGAAAGTAGAGAAGGGCAGGGG + Intergenic
1117571699 14:57055432-57055454 CACAGAAAAGAGTAGGCCAGAGG - Intergenic
1117803629 14:59468341-59468363 CACAGAAAAAAGAAGGAAAGTGG - Intronic
1117962291 14:61175249-61175271 TAGAGAAAAGACAGGGTCAGGGG + Intergenic
1118171927 14:63396142-63396164 GGGAGAAAGGAGGAGGACAGGGG + Intronic
1118284448 14:64458737-64458759 AATAGAAAAGAGAAGGAAACAGG + Intronic
1118313938 14:64713757-64713779 CAGAGAAAAAAAAAGGAAATGGG - Intronic
1118687835 14:68309483-68309505 TAGAGAAAAGTGAAGGGCAAAGG + Intronic
1119101706 14:71885931-71885953 GAGAAAAAAGAGAAGGAGAGTGG - Intergenic
1119108892 14:71952389-71952411 AAGAGAAAAAGGAAGTACAGAGG - Intronic
1119133468 14:72195513-72195535 CAGAGTAGAGAGAAGAAAAGAGG + Intronic
1119332533 14:73805653-73805675 ATGAGAAAACTGAAGGACAGAGG + Intergenic
1119430626 14:74566237-74566259 AAGAGAACAAAGAAGGGCAGAGG + Intronic
1119476773 14:74934977-74934999 CAGAGAAGAGAGAAGGAGAAGGG + Intergenic
1119554801 14:75545090-75545112 CAGAAAAAAGAGAAGCTCACAGG + Intronic
1119607322 14:76031839-76031861 CAGAGAAGAGAGAAGGTTAGAGG - Intronic
1119618684 14:76115297-76115319 CAGAGAAAAAGGAAGCACAGAGG - Intergenic
1119641255 14:76316692-76316714 CAGAGAGGAGAGAAGGATAGGGG - Intronic
1120546345 14:85816651-85816673 CATAGAAAAGGGAATGAGAGAGG + Intergenic
1120765878 14:88326134-88326156 CTGAGAAAGGAGAATGAAAGTGG - Intronic
1120852629 14:89185262-89185284 GACAGAAAGGAGAAAGACAGGGG - Intronic
1120896606 14:89538501-89538523 AAGAGAAAAGAAAAGGAAAAAGG - Intronic
1121032758 14:90673430-90673452 AAGAGAAAAAAGAAGGAGCGCGG + Intronic
1121047605 14:90799469-90799491 CAGAGAAAAGAGGGTGACTGGGG + Intronic
1121506099 14:94478644-94478666 CAAAAAAAAGTGAGGGACAGTGG + Intronic
1121567830 14:94923870-94923892 GAGAGGAAAGAAGAGGACAGAGG - Intergenic
1122392789 14:101401803-101401825 AAGAGGAAAGAGAAGGAGAAGGG - Intergenic
1122477883 14:102024387-102024409 TGGAGGAAAGAGCAGGACAGAGG + Intronic
1122623044 14:103070603-103070625 CAGAACAAAGAGGAGGAGAGAGG - Intergenic
1122764576 14:104057477-104057499 GAGAGAAGAGAGAGGCACAGGGG - Intergenic
1122770617 14:104096056-104096078 CGGAGCAAAGAGAGGGACAAAGG - Intronic
1122795290 14:104203046-104203068 CAGAGGCCAGAGGAGGACAGGGG + Intergenic
1122874049 14:104655130-104655152 AAAAGAAAAGAGAAGGGAAGGGG + Intergenic
1122935385 14:104953560-104953582 AAGAGAACAGAGACGCACAGAGG - Exonic
1123033760 14:105463467-105463489 AAAACAAAAGAGAAGGTCAGAGG - Intronic
1123779869 15:23615579-23615601 CAGAGGTAAGAGAAGCACCGAGG - Intronic
1123792170 15:23732933-23732955 AAAAGAAAAGAAAAGGAGAGAGG - Intergenic
1124008204 15:25811290-25811312 GAGAGGAAAGAGGAGGACAGAGG + Intronic
1124037234 15:26065839-26065861 CTGAGCAAAGAGAAGCAGAGAGG - Intergenic
1124121105 15:26889365-26889387 CAGAAAAAAAAAAAAGACAGTGG - Intronic
1124428804 15:29588309-29588331 CAGGGAAAAGAAAGGGATAGAGG + Intergenic
1124797048 15:32791989-32792011 CAGAGAATAGAGCAGAAAAGAGG + Intronic
1124824738 15:33082584-33082606 CAGAGACTAGAGAAGCACTGGGG - Intronic
1124904708 15:33857742-33857764 CAGAGAAAGGAAAAGGAGTGGGG - Intronic
1124907876 15:33888534-33888556 CAAGGTAAAGATAAGGACAGAGG + Intronic
1125084234 15:35711905-35711927 CACAGAAATGAGAGGGACAAGGG + Intergenic
1125164492 15:36686742-36686764 GAGAGAGAAGGGAGGGACAGAGG + Intronic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125331891 15:38590584-38590606 CAGAGAAGATGGAAGGAGAGAGG - Intergenic
1125518830 15:40337312-40337334 CAGAGAAAAGAGAGGACAAGGGG + Intronic
1125547519 15:40517326-40517348 CAGAAAACAGAGAGGGCCAGAGG + Intergenic
1125736301 15:41928854-41928876 CAGGGAGGAGAGAAGGCCAGTGG - Intronic
1126328250 15:47505022-47505044 CACAGAAAACAGAATTACAGTGG + Intronic
1126696468 15:51330057-51330079 CAGAGAAATGAGCATGATAGTGG + Intronic
1126747159 15:51837699-51837721 CAGAGGAAAGGCAAGCACAGAGG - Intronic
1127006250 15:54573201-54573223 GAGAGAAAAGAGCAAGAAAGAGG - Intronic
1127191089 15:56531340-56531362 CAGGGAAAAGAGAATTACTGTGG + Intergenic
1127191168 15:56532100-56532122 AAAAGAAAGGAGAAGGGCAGCGG + Intergenic
1127277019 15:57455490-57455512 TAGAGAAACTAAAAGGACAGGGG - Intronic
1127530903 15:59842517-59842539 CAAAGAAAAGAAAAGGAAAAAGG + Intergenic
1127814056 15:62591237-62591259 CAGAGAAATGAGGAAGACATAGG - Intronic
1127819199 15:62640370-62640392 CAGAGAGAAGAGGGGGACGGTGG + Intronic
1128104305 15:65031762-65031784 AACAGAAAAGAGAAGCAAAGAGG + Intergenic
1128226229 15:66003344-66003366 CAGGGAAAAGACAAGCACATGGG - Intronic
1128306453 15:66602004-66602026 AAAAGAAAAGAAAAGGAGAGAGG - Intronic
1128961872 15:72014810-72014832 AAAAGAAAAGAGAAGAAAAGAGG + Intronic
1129497249 15:75995818-75995840 CACAGAAAGGAGAGGCACAGAGG + Intronic
1129760435 15:78126118-78126140 CAGGGGAAAGGGAAGCACAGAGG - Intronic
1130098691 15:80875612-80875634 CAGAGAAAAGCACAGGCCAGAGG - Intronic
1130141969 15:81235166-81235188 CAGAGAAAAGATAAGGTTGGGGG + Intronic
1130289588 15:82585766-82585788 CAGAGAAGAGAGTAGGATTGAGG - Intronic
1130562771 15:84971646-84971668 AAAAGAAAAGAGAAGAACAAGGG - Intergenic
1130750044 15:86701862-86701884 AAGAAAAAAGAGAAGGGAAGGGG - Intronic
1130859667 15:87875170-87875192 CAGGGAAAAGGGTAGGCCAGAGG + Intronic
1131037107 15:89230087-89230109 CAGAGGTAAGAGAACGGCAGAGG + Intergenic
1131122791 15:89833384-89833406 GCGAGGAAAGAAAAGGACAGTGG + Exonic
1131312615 15:91304601-91304623 CGGAGAGGAGAGAAGGAGAGAGG + Intergenic
1131374860 15:91915217-91915239 AAGAGAAAAGTGATGGAGAGAGG - Intronic
1131610764 15:93960137-93960159 CAGAGGAAAAAGAAAGACATGGG - Intergenic
1131923701 15:97358442-97358464 AAGAGAAAAGAGAAGGCAACAGG - Intergenic
1132005481 15:98222718-98222740 TAAAGAAAAAAGAAAGACAGAGG - Intergenic
1132123442 15:99197923-99197945 AAGAAAAAAGAAAGGGACAGAGG + Intronic
1132425294 15:101710805-101710827 CAGAAACAAGAGAAGGAGAGGGG + Intronic
1132508200 16:323137-323159 AAAAGAAAAGAAAAGGAAAGAGG + Intronic
1132520861 16:387907-387929 CAAAGTATAGAGAAGGAAAGGGG + Intergenic
1132980998 16:2738684-2738706 CAGAGACCAGAGAAAAACAGTGG + Intergenic
1133449685 16:5893503-5893525 CAGATAAAACAGATGGACACAGG - Intergenic
1133483290 16:6193158-6193180 CAAAGAACAGATAAGGACATAGG - Intronic
1133489598 16:6254833-6254855 CAGAGAACAGGGCAGGAAAGAGG - Intronic
1133569621 16:7027916-7027938 AAGGGAAAAGAGAAGGAAGGAGG + Intronic
1133850046 16:9494855-9494877 AAGAGACAAAAGAAGGAGAGTGG + Intergenic
1134028797 16:10975328-10975350 CAAAGAAAAGAAAAAAACAGTGG + Intronic
1134187860 16:12098618-12098640 CAGGCAAAAGAGGAGGAGAGGGG - Intronic
1134488940 16:14681175-14681197 AAGAGAAAAGAAAAGAAAAGGGG + Intronic
1134825433 16:17280830-17280852 GAGAGAAAATAAAAGGAGAGAGG - Intronic
1134885119 16:17783982-17784004 TAGAGAAAAGCGAGGGAAAGTGG - Intergenic
1135166792 16:20146271-20146293 CAGAGACAAGAGCAGGAAATGGG - Intergenic
1135229230 16:20690091-20690113 CAGAGAAAAGAAAAAGAAGGTGG + Intronic
1135458716 16:22622431-22622453 CAGGGAACAGATAATGACAGTGG + Intergenic
1135706160 16:24676936-24676958 CAGAGAGAAAAGAAGGCTAGAGG - Intergenic
1135796453 16:25447772-25447794 GAGAGAGGAGAGATGGACAGGGG + Intergenic
1135943079 16:26839804-26839826 CAAACAAAAGAGAAGATCAGAGG + Intergenic
1135946691 16:26871273-26871295 CTGAGAAAAGAGGGGGAGAGGGG + Intergenic
1136074799 16:27809657-27809679 GAGAGAAAAGAGAGGGATGGAGG - Intronic
1136133084 16:28236832-28236854 GGGAGAAAAGAGAAAGGCAGAGG + Intergenic
1136841638 16:33546241-33546263 CAGGGCAAAGACAAGGGCAGGGG + Intergenic
1137222918 16:46473387-46473409 CAGAGAGAAGTAAAGGCCAGGGG + Intergenic
1137264833 16:46860118-46860140 CAGAGAACAGAGAACTTCAGAGG - Intergenic
1137566089 16:49533294-49533316 CTAAGAAAGGAGGAGGACAGAGG + Intronic
1137740118 16:50761467-50761489 CAGAGAACAGAGATGAGCAGAGG - Intronic
1137936552 16:52640396-52640418 TAGAGCAAAGACAAGGACAATGG + Intergenic
1138282527 16:55783016-55783038 CAGAAAAAGGAGAAGGAAATTGG + Intergenic
1138286414 16:55813603-55813625 CAGAAAAAGGAGAAGGAAATTGG - Intronic
1138287429 16:55820960-55820982 CAGAGAGAAGAGGTGGACAGAGG - Intronic
1138292661 16:55861295-55861317 CATAGAAAAGAGGAGGATTGAGG - Intronic
1138763154 16:59567860-59567882 AAGAGAAAAGAGAGGGACCTGGG - Intergenic
1138875617 16:60945192-60945214 CAGAGAATAAATAAGGTCAGTGG - Intergenic
1139174865 16:64674650-64674672 CGGAGAAAAGAAAAGGACTTGGG + Intergenic
1140023416 16:71261258-71261280 CAGAGGAAAGAAGAGGAAAGAGG + Intergenic
1140230196 16:73111717-73111739 GAAAGAAAAGAAAAGGACAGAGG + Intergenic
1140235908 16:73158449-73158471 AAGAGAAAAGAGAAGGGAGGGGG - Intergenic
1140903571 16:79392109-79392131 GAGAGGAAAGAGAAGAAGAGAGG + Intergenic
1140979759 16:80096200-80096222 GAGAGAAGAGAGAAGCCCAGGGG - Intergenic
1141013436 16:80425032-80425054 AAAAGCAAAGAGAAGAACAGGGG + Intergenic
1141519811 16:84571285-84571307 CAGAGAGAAGGGATGGACGGAGG + Intronic
1141708127 16:85680838-85680860 CAGAGAAAAGAGCTGTAGAGAGG + Intronic
1141931631 16:87208500-87208522 CAGCAAAAAGAGAAGGAGAAAGG + Intronic
1142131977 16:88435290-88435312 CAGAAAAAAGAGAAGGCCGGAGG + Exonic
1203151803 16_KI270728v1_random:1846538-1846560 CAGGGCAAAGACAAGGGCAGGGG + Intergenic
1142468945 17:151894-151916 TAGAGAAAACAGCAGAACAGAGG - Intronic
1142788487 17:2244366-2244388 CAGAGGAAAGAGAAACCCAGAGG + Intronic
1143091264 17:4450253-4450275 GAGAGAAAAGAGGAGGAAGGAGG - Intronic
1143220960 17:5261336-5261358 AAAAGAAAAGAAAAAGACAGGGG + Intergenic
1143228913 17:5334228-5334250 CAAAAAAAAGAGAAGGAAAGGGG - Intronic
1143513794 17:7409267-7409289 AAGGGAGAAGAGAAGGACATCGG - Intronic
1143665768 17:8358715-8358737 GAGAGAGAAGGGAGGGACAGAGG - Intergenic
1143711492 17:8739104-8739126 AAGAAAAAAGAGAAAGAGAGGGG + Intronic
1144504899 17:15821594-15821616 CAGAGAACACAGAGGCACAGAGG + Intergenic
1145169072 17:20639477-20639499 CAGAGAACACAGAGGCACAGAGG + Intergenic
1146055553 17:29579009-29579031 CAGAGGGAAGAACAGGACAGAGG + Intronic
1146178042 17:30679428-30679450 CAGAGGAGAGGGGAGGACAGAGG + Intergenic
1146178098 17:30679574-30679596 CAGAGAAGGCAGGAGGACAGAGG + Intergenic
1146512388 17:33461332-33461354 CAGAGGATAGAGAAGGGCAATGG - Intronic
1146636120 17:34506468-34506490 CAGAGAAAAGGAAAGGAAAGAGG + Intergenic
1146945818 17:36872736-36872758 CAGAGAGCAGAGTGGGACAGGGG - Intergenic
1147156977 17:38548933-38548955 CAGAGAACATGGAAGGAAAGAGG - Intronic
1147189568 17:38730674-38730696 CAGTGGAAAGGGAAGGACACGGG - Intronic
1147339919 17:39747121-39747143 CAGAGCTAGGAGAAGGAGAGGGG - Exonic
1147966202 17:44195524-44195546 CAGAGAAAAGAGAAGGACAGGGG + Intronic
1148503026 17:48106451-48106473 CAGAGAAAGGGGAAGCACATAGG + Intronic
1148682190 17:49480813-49480835 CAGAGCCAAGAGATGGTCAGTGG - Intergenic
1148693886 17:49547875-49547897 GAGAAAACAGAAAAGGACAGGGG + Intergenic
1148742838 17:49902396-49902418 CAGAGAAAGGGGGAGGGCAGGGG - Intergenic
1148763543 17:50022151-50022173 CAGAGAAGAGAAAAGCACAGAGG - Intergenic
1149289579 17:55204107-55204129 CATTAAAAATAGAAGGACAGGGG - Intergenic
1149569401 17:57661799-57661821 GAGGGCAAAGACAAGGACAGAGG - Intronic
1149595843 17:57864179-57864201 AATAGAAAAGAGAATGAAAGGGG + Intronic
1149649591 17:58268599-58268621 CAGAGAAAGGGGAGGGGCAGGGG + Intergenic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150506648 17:65705575-65705597 AAAAGAAAAAGGAAGGACAGAGG + Intronic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1150563213 17:66313070-66313092 CAGAGGAAACAGAAGTAGAGAGG - Intronic
1150651245 17:67011793-67011815 AAAAGGAAAGAGAAGGAAAGAGG - Intronic
1150657197 17:67046993-67047015 CAGAGAAAAGAGAGGGAAAAAGG - Intronic
1150982432 17:70157438-70157460 CAGAGGAAAAGGAAAGACAGAGG + Intergenic
1151161799 17:72172211-72172233 CAGAGCAAAGAAAAGGAAACTGG - Intergenic
1151236536 17:72724184-72724206 GAGAGGAAAGAGAGGGACAGAGG + Intronic
1151315596 17:73320147-73320169 CAGTAAAAAGAGAAGGAAGGAGG - Intergenic
1151362952 17:73599573-73599595 GAGGGAAAAGAGGAGGAGAGAGG + Intronic
1151439389 17:74118482-74118504 AAGAAAAAAGAGAGGGGCAGGGG - Intergenic
1151637090 17:75357311-75357333 CGTAGAACAGAGAAGGACACTGG + Intronic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1151922237 17:77165688-77165710 CAGAGAAAAGAAAAGGCCAAAGG - Intronic
1152100331 17:78297868-78297890 AAGAAAGAAGAGAGGGACAGAGG - Intergenic
1152296133 17:79467888-79467910 CAGAGAAATCAGAGGGTCAGAGG - Intronic
1152477296 17:80526578-80526600 CTCAGAGCAGAGAAGGACAGAGG - Intergenic
1152856437 17:82667367-82667389 CAGTGGAAAGTGGAGGACAGAGG - Intronic
1152984561 18:310026-310048 CAGATAAAAGACAAGTGCAGTGG + Intergenic
1153056941 18:955188-955210 CAGGGAAAAGGGAAGCCCAGTGG - Intergenic
1153156328 18:2153556-2153578 CAAAGAAAAGAGAATGAGATAGG - Intergenic
1153328628 18:3848836-3848858 GAGTGGAAGGAGAAGGACAGTGG - Intronic
1153693082 18:7613256-7613278 CTGAGAGAAGAGAATGACTGGGG - Intronic
1153752664 18:8249203-8249225 TAGAGAAAAGAGAAGCAGAGGGG - Intronic
1153789000 18:8560820-8560842 GAGGGAAAAGAGAAAGAGAGCGG - Intergenic
1153861736 18:9217664-9217686 CAGAGAAAAGAGTAGACCACTGG - Intronic
1153980307 18:10303058-10303080 CAGAGAGATGAGAAGAACTGAGG - Intergenic
1154276993 18:12970398-12970420 AAGAAAAAACAGATGGACAGGGG - Intronic
1154296811 18:13158598-13158620 CAGAGATAAGAGAGAGAAAGGGG - Intergenic
1154315720 18:13301805-13301827 CAGAGAAAGGAAGGGGACAGAGG - Intronic
1155029004 18:21967961-21967983 CAGAGAAAAGACTAGGAAAATGG + Intergenic
1155074451 18:22342382-22342404 CAGAGAGAGGAGAAGCAGAGAGG + Intergenic
1155146984 18:23092430-23092452 CACAGAGAATAGAAAGACAGAGG - Intergenic
1155444574 18:25897719-25897741 CAGATAAAAAAGAATGAAAGAGG - Intergenic
1155780402 18:29825510-29825532 TAGGGTAAAGAGTAGGACAGTGG - Intergenic
1156028654 18:32687418-32687440 AAAAGGAAAGAGAAGGAAAGAGG - Intronic
1156042152 18:32834940-32834962 CAGAGAAGAGTGCAGGAAAGGGG + Intergenic
1156045441 18:32872155-32872177 CAGAGAAGAGGGAAGGAAACAGG + Intergenic
1156109031 18:33700954-33700976 CAGAGAGAAGAGCACGATAGGGG + Intronic
1156546107 18:37965209-37965231 GAGAGAAAAGGGATGGAAAGGGG - Intergenic
1156585319 18:38425444-38425466 CACAGAAAAGTGAATGTCAGGGG + Intergenic
1156930886 18:42641875-42641897 TAGATAAAAGAGAAGGACAGGGG + Intergenic
1157513098 18:48292532-48292554 CTGGCAAGAGAGAAGGACAGGGG + Intronic
1158090812 18:53710940-53710962 CAGAGAAGAGACAAGGACTGGGG - Intergenic
1158227106 18:55212901-55212923 CTGAGTGAAGAGAAGGCCAGAGG - Intergenic
1158409084 18:57188509-57188531 CAGAGAAAGGAGAGCGAGAGAGG + Intergenic
1158497731 18:57971593-57971615 GAGAGAAACGCGAAGGGCAGTGG - Intergenic
1158643329 18:59221002-59221024 CAAAGCGAAGAGAAGGACTGAGG - Intronic
1158668633 18:59455124-59455146 CAGGGAAGAGGGGAGGACAGAGG + Intronic
1158843474 18:61414308-61414330 CAGAAACAAGAGAAGCACAAGGG + Intronic
1159575227 18:70167764-70167786 CAGAGAAAACAAGAAGACAGTGG + Intronic
1160002047 18:75033864-75033886 CAGGGAAAGGAGAAGGGAAGAGG - Intronic
1160385870 18:78495852-78495874 CAGAGCTCAGAGAAGGACACAGG + Intergenic
1160602268 18:80022773-80022795 CCCAGAGAAGAGAAGGAAAGAGG - Intronic
1161139298 19:2638363-2638385 AAGAGAAAAGAAAAGAAAAGGGG + Intronic
1161267394 19:3370621-3370643 GAGAGAAGAGAGAAGGAGAGAGG - Intronic
1161301392 19:3544607-3544629 CAGAGAAGAGTGAGGGGCAGTGG + Exonic
1161501563 19:4618879-4618901 CAGAGAAGAGGGAGAGACAGAGG - Intergenic
1162887449 19:13706312-13706334 GGGAGGAAAGAGAAGGACAGAGG - Intergenic
1163057142 19:14728842-14728864 CAGAGAACAAAGGAGGCCAGGGG + Intronic
1163278757 19:16302216-16302238 AAGAGAAAAGACAGGAACAGTGG - Intergenic
1163458941 19:17424874-17424896 CAGAGTAAAGAGAGGGCCAAAGG - Intronic
1163478059 19:17538626-17538648 GAGAGAAAAGAAAAGAAAAGAGG + Intronic
1164260034 19:23561302-23561324 AAGAAAAGAAAGAAGGACAGAGG + Intronic
1164458900 19:28431076-28431098 CAGAGAAAAGCAAAGGCCACAGG + Intergenic
1164780838 19:30890792-30890814 TAGAGACAAAAGAAAGACAGTGG - Intergenic
1164813881 19:31179335-31179357 CCCAGAAGAGAGAAAGACAGGGG + Intergenic
1164937041 19:32223150-32223172 AAGAGAAAAGAGGAGGAGAAAGG + Intergenic
1164995441 19:32717836-32717858 TAGAGAAAGCAGGAGGACAGGGG + Intergenic
1165201238 19:34146518-34146540 AAAAGAAGAGAGAAGGAGAGAGG + Intergenic
1165429423 19:35764085-35764107 CCAAAAAAAGAGAAGCACAGAGG - Intronic
1165459900 19:35938142-35938164 TAGAGAGGAGAGATGGACAGAGG - Intronic
1165638157 19:37361481-37361503 CACAGAAAAGAGAAAGAGAAAGG - Intronic
1165757232 19:38300999-38301021 CAGAGAGAGCAGAAGGAGAGAGG - Intronic
1166298413 19:41900745-41900767 CAGCGAAAAGGGAAAGGCAGTGG + Intronic
1166406831 19:42527593-42527615 CAGAGAAATGACAAGGTCAGAGG - Intronic
1167228609 19:48267160-48267182 CAGAGAAAATAGAAGGGAATTGG + Intronic
1167252456 19:48407311-48407333 GAGAGGAAGGAGATGGACAGAGG - Intronic
1167631451 19:50628602-50628624 CAGAGATTAGAGAGGGACTGGGG + Intronic
1168109199 19:54182051-54182073 AAGGGAAAAGGGAAGGACGGAGG + Intronic
1168228270 19:55011945-55011967 CAGAGCAAAGAGCAAGACAGGGG + Intergenic
1168386364 19:55966463-55966485 CAGATCAAAGGAAAGGACAGAGG - Intronic
924964728 2:65268-65290 CAGGGGAAAGAGGAAGACAGTGG + Intergenic
924998765 2:386995-387017 CAGAGAAGGGAGCAGGGCAGAGG - Intergenic
925273317 2:2630833-2630855 CAGAGAAAAGGGAGGTACAGGGG - Intergenic
925372465 2:3356758-3356780 CACAGAAAAGAGAATCAGAGAGG + Intronic
925553379 2:5101190-5101212 CAGATAAAACAAAAGGTCAGAGG + Intergenic
926377017 2:12240703-12240725 CAGAGGAAAGAGAAGGAACATGG - Intergenic
927236835 2:20882437-20882459 AAGAGAAAAGGGAAGGATAAGGG - Intergenic
928154058 2:28859598-28859620 GAGGGAATAGAGAAGGAGAGGGG - Intronic
928415479 2:31088133-31088155 CAGAGAAAAAAGAGGGGCACAGG + Intronic
928732458 2:34247367-34247389 CAGACAAAAGTGAAGAACACAGG - Intergenic
928956871 2:36878269-36878291 TAGTGAAAAGGAAAGGACAGTGG - Intronic
929052108 2:37846412-37846434 CAGAGAGAGGAGAAAGAGAGAGG - Intergenic
929244311 2:39685464-39685486 TAGAGTCTAGAGAAGGACAGGGG - Intronic
929310557 2:40419456-40419478 GAGAGAAAGGAGACAGACAGAGG - Intronic
929411102 2:41698087-41698109 CAGAGAAGGGAGAGAGACAGAGG - Intergenic
929561258 2:42957906-42957928 CTGAGCCAAGAGAAGAACAGTGG - Intergenic
929774275 2:44918513-44918535 AAGAGGAAGGTGAAGGACAGTGG - Intergenic
929812491 2:45202262-45202284 CAGGGAGAAGAGATGGACAAAGG + Intergenic
930267677 2:49219057-49219079 CAGGGAGAAGGGAAGGCCAGAGG + Intergenic
930337049 2:50061318-50061340 CAAAGAAAAGAAAAGGTCATTGG - Intronic
930376367 2:50572100-50572122 CAGAGAAAACAGGAGGACTAAGG + Intronic
930422485 2:51170549-51170571 CAGATAAAAGAGACTGATAGAGG + Intergenic
930590572 2:53321973-53321995 CAGAGTAAAGAGAAGAAGTGTGG - Intergenic
930741031 2:54832658-54832680 CAAATAAAAGGGAAGGAAAGAGG + Intronic
930975547 2:57455173-57455195 CAGAGAAAATGGAAGGAGAGAGG - Intergenic
931135577 2:59395854-59395876 AAGAGAGAAGACAAGGGCAGAGG - Intergenic
931409472 2:62015208-62015230 CAGAGAAAAAAGTAGAAAAGAGG - Intronic
931908439 2:66868512-66868534 GAGAGAAAAGAGATGGAGAGTGG + Intergenic
932050041 2:68389156-68389178 AAGAGGTAAGAGATGGACAGGGG + Intronic
932053314 2:68419939-68419961 CAGAGAAAAGAGAGCTCCAGAGG - Intergenic
932093586 2:68827726-68827748 GAGAGAAAAAGGAATGACAGAGG - Intergenic
932186412 2:69700010-69700032 CAGAGAGAATGGAAGGAGAGAGG + Intronic
932196783 2:69790740-69790762 CAGAGAAAACAGAAAGGCATCGG - Intronic
932300570 2:70664070-70664092 CAGAGAAAGGAGAAGGCGTGAGG + Intronic
932555380 2:72819489-72819511 CAGAGAAAGGAGGAGGAGATAGG - Intronic
932753292 2:74386558-74386580 AAGAGGAAAGAGGAAGACAGTGG - Intronic
932888347 2:75568185-75568207 AAGATTAAAGAGAAGGAAAGAGG - Intronic
932900230 2:75689810-75689832 CAGAGAAAAGAGTCTTACAGAGG + Intronic
933042660 2:77488088-77488110 GAGGGAAGAGAGAAGGAGAGAGG + Intronic
933121921 2:78548765-78548787 CACAGAAAAGCTAAGGAAAGGGG + Intergenic
933596559 2:84288853-84288875 AAGAGAAGAGAAAAAGACAGTGG + Intergenic
933624371 2:84582252-84582274 CAGAGATGAGAGAAGGAGAGAGG - Intronic
934879227 2:97959008-97959030 CAGAGAAAAGAAGAGGACAGAGG + Intronic
934939002 2:98486395-98486417 CAAGGAAAGGAGAAAGACAGAGG - Intronic
935056063 2:99567965-99567987 CAGAAAATAGAGGAGGGCAGCGG - Intronic
935111678 2:100099799-100099821 AAGAAAAAAGAGAAAGAAAGAGG + Intronic
935210227 2:100933301-100933323 TAGAGAGAGGAGAAGGACAGAGG + Intronic
935354747 2:102187733-102187755 CAGGAAAAAGGGAAGGTCAGCGG + Intronic
935457697 2:103289149-103289171 CTGAGAAAAGAGAAGACCTGAGG + Intergenic
936221396 2:110606096-110606118 AAGAAAAAAGAGAAAGAAAGAGG + Intergenic
936483969 2:112910868-112910890 CAGAGGAGAGTGAAGGAAAGAGG - Intergenic
936726757 2:115328727-115328749 AAGAGATGAGGGAAGGACAGAGG - Intronic
936836495 2:116717058-116717080 AAGAAAAAAGAAAAGGTCAGTGG + Intergenic
936918326 2:117662440-117662462 CACTGAGAAGAGAAGGAGAGAGG - Intergenic
937619616 2:123970719-123970741 AAGGGGAAAGAGAAGGAAAGAGG + Intergenic
937705682 2:124918181-124918203 CTGAGAAAAGGGAAGGAGAGGGG - Intergenic
937829716 2:126406161-126406183 CAGAGACACGGAAAGGACAGAGG + Intergenic
937941780 2:127291725-127291747 CATTTAAAAGAGATGGACAGTGG - Intronic
937979276 2:127604750-127604772 CAGAGAAAAGAGAGAGAGATGGG + Intronic
938021674 2:127910905-127910927 CAGTGACATGAGAGGGACAGGGG - Intergenic
938057593 2:128228356-128228378 CAGAGAAAGGAAAAAGAGAGAGG + Intergenic
938926946 2:136052145-136052167 CTGGGAATAGAGAAGGAAAGTGG - Intergenic
939413857 2:141866817-141866839 GAGAGAAAATAGAAGGAGAGAGG + Intronic
939483783 2:142782750-142782772 CATAAAAAAGACAAAGACAGTGG - Intergenic
939697552 2:145345077-145345099 CAGAGAGAAGAGAATGACCTTGG - Intergenic
939931011 2:148232879-148232901 TTGAGAAAAGAGAAGGAGACTGG - Intronic
940219383 2:151335847-151335869 CAGGGAAAGGAGAAGGGCGGTGG - Intergenic
940557448 2:155248683-155248705 AGGAGAAAGGAGAAGGAAAGAGG + Intergenic
940676107 2:156725362-156725384 CAGAGCAAAGAACAGGACAGGGG + Intergenic
940818318 2:158321633-158321655 CAGAAGAAAGAGAGGGAAAGGGG - Intronic
940945597 2:159615123-159615145 CAGACAAAAGATAAATACAGAGG + Intronic
941265829 2:163360668-163360690 CATAGAGAGGAGGAGGACAGAGG - Intergenic
941595679 2:167473998-167474020 CAGAGAAATCAGAATGGCAGAGG + Intergenic
941920829 2:170849254-170849276 CAGAGAAAGGAGAGGAAGAGGGG - Intronic
942151477 2:173080337-173080359 CAGAAAACAGACTAGGACAGTGG - Intronic
942371709 2:175293010-175293032 CAAAGGAAAGAGATGGACAATGG + Intergenic
942414437 2:175744050-175744072 AAGAGGAGAGAGAAAGACAGAGG + Intergenic
942983031 2:182105477-182105499 CACAGAAGAGAGAAGGGCAAAGG + Intronic
943227965 2:185205658-185205680 CAGACAAAAGAGATGTGCAGGGG - Intergenic
943231150 2:185254113-185254135 CAGAGAAAACAGAGAGAGAGAGG - Intergenic
943449896 2:188033964-188033986 CGGAGCAAAGAGCAGGACGGGGG - Intergenic
943501912 2:188701584-188701606 CAGAGAAAAAAGAAAAACATTGG + Intergenic
943701875 2:190995890-190995912 CAGGGCAAAGAGGAGGCCAGAGG + Intronic
943903763 2:193472872-193472894 GAGAGATAAGAGAAAGGCAGAGG + Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944085129 2:195836973-195836995 GAGAGAAAAGAGATGGAGAGAGG - Intronic
944224855 2:197339488-197339510 CAGAGAGCAGAGAGGGACAAAGG + Intergenic
944398666 2:199300037-199300059 TAGAGCAATGAGAAAGACAGAGG - Intronic
944438222 2:199714728-199714750 CAGAGAAAAGGGAGGGTCACAGG + Intergenic
944641017 2:201725704-201725726 CAGAGATAGGTGAAGGACACAGG - Intronic
944832684 2:203548875-203548897 AAGAAAAAAGAGCAGGGCAGAGG - Intergenic
945004639 2:205391220-205391242 TAGAGAAAAGGGAAGGAAAGAGG + Intronic
945120496 2:206452482-206452504 AACTGTAAAGAGAAGGACAGTGG - Intronic
945160324 2:206883945-206883967 GAGAGAAAATAGAAGGACCAGGG - Intergenic
945444278 2:209917506-209917528 CAGTGAAAAGTGAATGCCAGAGG - Intronic
945450154 2:209984975-209984997 CAGAGAAGACAGAGAGACAGAGG - Intronic
945570935 2:211466872-211466894 GAGAGAAAAGAGAGAGAGAGAGG - Intronic
945608222 2:211963608-211963630 AAGAGGAAAGAGAGGGAGAGAGG - Intronic
945809264 2:214528483-214528505 CAGAGAAAAGAAAAGTTAAGAGG - Intronic
945857896 2:215090354-215090376 CAGAGTGAGGACAAGGACAGGGG - Intronic
945986587 2:216359353-216359375 CAGAGAAAAGAGAAAAGAAGAGG - Intronic
946070528 2:217030777-217030799 CAAAGAACAGTGAAGAACAGTGG + Intergenic
946270118 2:218585059-218585081 AAGAGAAGAGAGAAGGGAAGAGG - Intronic
946595704 2:221303530-221303552 CAGAGACAAGAGAAGAACCCAGG - Intergenic
946606554 2:221411492-221411514 AAGAGAAAAGGGAAGGAGAAAGG + Intergenic
946695940 2:222359320-222359342 CAAAGGAAAGACAAAGACAGAGG + Intergenic
947074677 2:226329571-226329593 CAGAGAGAAGAGCATTACAGAGG - Intergenic
947212308 2:227719179-227719201 AAGAGAAAAGAAAAGAAAAGAGG - Intergenic
947345840 2:229188358-229188380 GAGAAAAGAGAGAAGGAAAGGGG + Intronic
947518509 2:230827533-230827555 AAAAGAAAAGAGAAGGGGAGGGG - Intergenic
947651181 2:231787148-231787170 AAGGGAAAAGAGAAGGGGAGAGG - Intronic
948101527 2:235377981-235378003 GAGAGAAGAGAGAAGGACGAGGG - Intergenic
948379102 2:237540780-237540802 CCTAGGAAAGAGAAGGACGGAGG - Exonic
948611715 2:239173113-239173135 CAGAGAATACAAAAGGAGAGAGG + Intronic
948751811 2:240137447-240137469 GAGGGAAAGGAGAAGGAAAGGGG + Intergenic
948778274 2:240301336-240301358 CAACAAAAAGAGAAGGGCAGTGG - Intergenic
948995444 2:241576038-241576060 CAAAGAAAAGAGAACTGCAGTGG - Intergenic
949075286 2:242053462-242053484 CAGACAAGATAGAAGGACAGGGG + Intergenic
1168851265 20:978659-978681 CAGAGACAAGTGAAGGACCCAGG + Intronic
1169009833 20:2241298-2241320 AAGAAAAAAGAGAAAGAAAGAGG - Intergenic
1169036392 20:2455910-2455932 CAGAGGAAAGAAAAGGAAAGGGG + Intergenic
1169107485 20:3009341-3009363 CAGACAAAAGGGAAGGTCAGTGG + Intronic
1169566664 20:6861353-6861375 CAGAAAAAAGGGAATAACAGAGG + Intergenic
1169623254 20:7532024-7532046 GAGAGAAAGGAGAAGGAAACTGG + Intergenic
1169638494 20:7721627-7721649 GGGAGAAGAGAGAAGGAAAGAGG - Intergenic
1170365229 20:15590889-15590911 GAGAGAAAAGAGAGAGAGAGAGG + Intronic
1170433616 20:16300466-16300488 AAGAGGGAAGAGAAGAACAGTGG - Intronic
1170465231 20:16616862-16616884 AAGGAAAAAGAGAAGGAAAGAGG + Intergenic
1170475877 20:16713998-16714020 CTGAGAAAAGGGAAGAACATCGG - Intergenic
1170738645 20:19033177-19033199 TAGATAAAAGAGCAGTACAGAGG - Intergenic
1170748216 20:19119970-19119992 CAGGGAAATGAGACAGACAGTGG + Intergenic
1170813936 20:19697020-19697042 GAGGGAGAAGAGAAGGAAAGAGG + Intronic
1170820275 20:19751708-19751730 AAGAGAAGAGAGAGGGACATGGG + Intergenic
1170985201 20:21251512-21251534 CACAGAATAGAGATGGAAAGGGG + Intergenic
1171004765 20:21453663-21453685 CAGAGAAGACAGCAGGAAAGAGG + Intergenic
1171095917 20:22332181-22332203 GAGAAAAAAAAGAAGGACTGAGG - Intergenic
1171216396 20:23355752-23355774 CAGATAATAGAGAAGGGAAGGGG - Intergenic
1171562690 20:26139871-26139893 CAGAGAAGAGGGAATGAGAGAGG - Intergenic
1171879592 20:30608517-30608539 AGGAGAAAAGAGGAGAACAGAGG + Intergenic
1172221272 20:33276686-33276708 CAGAGAGAGGAGAGAGACAGTGG + Intronic
1172543134 20:35737560-35737582 CAAAGAAAAAATAAAGACAGAGG + Intronic
1172667857 20:36613283-36613305 CAGAGCAAAGAGAAAGACTTCGG - Exonic
1172754575 20:37274097-37274119 GAGGGAAAGGAGAAGGAAAGAGG + Intergenic
1173109404 20:40172112-40172134 TAGAGAATAGACAAGGAAAGAGG - Intergenic
1173118576 20:40269552-40269574 CAGAGCAAAGAGCAGGACAGGGG - Intergenic
1173544469 20:43883871-43883893 GAGAGAACAGAGAAACACAGGGG - Intergenic
1173752311 20:45487108-45487130 GAAAGAAAAGAGAAAGACAGTGG - Intergenic
1173752312 20:45487134-45487156 GAAAGAAAAGAGAAAGACAGTGG - Intergenic
1173907830 20:46641691-46641713 GTGAGAAAAGACAAGGGCAGGGG + Intronic
1174094560 20:48078021-48078043 TGGAGCAAAGAGAAGGACATGGG - Intergenic
1174188204 20:48721918-48721940 CTGAGCAACCAGAAGGACAGAGG + Intronic
1174328516 20:49798884-49798906 CAGAGATGAGAGATGGAGAGAGG + Intergenic
1174582104 20:51579385-51579407 CAGGGAAAGGGGAAGGACATTGG + Intergenic
1175352300 20:58332653-58332675 GAAAGAAAGGAGAAGGACAAAGG + Intronic
1175361975 20:58419381-58419403 CAGACTCAAGAGAAGCACAGGGG - Intronic
1175467826 20:59204512-59204534 CAAAGCAAAGAGAAGAGCAGTGG - Intronic
1175523426 20:59617802-59617824 AGGAGAAAGAAGAAGGACAGAGG - Intronic
1175546216 20:59779608-59779630 CAGGGGAAAGAGAGGGAGAGAGG - Intronic
1175571644 20:60027227-60027249 CAGGTGAAAAAGAAGGACAGTGG + Intronic
1175731905 20:61359779-61359801 GAGAGAAAAGAGAGAGACAGAGG + Intronic
1175742258 20:61427984-61428006 CAGAGAAAAGAGAACTACTGAGG + Intronic
1176077953 20:63257235-63257257 CAGAGGACAGTGATGGACAGCGG + Intronic
1176383954 21:6127757-6127779 CAGAGAAGAGAGAGGGGGAGAGG + Intergenic
1176658889 21:9614799-9614821 CAGAGAAAGGTTAAGGACACAGG - Intergenic
1176744284 21:10637702-10637724 CTTATAACAGAGAAGGACAGAGG + Intergenic
1176870086 21:14076943-14076965 TGGAGAAAAGAGACAGACAGAGG + Intergenic
1177077065 21:16589147-16589169 CAGAGTAAAGATCTGGACAGGGG + Intergenic
1177195973 21:17903815-17903837 CAGAGAGGAGTGAAGAACAGTGG + Intronic
1177393905 21:20509322-20509344 CTGAGGAAAGTGAAGGACAAAGG - Intergenic
1177444676 21:21177709-21177731 GGGAAAAAAGAGAAGGAGAGGGG - Intronic
1177748506 21:25251241-25251263 CAGAGGAAAGAGAAAGAGACAGG - Intergenic
1177902060 21:26928633-26928655 CAAAGGAAAGAGAAAGAAAGAGG - Intronic
1178000962 21:28161891-28161913 TGGAGCAAAGAGTAGGACAGGGG - Intergenic
1178007971 21:28244554-28244576 CAGAGAAAAGAGAATCAGATTGG + Intergenic
1178598346 21:33974757-33974779 AAGGGAAAAAAGAAGGAAAGAGG - Intergenic
1178634429 21:34289887-34289909 CAGATCATAGAGAATGACAGTGG + Intergenic
1178734638 21:35137715-35137737 CACAGAAATGAGAAAGAAAGGGG - Intronic
1178833145 21:36072857-36072879 CAGAGAAGAGAGTTGAACAGTGG + Exonic
1178875895 21:36413670-36413692 CCCAGAGAAGGGAAGGACAGAGG - Intronic
1178982554 21:37277152-37277174 CACAGAAAAGAGAAATACAATGG + Intergenic
1179222296 21:39419158-39419180 CAGAGACAGGAGAAGAATAGTGG - Intronic
1179338964 21:40486484-40486506 AAGAGGAAAGGGAAGGAGAGAGG + Intronic
1179739520 21:43410481-43410503 CAGAGAAGAGAGAGGGGGAGAGG - Intergenic
1180186918 21:46144707-46144729 GAGAGAGAAGAGAGGGAGAGTGG - Intronic
1180236407 21:46462074-46462096 CAGAGAACAGAGTAGTAGAGTGG + Intronic
1180880980 22:19203444-19203466 CAGAGAGAATAGGAAGACAGGGG - Intronic
1181014880 22:20063170-20063192 AAGAGAAAAGAGAAGAGAAGAGG + Intronic
1181266770 22:21635192-21635214 CAGAGAAAACGCAAGGACAGAGG + Exonic
1181507319 22:23368663-23368685 CATGGAAAAGAGGAGGACTGGGG - Intergenic
1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG + Intronic
1182050668 22:27310495-27310517 GAGAGAGAAGAGAAGGAGGGAGG + Intergenic
1182110458 22:27719428-27719450 GAGAGAACAGATAGGGACAGTGG - Intergenic
1182309737 22:29396074-29396096 AAGAGAAAAGAGAAGAGAAGAGG + Intronic
1182575680 22:31271342-31271364 CAGAGGACAGAGAAGGGCATTGG - Intronic
1182743542 22:32587256-32587278 CAGAGAATAAAGGAGGCCAGTGG + Intronic
1182875689 22:33689413-33689435 CAGAGAGATGAGACAGACAGAGG + Intronic
1183034843 22:35133821-35133843 AAGAGAAATGAGAGGGAGAGGGG + Intergenic
1183182572 22:36270624-36270646 TAGAGAAAAAAGAATGACAATGG - Intergenic
1183284305 22:36952775-36952797 CAGAGGACAGAGGAGGACGGAGG - Intergenic
1183838943 22:40481559-40481581 AAGAGAACAGAGAGTGACAGGGG + Intronic
1184446297 22:44549133-44549155 TAGAGAAAGGAGAAACACAGAGG + Intergenic
949401063 3:3665845-3665867 CAGGAAAGAGAGAAAGACAGAGG + Intergenic
949494615 3:4619837-4619859 GAGAAAAGAGAGAAGGAGAGGGG - Intronic
949567239 3:5256265-5256287 GAGAAAAAAGAGAAGGAGAAGGG - Intergenic
950012985 3:9736454-9736476 AACAGAAAAGAGAAAGACTGTGG - Intronic
950342861 3:12263016-12263038 CAGAGGAGAGAGAAGGACAAAGG + Intergenic
950540314 3:13608539-13608561 CAGAGAAAGGAAGAGGGCAGAGG - Intronic
950575463 3:13829686-13829708 GAGAGAAAAGACGGGGACAGAGG + Intronic
950731024 3:14957886-14957908 CAGAGACCAGGGAAGGAGAGAGG - Intronic
950895623 3:16447967-16447989 AAGAGAGAAAAGAAGGAGAGAGG - Intronic
952007905 3:28863512-28863534 CAGAAAGAACAGAATGACAGAGG - Intergenic
952013476 3:28929862-28929884 CAGAGAAAAGAGAAATTGAGTGG - Intergenic
952027761 3:29103816-29103838 CAGAGAACAGAGAGGGGCACTGG - Intergenic
952218679 3:31302804-31302826 CAGAGAAGAGGAAAGGGCAGGGG - Intergenic
952234553 3:31465258-31465280 CAGAGAAAAGAAAAGAACAAAGG + Intergenic
952683728 3:36124929-36124951 CAGAGAGAAGAGAGAGAGAGAGG + Intergenic
953071084 3:39520602-39520624 GAGAGAGAAGAGAGAGACAGAGG + Intronic
953423380 3:42772513-42772535 AAGAAGAAAGAGAAGGAGAGGGG - Intronic
953439314 3:42904392-42904414 AAAAGAGAAGAGAAGGAAAGAGG - Intronic
953515526 3:43587384-43587406 CAGAGAAACGGGGAGGCCAGGGG + Intronic
953744802 3:45566218-45566240 TACAGAATAGAGAAGGAGAGAGG - Intronic
953903649 3:46857525-46857547 CAGAGAGGAAAGAAGGAGAGAGG + Intergenic
954085423 3:48240360-48240382 CAGGGCAAAGAAAAGGACGGCGG + Intergenic
954169560 3:48789910-48789932 GAAAGAAAAGAGAGGGAGAGAGG - Intronic
954365846 3:50145565-50145587 CAGAGAGAAGAGGAGCACTGAGG + Intergenic
954407556 3:50353910-50353932 CAGAGAAAGGGGAAGGAAATGGG - Exonic
954675466 3:52313120-52313142 CTGGGGAAAGAGAAAGACAGTGG + Intergenic
954713684 3:52516890-52516912 GAGAGAAAGGAAAAGGTCAGAGG - Intronic
955029579 3:55203352-55203374 CAGAGAAGAGGGAAGGGGAGAGG + Intergenic
955185919 3:56715095-56715117 CAAACAAAAAAGATGGACAGTGG - Intergenic
955190994 3:56761429-56761451 AAAAAAAAAGAGAAGGGCAGAGG - Intronic
955216717 3:56990181-56990203 GAGAGAAAAGAGAATACCAGAGG + Intronic
955592601 3:60553796-60553818 CAGGGAAAAGCCAAGCACAGTGG + Intronic
955839947 3:63101688-63101710 CCCAGAAAAGTGGAGGACAGAGG + Intergenic
955856308 3:63277688-63277710 CAGAGAGAGGACCAGGACAGAGG - Intronic
955867925 3:63405132-63405154 TTGAGAAAGGGGAAGGACAGAGG - Intronic
956135936 3:66098994-66099016 CAGAGAGAAGGGAAGGGAAGGGG - Intergenic
956141026 3:66147148-66147170 AAGAGAAAAGAAAAGAAAAGAGG - Intronic
956325642 3:68049704-68049726 CAGACAAGTGAGAGGGACAGAGG - Intronic
956504054 3:69918796-69918818 CAGAGAAAAGAAAATAAGAGAGG - Intronic
956518027 3:70072083-70072105 GAGAGAAAGGAGAAAGAAAGAGG - Intergenic
956903442 3:73741063-73741085 GAGAAAAGAGAGAAAGACAGAGG + Intergenic
957001661 3:74893522-74893544 CACAGACATGGGAAGGACAGAGG + Intergenic
957471666 3:80667030-80667052 CACAGAAATGAGAAGGAATGAGG + Intergenic
957574543 3:81990805-81990827 GAGAGAACAGAGGAGGAGAGAGG - Intergenic
957618083 3:82558327-82558349 CAGAGATAAGAGAACTACATAGG + Intergenic
957898141 3:86450248-86450270 CAGTGAAAAGATAAGGAAATGGG + Intergenic
957962050 3:87268850-87268872 CAGAGGAGAGAGAAGAACAGAGG + Intronic
958036386 3:88174503-88174525 CAGAAGACAGAGAATGACAGTGG + Intergenic
958983404 3:100752045-100752067 TAGAGGAAAGAGAAGGTCAAAGG - Intronic
959893312 3:111580660-111580682 CAGAGGGAAGGGGAGGACAGAGG - Intronic
960105892 3:113796720-113796742 CAGAGAAAAGGAAATGTCAGAGG + Intronic
960158220 3:114319525-114319547 CACAGTAAAGGGAAGAACAGCGG - Intergenic
960254811 3:115500738-115500760 CACAGAAAATAGAAAGAAAGAGG + Intergenic
960538758 3:118842377-118842399 CAGAAAAAAGAAAAGGGGAGGGG + Intergenic
960707712 3:120496329-120496351 CATAGGAAAGAGAAGCACTGAGG - Intergenic
961760335 3:129162476-129162498 CAGAGAAAGGAAAAGGGCAAGGG - Intergenic
962445123 3:135456948-135456970 GAGGGAAAAGAAGAGGACAGGGG - Intergenic
962768612 3:138592123-138592145 GAGAGAGAAGAGAAGGGAAGAGG - Intronic
962932443 3:140050750-140050772 CACAGAAGAGAGAAGGGTAGTGG + Intronic
963024525 3:140905726-140905748 AAAAGAAAAGAGAAGGACCAAGG + Intergenic
963115385 3:141724595-141724617 CAGAGCAAAGAGGATGAGAGAGG + Intergenic
963632688 3:147752763-147752785 AAGAGGAAACAGAAGGAAAGGGG + Intergenic
963709216 3:148727237-148727259 GAGAGAAGAGAGAAAGAGAGAGG - Intronic
963863623 3:150336219-150336241 TAGAGAAAGGGGAAGGAGAGTGG - Intergenic
963967701 3:151391455-151391477 CAGAAAAAAGAGAGAAACAGAGG - Intronic
964073357 3:152663239-152663261 CAGAACAAAGAGAAGGTAAGAGG + Intergenic
964212919 3:154247922-154247944 GAGGGAAAAAAGAATGACAGTGG - Intronic
964240784 3:154591630-154591652 GAAAGAACAGAGCAGGACAGTGG + Intergenic
964450506 3:156808183-156808205 CAAAAAAAAGAGAAGGGAAGGGG + Intergenic
964625215 3:158752161-158752183 CAAATAAAACAGAAAGACAGAGG + Intronic
964763740 3:160158491-160158513 AAGAGCAGAGAGAAGGCCAGTGG - Intergenic
965136502 3:164778311-164778333 CAGAAAAAAGGGAAAGAAAGAGG + Intergenic
965211952 3:165802443-165802465 GAGAGAAAAGAGTAGGACCAGGG + Intronic
965503530 3:169484278-169484300 AAGAGAAAAAAGAAAGAAAGAGG + Intronic
965641607 3:170834735-170834757 CAGAATAAAGAGGAGGACAATGG + Intronic
965878052 3:173352501-173352523 CAGAGAAAAGAGAGGAAAAAAGG - Intergenic
965991398 3:174822987-174823009 AAGTGAAAAGATATGGACAGAGG - Intronic
966016546 3:175146284-175146306 CAGAAAAAAGAGAAGGACTGTGG + Intronic
966085146 3:176061801-176061823 CGGAGCAAAGAGCAGGACAGGGG - Intergenic
966086018 3:176067899-176067921 CAGAGAGAAGAGAATAGCAGAGG + Intergenic
966143254 3:176780978-176781000 CAGACAAAACAGAAGGAAATGGG + Intergenic
966216875 3:177512991-177513013 GGGAGCAAAGAGAAAGACAGAGG + Intergenic
966278931 3:178207905-178207927 CAGAACAAAGAGCAGGACAGGGG + Intergenic
967205105 3:187112484-187112506 AAGAGAAAAGAGAAAGAGAAAGG - Intergenic
967274057 3:187756602-187756624 GAGAGAAGAGAGAAGGGGAGGGG + Intergenic
967293303 3:187942744-187942766 AAGAGAAGCGGGAAGGACAGAGG - Intergenic
967355410 3:188564439-188564461 TAAATAAAAGAGAAGGATAGGGG - Intronic
967422404 3:189288052-189288074 GAGAGAAAAGAGAGAGACAGAGG + Intronic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968056247 3:195694139-195694161 CAGAGAAAAGGGAATGAGAACGG + Intergenic
968320076 3:197758842-197758864 AAGAGAAATAAGTAGGACAGAGG + Intronic
968843749 4:3027945-3027967 CAGAGATCCCAGAAGGACAGAGG + Exonic
969164931 4:5299293-5299315 CAGTGAAAAGGGAAGGAAACAGG + Intronic
969228967 4:5816607-5816629 GAGGGAGAAAAGAAGGACAGAGG - Intronic
969254243 4:5991716-5991738 GACACAGAAGAGAAGGACAGAGG + Intergenic
969436105 4:7190505-7190527 GACAGAAAAGAGAAAGAAAGAGG - Intergenic
970010944 4:11458682-11458704 AAGAGTAAAGGGAAGGACATGGG - Intergenic
970079628 4:12265671-12265693 AAAAGAAAAGAGAAGGGGAGGGG + Intergenic
970173275 4:13310234-13310256 CATTTAAAAGAGAAGGACAGTGG + Intergenic
970500598 4:16672899-16672921 GAGAAAAAAGATAAGGAGAGGGG - Intronic
970739495 4:19217888-19217910 GACAGAAGAGAGAATGACAGTGG - Intergenic
970858567 4:20676132-20676154 GGGAGAGAAGAGAGGGACAGTGG + Intergenic
971120892 4:23703815-23703837 AAGAGAAATGAGAAGTACATGGG + Intergenic
971511832 4:27436221-27436243 CTGGGAATAGAGAAGGACTGTGG - Intergenic
971728902 4:30350538-30350560 CAGAGCAGGGAGAGGGACAGAGG - Intergenic
972400325 4:38695928-38695950 AAGAGAAAAGGGAAGGAAAGTGG + Intronic
972514326 4:39797984-39798006 AAAAGAAAAGAAAATGACAGAGG - Intergenic
972640245 4:40918737-40918759 CAGAGAAAAAATAAGGAAGGAGG - Intronic
972663629 4:41142714-41142736 CAGAGAAGAGAGAAGGACGTTGG - Intronic
972961233 4:44454623-44454645 AAGAGAGAAGGGGAGGACAGGGG + Intergenic
972987281 4:44779993-44780015 AAGAGAATAGAGAAGGAGATGGG - Intergenic
973171349 4:47147862-47147884 CAGAGATAAGATAGAGACAGAGG + Intronic
973194519 4:47424474-47424496 GAAAGAAAAGAAAGGGACAGAGG - Intronic
973337694 4:48972951-48972973 AAAAGGAAGGAGAAGGACAGGGG - Intergenic
973953616 4:56041197-56041219 AAGAGAAAGGATAAGGTCAGGGG - Intergenic
974083039 4:57232270-57232292 CAGAAGAAAGAGAAAGGCAGGGG - Intergenic
974483016 4:62470349-62470371 CTGAAAAAAGAGAAGGGAAGGGG - Intergenic
974767962 4:66372464-66372486 GAGAGAAAAGATCAAGACAGTGG + Intergenic
974953947 4:68616128-68616150 AAGACAAAAGAGAATGAAAGAGG - Intronic
975193133 4:71489936-71489958 CAGGGAAAAGAGCAGGAGAGAGG + Intronic
975406886 4:73999899-73999921 CACAGATAACAGAAGGAGAGAGG - Intergenic
975523828 4:75328168-75328190 CAGAGAAGAGAGGAGGGCAATGG + Intergenic
976964579 4:91020806-91020828 CAGAGAAAACAGAAGTACCTTGG - Intronic
977329426 4:95618667-95618689 AAAAGAAAAGAAAAGGACAAAGG + Intergenic
977475332 4:97500128-97500150 CAGAGAAAAGATGATGATAGTGG + Intronic
977700377 4:100015310-100015332 CAAATGAAAGAGAAGGATAGAGG - Intergenic
977705383 4:100064887-100064909 CAGAGAGAAGGGAAGGAGGGAGG - Intergenic
977745174 4:100538475-100538497 CAGAGAAATGAGCAGGAGGGTGG + Intronic
977901005 4:102422395-102422417 CTGAGCAAAGAGACGGAAAGTGG - Intronic
978303461 4:107295404-107295426 CAGAGTGAGGACAAGGACAGAGG + Intergenic
978486987 4:109265948-109265970 CTGAGAAAAGAGAAGGGCTATGG - Intronic
978689934 4:111495707-111495729 CAAAGCAAAGAGAAAGAGAGAGG + Intergenic
979010308 4:115358460-115358482 CAGAGCAAAGAGAGGGCCACAGG - Intergenic
979121063 4:116902267-116902289 GAGATAAGAGAGAAGGAGAGAGG + Intergenic
979403913 4:120285413-120285435 CAGAGAAACGATAAGAACAAAGG + Intergenic
979624377 4:122828298-122828320 TAGAGGAAAGAGAAAGAAAGGGG + Intronic
979665039 4:123302243-123302265 CAAAGAGGAGAGGAGGACAGGGG - Intronic
979677357 4:123424533-123424555 AAAAGAAAAGAGAAGGCAAGTGG - Intergenic
980289210 4:130824064-130824086 GAGAGAAAATAGTAGGACAAAGG - Intergenic
980289230 4:130824359-130824381 TAGAGAAAAGAGAGGGAGGGAGG - Intergenic
980720115 4:136684739-136684761 TAGGGAAAAGAGATGGAAAGGGG - Intergenic
980758224 4:137192828-137192850 AAAAGAAAAGAAAAGGAAAGAGG + Intergenic
981234181 4:142395239-142395261 CAGAGAAAAGGAAATGAAAGAGG + Intronic
981379013 4:144050217-144050239 CAAAGAAAAGAGGAAGTCAGAGG - Intergenic
981379523 4:144056906-144056928 CAGAGAGAGGAGAAGGAGTGAGG + Intergenic
981500567 4:145447111-145447133 AAGAGAAAAGAGGAGGGAAGCGG + Intergenic
981879273 4:149590144-149590166 GAGAGAAAATAGAATCACAGAGG - Intergenic
982137068 4:152281895-152281917 GAGAGAAGAGAGAAAGCCAGAGG + Intergenic
982425222 4:155250421-155250443 AAGAGAAAAGAAAGGGACAAGGG - Intergenic
982589465 4:157287782-157287804 CGGAGAAAAGAGAAAGACTTTGG - Intronic
982779066 4:159471647-159471669 AAAAGAAAAAAGAAAGACAGAGG - Intergenic
983324299 4:166233742-166233764 TAGAGAGAAGAGAGAGACAGGGG + Intergenic
983412418 4:167417795-167417817 GAAATACAAGAGAAGGACAGAGG + Intergenic
983650919 4:170035579-170035601 CAGGGACAAGAAGAGGACAGTGG - Intergenic
984473201 4:180203482-180203504 CTGAGAAAAGAGTAGGAGGGAGG + Intergenic
984611260 4:181841708-181841730 TATACAAAAGAGATGGACAGAGG - Intergenic
984617560 4:181915701-181915723 GAGAGAAAAGAGGAGGGGAGAGG + Intergenic
985043369 4:185915594-185915616 AGGACAAAAGAGAAGGAAAGAGG - Intronic
985416436 4:189740629-189740651 CAGAGAAAGGTTAAGGACACAGG + Intergenic
985825543 5:2188072-2188094 CAGCGAGAAGAGAAGGACCTGGG - Intergenic
986242650 5:5975078-5975100 CAGAGAAGAGAGAATGCAAGAGG - Intergenic
986283831 5:6345593-6345615 CAGAGAACAGAGGAGGAGGGAGG + Intergenic
987568163 5:19620526-19620548 GAGAGAAAAGAGAAATAAAGAGG + Intronic
987624933 5:20386860-20386882 CAGAGAGAAGACAATGACAGTGG - Intronic
988085895 5:26475378-26475400 CCAAGAAAACAGAAGCACAGAGG - Intergenic
988206989 5:28150599-28150621 CAGAGAAGATAAAAAGACAGAGG + Intergenic
988547832 5:32174440-32174462 CAAAGAAAAGACAAGCACCGAGG - Intergenic
988548717 5:32181130-32181152 CAGAGAAAAAAAAAGGAAACTGG + Intergenic
988673932 5:33411617-33411639 GAGTGAAGAGAGAAGGAAAGGGG - Intergenic
989104432 5:37847837-37847859 CAGAGAAGAGTGAAGAACTGAGG - Intergenic
989168165 5:38450575-38450597 CAGAGAAAAGAGGAAGGCTGAGG - Intronic
989410484 5:41114153-41114175 CAGAGAAAACAGAAGTATACAGG - Intergenic
989647206 5:43648341-43648363 CAGTAAAAAGAAAATGACAGTGG - Intronic
989699446 5:44244352-44244374 CAGAGAATAGATAAGAGCAGAGG - Intergenic
989955593 5:50355641-50355663 CAAAACAAAGAGAAGGACAAAGG - Intergenic
990066728 5:51725619-51725641 CATAGAAAGGAAAAGGACACTGG + Intergenic
990219770 5:53575080-53575102 GAGAGAAAAGAGAAGAAAATGGG + Intronic
990553375 5:56906550-56906572 GAGAAAAAAGATAAGAACAGAGG + Intergenic
990752680 5:59035058-59035080 TAGAGAGGAGAGCAGGACAGCGG - Intronic
990878842 5:60517911-60517933 GAGAGAAGAGAGAAGAAGAGAGG + Intronic
991198526 5:63962183-63962205 GAGAGAAGAGAGGAGGAGAGAGG - Intronic
991249459 5:64543827-64543849 AAAAGAAAAGGGAAGGGCAGAGG + Intronic
991722516 5:69507024-69507046 CAGAGAAAAGGAGAGGACACAGG - Intronic
991900223 5:71453305-71453327 AAGAGAAAAGAGGAGGTCTGTGG - Intergenic
992361459 5:76042570-76042592 CAGACAAGAGATGAGGACAGAGG - Intergenic
992707126 5:79407728-79407750 AGGAGAAGAGAGAAGGGCAGAGG + Intronic
993456555 5:88133657-88133679 GAGAGAAAAGAGAAGAGGAGAGG + Intergenic
993904521 5:93607935-93607957 CACAGAGCACAGAAGGACAGGGG - Intergenic
994084584 5:95744045-95744067 GAGAGAAGAGGGAAGGAGAGAGG - Intronic
994934674 5:106239014-106239036 AAGAAAAAAGAGAAGGAAAAAGG + Intergenic
995099461 5:108280906-108280928 CAGTAAAAAGAGAAAGAGAGAGG + Intronic
996052206 5:118947547-118947569 CAGAGAGAAGAGAAGGGGAGAGG - Intronic
996100246 5:119437736-119437758 CAGGGAAGGGGGAAGGACAGGGG + Intergenic
996638757 5:125728258-125728280 CAGAGCAAAGGGATGGAGAGTGG + Intergenic
996737031 5:126767517-126767539 CAGAGAGAAGAGAGAGAAAGAGG - Intergenic
996847777 5:127919832-127919854 CAGAGCAGATAGAGGGACAGAGG - Intergenic
996914701 5:128698482-128698504 CAGAGAAACTTGAAGGAAAGAGG - Intronic
996993571 5:129667271-129667293 CAGAGAAAAGATCAGGACCCAGG - Intronic
997138769 5:131355507-131355529 GAGAGAGAAGAGAGGGAGAGAGG + Intronic
997235016 5:132267685-132267707 CAGAGAAAAGAAAGGTCCAGGGG + Intronic
997263817 5:132483448-132483470 CAGTGAAATGTGAAGGAAAGTGG - Exonic
997391388 5:133520092-133520114 CTGAGAAAGGAGAAGAAAAGAGG - Intronic
997605308 5:135171127-135171149 CAGAGAAGAGAGTAGAACAGTGG - Intronic
997659000 5:135575893-135575915 GAGTGAGAAGAGAGGGACAGAGG + Intronic
997863432 5:137440318-137440340 AAGAGAAAAGACAAAGACAAAGG + Intronic
998302659 5:141040032-141040054 CAGAGAACTGAGAGGGCCAGAGG - Intergenic
998379373 5:141713117-141713139 CAGGGAAAAGAGAAGGCCTCTGG - Intergenic
998430541 5:142066161-142066183 CAGAGAAATGAGGGGGTCAGGGG + Intergenic
998556915 5:143134447-143134469 CCGAGAAAAGGAAAGGACACTGG - Intronic
999120844 5:149208239-149208261 CACAGAAATGGGAAGGCCAGAGG + Intronic
999252657 5:150191810-150191832 GAGAGGGAAGAGAAGGAGAGTGG - Intronic
999377341 5:151095931-151095953 TGGAGAAAAGAGAAGGACACTGG - Intergenic
999744722 5:154583493-154583515 AAAAGAAAAGAAAAGAACAGAGG + Intergenic
999777670 5:154823867-154823889 CAGAGAAATGGGGAGGGCAGTGG - Intronic
999789795 5:154928663-154928685 CAGATTAAAAAGAAGGCCAGTGG + Intronic
999869134 5:155731096-155731118 AAGAAAAAGGAGAAAGACAGAGG + Intergenic
999881179 5:155866213-155866235 TAGAGAAAAGAGATGGAGGGAGG - Intergenic
1000037703 5:157461324-157461346 CAGTGAAAAGTAAAAGACAGAGG - Intronic
1000154744 5:158539411-158539433 CAGAGCTAACAGAAGGAAAGAGG - Intergenic
1000332556 5:160217387-160217409 CAGAGAAAAGACAAGAAGAAGGG + Intronic
1000408355 5:160912652-160912674 GAGAAAAAAGAGAAGAAAAGAGG + Intergenic
1000435233 5:161199803-161199825 AAGAGAAAAGAAAAGCACAGTGG + Intergenic
1001667382 5:173444640-173444662 CAGAGCAAATACAAGAACAGAGG + Intergenic
1001712428 5:173789396-173789418 CAGAGGAAAGTTCAGGACAGTGG + Intergenic
1001789941 5:174447477-174447499 CACTGAAGAGAGGAGGACAGAGG + Intergenic
1001796431 5:174505982-174506004 AAGAGGAAAATGAAGGACAGTGG + Intergenic
1001954198 5:175837210-175837232 CAGAGCTAAGTGAAGGTCAGGGG - Intronic
1002029930 5:176420414-176420436 GAGAGAAAAAGGAAGGAAAGGGG - Intergenic
1002078329 5:176723080-176723102 CAGTGAAAAGAGCAGCAAAGAGG + Intergenic
1002107323 5:176886630-176886652 CAAAGAAAGGAGGAGGAGAGAGG + Intronic
1002401310 5:178992892-178992914 GAGAGAAACAAGAAGGAGAGAGG + Intronic
1002490417 5:179572284-179572306 CACAGAAAAGTGAAGTCCAGAGG - Intronic
1002545875 5:179944839-179944861 CAGAGAAATTAGGAGGAAAGGGG - Intronic
1002683374 5:180987586-180987608 GAGAGAAAAGACAAGGCGAGTGG + Intergenic
1003483278 6:6552773-6552795 CAGAGGAAACAGAATGAAAGGGG + Intergenic
1003539994 6:7010208-7010230 AAGAGAAGAGAGAGGGAGAGAGG + Intergenic
1003570249 6:7251668-7251690 GAGAGGAAAGAGACGAACAGAGG - Exonic
1003641037 6:7875240-7875262 CAGAGAGAACAAAAAGACAGAGG - Intronic
1003683751 6:8280898-8280920 AAGAGAAACGGGAAGGACAAGGG - Intergenic
1004082068 6:12404522-12404544 CAGACAAGACAGAAGGAGAGAGG - Intergenic
1004383147 6:15149554-15149576 TGAAGGAAAGAGAAGGACAGAGG + Intergenic
1004590613 6:17047697-17047719 CTGTGACAACAGAAGGACAGCGG + Intergenic
1004691622 6:17997131-17997153 AAGCGAAAAGAGAAGTACATTGG + Intergenic
1004761428 6:18670868-18670890 AAGAGAAGAGAGAAGGGGAGGGG - Intergenic
1004797141 6:19099369-19099391 CAGAGTAAAGAGAACTCCAGGGG - Intergenic
1004803746 6:19179607-19179629 CAGAGAACAAAGAAGACCAGGGG + Intergenic
1004904460 6:20223337-20223359 GAGAGAAAACAGAAAGAGAGGGG + Intergenic
1004962345 6:20804323-20804345 GAGAGAAAATAGAATGAGAGAGG + Intronic
1005091241 6:22059109-22059131 CAGAGAAAAGGGAAGAAAACAGG - Intergenic
1005518433 6:26576724-26576746 CAGACAAAACAGCAGGACAGAGG + Intergenic
1005602489 6:27442125-27442147 CTGAGAAAATAGAAGGGCACGGG - Intergenic
1005952926 6:30644730-30644752 GTGAGAAATGAGAGGGACAGAGG - Intronic
1006104984 6:31711033-31711055 AAGTGGAAAGAGATGGACAGAGG + Intronic
1006191783 6:32213890-32213912 AAGAGGAAAGAGAAGGAGAGCGG - Intronic
1006457399 6:34139722-34139744 CAGAGCAAAGCCCAGGACAGGGG + Intronic
1006524215 6:34589938-34589960 AAGAGAAAAGAGGAGGAAAAGGG + Exonic
1007079899 6:39092568-39092590 GAGGGAAAAAGGAAGGACAGAGG - Intergenic
1007261622 6:40568056-40568078 GAGAGAGAAGAGAAGGAAGGGGG - Intronic
1007273774 6:40658603-40658625 CAGAGGGGAGGGAAGGACAGGGG - Intergenic
1007654759 6:43445437-43445459 CAGAGAAGAGAGATTGGCAGAGG - Intronic
1007848671 6:44782284-44782306 CAGAGAGAAGGCAAGGTCAGGGG - Intergenic
1008009858 6:46454863-46454885 CTGAGGACATAGAAGGACAGGGG - Intronic
1008128484 6:47694414-47694436 CAGAAAAGAGAGGAAGACAGAGG + Intronic
1008373795 6:50768307-50768329 GAGAAAAAAGAAAAGGAGAGAGG - Intronic
1008391458 6:50956821-50956843 CAGAGAAAAGAAGAAGGCAGAGG + Intergenic
1008695392 6:54029995-54030017 TAGAGAAATGAGAATCACAGTGG + Intronic
1008753446 6:54764983-54765005 GAGAAAAAGCAGAAGGACAGAGG - Intergenic
1008788645 6:55201330-55201352 CAGAGAAAAGAGAACAGCAAAGG - Intronic
1008875427 6:56320554-56320576 GAGAGAGAAGAAAAGGAGAGTGG - Intronic
1008965060 6:57306709-57306731 GAGAGAAAAGAGAGGGCCAAAGG + Intergenic
1009195930 6:60684371-60684393 AAGAGAAGAGAGAAGGAGGGAGG + Intergenic
1010024426 6:71199221-71199243 TAAAGAAAAGAGGAGGTCAGTGG + Intergenic
1010048001 6:71470013-71470035 CAGAGAAATGAGAAGCACTTGGG - Intergenic
1010112851 6:72261640-72261662 AAGAGGAAAGAGAAAGAAAGAGG + Intronic
1010244534 6:73651053-73651075 CAGGGAAAAGAAAAGGAGCGGGG + Intronic
1010568156 6:77443159-77443181 CAGACAGAAGAAAAAGACAGAGG - Intergenic
1010608636 6:77924810-77924832 CAAAGAAAAGTGACTGACAGGGG + Exonic
1010613961 6:77990619-77990641 AAGAGAGAGGAGAAGGAGAGGGG - Intergenic
1010915838 6:81617795-81617817 AAGAGAATAGAGAAGCACATGGG + Intronic
1010928393 6:81770981-81771003 CAGGGAAATGAGAAGGAAAGGGG + Intergenic
1011058445 6:83233185-83233207 CAGTGAAAAGAGAATGAAAAGGG - Intronic
1011484571 6:87828777-87828799 CAAGGAAGAGAGAAGGAGAGGGG - Intergenic
1011577977 6:88825851-88825873 CAGAGTGAGGAGAAGGATAGTGG - Intronic
1011743336 6:90385367-90385389 TACAGAAAAGAGAAGGTGAGAGG - Intergenic
1011840459 6:91491644-91491666 CAGAGAAGAGAGAGAGAAAGAGG - Intergenic
1011955118 6:93016613-93016635 CAGAGAGTAGAGAAGTCCAGTGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012397972 6:98821721-98821743 CAGAGAAAAGCAAAAGACAGAGG - Intergenic
1012695574 6:102378090-102378112 CAAAAAAAAAAGAATGACAGTGG - Intergenic
1012713722 6:102641142-102641164 AAGAGAGAAGAGAATGAAAGGGG - Intergenic
1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG + Intronic
1013033367 6:106357902-106357924 AAGGGAAAAGAGAAGAAAAGGGG - Intergenic
1013452469 6:110297997-110298019 CAGAGAAAAGGGAGGAAGAGGGG + Intronic
1014313612 6:119835967-119835989 TTGACAAAAGAGAAGGACTGGGG - Intergenic
1014944765 6:127484092-127484114 GAGGTCAAAGAGAAGGACAGGGG + Intronic
1015064775 6:129011206-129011228 GAGCAAAAAGAGAAGGAGAGAGG - Intronic
1015353854 6:132254075-132254097 CAGAGAGAGGAGAATGGCAGAGG + Intergenic
1016239228 6:141909050-141909072 GAAAGAAAATGGAAGGACAGTGG + Intergenic
1016513096 6:144864911-144864933 CAGAGAAGAGAGAAAGAGAGAGG - Intergenic
1016578911 6:145605462-145605484 CAGACAAGAGAGAAGGATAATGG - Intronic
1016726043 6:147368633-147368655 CAAGGAAAAGAAAAGGAAAGCGG + Intronic
1017286368 6:152681027-152681049 GAAAGAAGAGAGAGGGACAGAGG + Intergenic
1017607117 6:156146367-156146389 CAGAGAAAAGAGGAAAAAAGAGG - Intergenic
1018341254 6:162853119-162853141 TAGAGAAAAGAGAACACCAGGGG + Intronic
1018582732 6:165321468-165321490 CAGAGAAAAGAGAAGGCAACTGG + Intergenic
1018648732 6:165972954-165972976 GGGAGAAGAGAGAAGGAGAGAGG - Intronic
1018843900 6:167540756-167540778 AAAAGAAAAGAGAGGGAAAGAGG + Intergenic
1018911401 6:168102341-168102363 GAGAGCAAAGAGAGGGAGAGAGG + Intergenic
1018921709 6:168180051-168180073 CAGAGAAAGGCGGAGGAAAGTGG + Intergenic
1019405736 7:882996-883018 AAGAGACAAAAGAAGGTCAGAGG - Intronic
1019636389 7:2078311-2078333 AAGAGGAAGGAGAAGGCCAGAGG - Intronic
1019908944 7:4086621-4086643 CAGAGAGATGAGAAGGAAGGAGG - Intronic
1020040937 7:5000422-5000444 CAGAGAGAATGGAAGGAGAGAGG + Intronic
1020076538 7:5262478-5262500 AGGAGAAAAGAGAGGGAGAGAGG + Intergenic
1020603021 7:10300342-10300364 CAGAGAAAAGAGAGTGAGAGAGG - Intergenic
1021060003 7:16099497-16099519 AAGGGAAAAGGGAAGGAAAGAGG + Intronic
1021165132 7:17329431-17329453 GAGAGGCAAGAGAAGGAAAGTGG + Intronic
1021442371 7:20690706-20690728 TGGATAAAAGAGTAGGACAGGGG + Intronic
1021584546 7:22193789-22193811 GAGAGAAAAGAGAGGGAGGGAGG + Intronic
1021606755 7:22415966-22415988 CAGACAGAAGGGAAGGACCGGGG - Intergenic
1021784881 7:24141898-24141920 CAGATAAATGAGAAGAACAGAGG + Intergenic
1022237090 7:28472790-28472812 CAGAGCACAGAGAAGCACTGAGG - Intronic
1022437341 7:30401867-30401889 AAGAGAAGAGGGAAGGAGAGAGG - Intronic
1022448126 7:30486747-30486769 CAGAAAAAAAAGAAAGAAAGTGG - Intergenic
1022901173 7:34811965-34811987 GAGAAGAAAGAGAAGGAAAGAGG - Intronic
1022912786 7:34916469-34916491 CAGTGAAAGTAGAAGGACAGTGG + Intergenic
1023308498 7:38856601-38856623 CAGAGAAAAGAGAAAGGGTGGGG + Intronic
1023473452 7:40550959-40550981 AAGAGAAAAGAGAAGAAAACAGG - Intronic
1023776800 7:43615775-43615797 CAGAGGGAAGAGAAGTATAGAGG - Intronic
1023840547 7:44095061-44095083 GAGAGAAGAGAGAGGGAGAGAGG + Intergenic
1023986348 7:45099377-45099399 CAGAACAGAGAGTAGGACAGTGG - Intergenic
1024009198 7:45253318-45253340 GAGAGAGAAGAGAAGGAGACAGG - Intergenic
1024109883 7:46134244-46134266 CAGAGAGAAGAGAACGCCAGAGG - Intergenic
1024245008 7:47462814-47462836 CAGGGAGAAGAGAGGCACAGCGG - Intronic
1024344683 7:48301038-48301060 CACAGAAAATAAAGGGACAGAGG - Intronic
1024408475 7:49010620-49010642 CAGAGTAAAGAAAGGGACACTGG + Intergenic
1024574494 7:50753043-50753065 CAGTGAGCAGCGAAGGACAGTGG + Intronic
1024747832 7:52428430-52428452 CATGGTAAGGAGAAGGACAGGGG - Intergenic
1024882794 7:54108919-54108941 CAGAGGTCATAGAAGGACAGAGG - Intergenic
1024883100 7:54111807-54111829 CAGGGAAAAGGGAAGGAAAAGGG + Intergenic
1024938489 7:54737638-54737660 AAGAGAAAAGAGGAGAGCAGAGG + Intergenic
1025202548 7:56971107-56971129 AGGAGAAAAGAGAGGGAGAGAGG - Intergenic
1025232708 7:57213286-57213308 CAGAGAAAAAACAAGAACAAAGG - Intergenic
1025276946 7:57591010-57591032 CAGAGAGTAAAGAAGGACAAGGG + Intergenic
1025669401 7:63605820-63605842 AGGAGAAAAGAGAGGGAGAGAGG + Intergenic
1025898824 7:65727442-65727464 CAAAGAAAAGAGAGAGGCAGAGG + Intergenic
1026097647 7:67359183-67359205 CAGGGGAAAGAGAAGGGCTGGGG - Intergenic
1026110547 7:67455699-67455721 AAGAGAGAAGAGAAAGAAAGAGG - Intergenic
1026214439 7:68335781-68335803 GAGAGGGAGGAGAAGGACAGAGG + Intergenic
1026228476 7:68462986-68463008 AAGAGGAGAGAGAAGGAAAGAGG - Intergenic
1026298395 7:69076366-69076388 CAGAGAAAAGAAAAACACAGGGG + Intergenic
1026321123 7:69268412-69268434 GAGAGGATAGAGAGGGACAGAGG - Intergenic
1026356576 7:69562970-69562992 AAGGGAGAAGAGAAGAACAGAGG + Intergenic
1026605215 7:71810094-71810116 GAGAGAAAAGACAGGGTCAGTGG + Intronic
1026715471 7:72785572-72785594 ATGAGAAAACAGAAGCACAGAGG + Intronic
1027450500 7:78326043-78326065 GAGACAACAGAGAAGGAAAGTGG - Intronic
1027878552 7:83802352-83802374 AAGAGGAAAGAAAAGGAAAGAGG + Intergenic
1027926748 7:84474962-84474984 CTAAGAAAAGAGAAGGAAATAGG + Intronic
1028055824 7:86241322-86241344 GAGAGAAAAAAGAAGGAGAAGGG + Intergenic
1028210563 7:88069170-88069192 CAGGGAGAAGAGAGGGAAAGAGG - Intronic
1028251623 7:88545004-88545026 GGAAGAAAAGGGAAGGACAGAGG - Intergenic
1028432665 7:90765431-90765453 AAGAGAGAAGTGAAGAACAGAGG + Intronic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1028729606 7:94130739-94130761 CAGAGAAGACAGAGGGACAGAGG - Intergenic
1028791069 7:94853586-94853608 CAGGGAGAAGAGAAGGATGGGGG - Intergenic
1028840511 7:95424713-95424735 AAGAGAAAATAGAAAGACAAGGG + Intronic
1029215106 7:98942369-98942391 CAGAGAGAAGAGGAGGGCAAAGG - Intronic
1029503873 7:100950370-100950392 CAGAGAAAAGAGAAGTATAGAGG - Intronic
1030017020 7:105233033-105233055 AAGAGAGAAGAGAGGGAGAGAGG + Intronic
1030196580 7:106859036-106859058 CAGAGAAGAAAGCAGTACAGAGG + Intergenic
1030321795 7:108177285-108177307 CAGAAATAAAGGAAGGACAGAGG + Intronic
1030347857 7:108454935-108454957 CGAAGAAAAGGGAAGGAGAGAGG + Intronic
1030608605 7:111665029-111665051 CTGAGAAAAGACAAGAGCAGTGG - Intergenic
1030611006 7:111688766-111688788 CAAACAAACGAAAAGGACAGAGG - Intergenic
1030710481 7:112743028-112743050 TAGAGAAGAGAGAACAACAGAGG + Intergenic
1030942453 7:115670977-115670999 AAGAGAAGATAGAGGGACAGGGG + Intergenic
1030947373 7:115740403-115740425 CACAGAAACAAGAAGAACAGTGG + Intergenic
1031060059 7:117040981-117041003 CAGAGAAAAGGAAAGCAAAGGGG - Intronic
1031250944 7:119379698-119379720 AAGAGAAAAGAGAAAGATTGTGG - Intergenic
1031626713 7:124000709-124000731 CAGAAAGAAGAGAGGGAGAGAGG + Intergenic
1031654209 7:124332249-124332271 GAGAGGGAAGAGAAGGAGAGAGG + Intergenic
1032504595 7:132425690-132425712 AAGAGAGAGGAGAAGGACAGGGG + Intronic
1032601378 7:133299863-133299885 CAAAGAGAGGAGAAGGACTGAGG - Intronic
1032838790 7:135697769-135697791 CACATAAAAGAAAACGACAGAGG - Intronic
1032975825 7:137221511-137221533 GAGAGAGAAGAGAAGGGGAGGGG + Intergenic
1033132867 7:138760069-138760091 CAAAGAAAACAGAAGGTCAAAGG - Intronic
1033789250 7:144771566-144771588 CAGAGATGAGAGTAGGTCAGAGG + Intronic
1033993864 7:147321168-147321190 CAGAGAGAAGAAAAGGAGGGAGG - Intronic
1034210335 7:149357670-149357692 AAGAGAAGAGAGAAGGAGAGAGG - Intergenic
1034248973 7:149672948-149672970 CAGAGAGGAGAGAAAGAGAGAGG + Intergenic
1034599218 7:152232593-152232615 CAGGGAAATAAGAAGGACTGAGG + Intronic
1034653411 7:152710497-152710519 AGGAGAAAAGGGAAGGAAAGAGG + Intergenic
1034700205 7:153088767-153088789 CAAAGAAAAGAGAAGATAAGGGG + Intergenic
1035025674 7:155823858-155823880 CAGAGAAATGGAAAGAACAGTGG - Intergenic
1035179204 7:157077149-157077171 CACAGGAATGAGAAGGAGAGAGG - Intergenic
1035287724 7:157816860-157816882 AAGAGAAAAGAGGAGGAGAAAGG - Intronic
1035791756 8:2312695-2312717 CAGTGGAAAGAGAGAGACAGGGG + Intergenic
1035801049 8:2409010-2409032 CAGTGGAAAGAGAGAGACAGGGG - Intergenic
1036469764 8:9042179-9042201 CACAGAAAAGAGAAGGAACTTGG + Intronic
1036764901 8:11543264-11543286 CCGATCAAAGAGAAGGACAAGGG + Exonic
1036990549 8:13588180-13588202 CAGAGAAAACAGATGAACAATGG + Intergenic
1037109165 8:15145135-15145157 CAGAGAAGCCAGAAGGACTGAGG - Intronic
1037145318 8:15564889-15564911 AAGATAGAAGAGAAGGAGAGAGG + Intronic
1037260280 8:17001052-17001074 GTGAGAAAAGAAAAGGAAAGGGG - Intronic
1037520297 8:19674519-19674541 CAGAGGAGGGAGAAGAACAGTGG + Intronic
1037531967 8:19785161-19785183 CAGAGACAAAAGTAGAACAGAGG + Intergenic
1037555385 8:20017408-20017430 GAGAGGAGAGAGAAAGACAGAGG + Intergenic
1037616116 8:20520300-20520322 CAGAGAGAGGGGAAGGAGAGTGG - Intergenic
1037649224 8:20821715-20821737 CAGAGAAAAGACAAGGTCATTGG + Intergenic
1037753702 8:21698323-21698345 CGCAGAAAGAAGAAGGACAGTGG + Intronic
1038020747 8:23550337-23550359 CAGAGAAACGTGAAGGAGGGCGG - Intronic
1038230885 8:25698570-25698592 CAGATAACAGAGGAGAACAGAGG + Intergenic
1038562908 8:28596159-28596181 CAAACAAGAGAGAAGGGCAGAGG - Intergenic
1038687069 8:29728495-29728517 CACAGAAAAGGCAAGGACTGGGG + Intergenic
1038827820 8:31024567-31024589 AATAGAAAAGAGAAAGACAGTGG - Intronic
1039407600 8:37326619-37326641 GAGAGGAAAGGGAAGGAGAGGGG - Intergenic
1039971271 8:42323559-42323581 AAGAGCAAAGGGAAGGAGAGAGG + Intronic
1040413509 8:47178587-47178609 AAAAGAAAAGAGAGGGAAAGGGG - Intergenic
1040781463 8:51114774-51114796 GAGAGAAGGGAGAAGGAGAGAGG - Intergenic
1040794901 8:51278857-51278879 CAGAGAAAAAGAAGGGACAGGGG + Intergenic
1040860101 8:51990295-51990317 TGTAGAAGAGAGAAGGACAGAGG + Intergenic
1041289666 8:56296889-56296911 AAAAGAAAAGAGAAGGGGAGGGG - Intergenic
1041289975 8:56299438-56299460 CTGAGGAAACAGAAGGACACAGG - Intergenic
1041337284 8:56800538-56800560 CATAGAATACAGAAGGAAAGGGG + Intergenic
1041726336 8:61021189-61021211 CTGAGGAAAGAGAAGGCCAAGGG + Intergenic
1041860833 8:62510863-62510885 CACAGGAAAAAGCAGGACAGAGG - Intronic
1041902957 8:63002072-63002094 CAGTAAAAAGGGAAGGTCAGTGG - Intergenic
1042338968 8:67658890-67658912 CAGACAAAAGAGAATGAGAGAGG - Intronic
1042349575 8:67763430-67763452 AAAAGAAAAAAGAAGGACAGAGG - Intergenic
1042595350 8:70441237-70441259 AAGAGGAAAGAGAAAGAAAGGGG + Intergenic
1042648262 8:71011149-71011171 CAGACGAGAGAGAAGGAGAGGGG - Intergenic
1042701309 8:71618106-71618128 CAGAGACCAGAGAGGAACAGAGG - Intergenic
1043570929 8:81601596-81601618 AAGAAAAAAGAAAAGGAAAGTGG + Intergenic
1043638529 8:82418272-82418294 CAGAAGAAAGAGAAACACAGTGG + Intergenic
1043791327 8:84470766-84470788 CAGAAACAAGAAAAGGACATGGG - Intronic
1043861755 8:85325694-85325716 CACAGAACAGAGAAGGACCACGG + Intergenic
1043875889 8:85485486-85485508 CAGGGAAAAGGGCAGGTCAGTGG - Intergenic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045441872 8:102221868-102221890 TAGAGAAAAAAGAAGGGAAGAGG - Intronic
1045614767 8:103896943-103896965 CACAGAAAATACAAGGAGAGGGG + Intronic
1045949963 8:107840501-107840523 GAGAGAGATGAGAAGGAAAGAGG - Intergenic
1046098952 8:109592653-109592675 CAGAGAAATGATAAGCAAAGAGG + Intronic
1046394397 8:113622815-113622837 AAGAGCAAATAAAAGGACAGTGG + Intergenic
1046412944 8:113872416-113872438 AAAAGAAAAGAGAAGGAGTGGGG - Intergenic
1046706741 8:117462014-117462036 AAGGAAAAAGAGAAGGAAAGAGG + Intergenic
1046936186 8:119887497-119887519 CAGAAAGAAGAGAAGGGAAGGGG - Intronic
1047094353 8:121608015-121608037 AAGATAAAAGAGAAGGGCAAAGG + Intergenic
1047330719 8:123884457-123884479 CAGAGGAAAGAGAAAGGCAGAGG + Intronic
1048041150 8:130729851-130729873 CAGGGAAATGAGAAGCATAGAGG + Intergenic
1049288125 8:141787571-141787593 CAGAGAACAGAGAGGGAGGGAGG + Intergenic
1049397704 8:142409276-142409298 GAGTGAAAAGAGAAGGAGAGAGG + Intergenic
1050081218 9:1917818-1917840 GAAAGAAAAGAGAAAGAAAGAGG - Intergenic
1050175841 9:2868629-2868651 CAGAGGAGAGAGAAGGTCAAAGG - Intergenic
1050638759 9:7642450-7642472 CAGAGAAGAGAAAAGGGGAGAGG - Intergenic
1050716120 9:8528261-8528283 CAGAGAAAGAAGAAAGAAAGAGG + Intronic
1050895717 9:10884446-10884468 GAGAGAAAACTGAGGGACAGAGG - Intergenic
1050952112 9:11610750-11610772 GAGGGGAAAGAGAAGGAGAGAGG - Intergenic
1051062807 9:13064676-13064698 CAGAGAAAATTTAAGTACAGAGG - Intergenic
1051111226 9:13639106-13639128 AAGACAAAAGAATAGGACAGTGG + Intergenic
1051123297 9:13775240-13775262 TAGACAAAATAGAAGCACAGAGG - Intergenic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1051930949 9:22384851-22384873 AAGAGAAAGGAGAGGGACATAGG - Intergenic
1051980279 9:23006208-23006230 AAAATAAAAAAGAAGGACAGAGG + Intergenic
1052216985 9:25978691-25978713 AAGAGAAAAGAGAAAGAATGGGG - Intergenic
1052679363 9:31669235-31669257 TAGAGATAGGAGAAGGACAAAGG + Intergenic
1052765996 9:32641473-32641495 CAAAGAAAAGGGAAGGGAAGGGG + Intergenic
1053607491 9:39675740-39675762 CAGAGCAAAGAAAATAACAGAGG - Intergenic
1053865343 9:42432098-42432120 CAGAGCAAAGAAAATAACAGAGG - Intergenic
1054246044 9:62666669-62666691 CAGAGCAAAGAAAATAACAGAGG + Intergenic
1054560166 9:66701202-66701224 CAGAGCAAAGAAAATAACAGAGG + Intergenic
1055197686 9:73616460-73616482 CCCAGAAAAGAAAAGGATAGGGG + Intergenic
1055213337 9:73826973-73826995 AACACAAAAGAGAAGGACAAAGG - Intergenic
1055274092 9:74594797-74594819 AAGAGAAAAAGGAAGGAAAGAGG + Intronic
1055564291 9:77552274-77552296 TGGTGAAAAGTGAAGGACAGTGG + Intronic
1055591041 9:77814105-77814127 CAAAAGAAACAGAAGGACAGAGG + Intronic
1055699024 9:78920979-78921001 GAGAGAAATCAGAAGGACAAAGG - Intergenic
1055901024 9:81238019-81238041 TAGAGATAAGAGAAATACAGAGG + Intergenic
1056246411 9:84699812-84699834 CATAGAGGAGAGAAAGACAGGGG - Intronic
1056385358 9:86092362-86092384 CAGAGTCAGGAGAAGGAAAGAGG - Intronic
1057500100 9:95590031-95590053 CAGAGAAGACAGAAGGACCGAGG - Intergenic
1057803869 9:98206988-98207010 CAAACAAATGAGAAGTACAGGGG + Intronic
1057838792 9:98468315-98468337 CACAGAAAAGGGCAGAACAGTGG - Intronic
1058503675 9:105647768-105647790 CAGAGAATAAAGAAGGAAAGGGG + Intergenic
1058764375 9:108167012-108167034 CTGTGATAAGAGAAGAACAGAGG - Intergenic
1059173373 9:112147405-112147427 CTGAGACAGGAGAAGCACAGGGG + Intronic
1059241751 9:112812105-112812127 GAAAGAAAAAACAAGGACAGAGG - Intronic
1059807206 9:117815328-117815350 ATGAGAAAAGACAAGGACACAGG - Intergenic
1059917900 9:119124224-119124246 GAGAGAAAAGAAAATGAGAGGGG + Intergenic
1059933861 9:119288167-119288189 GGGAGAAAAAAGAAGGACAATGG - Intronic
1060338900 9:122755269-122755291 CAGAGAGGAGAGAAGGACTGGGG - Intergenic
1060862620 9:126967356-126967378 CTGAAAAAAGAAAAGGACAGAGG - Intronic
1061331679 9:129898441-129898463 CAGAGGAACGGGGAGGACAGGGG - Intronic
1061810783 9:133161917-133161939 CAGAGAAAAGAGCAAGTCAAAGG + Intronic
1061890124 9:133614886-133614908 CAGAGAAAGGAGAATGGCAGGGG + Intergenic
1062161775 9:135084357-135084379 GAGAGAGAAGAGACGGAGAGAGG - Intronic
1062304159 9:135893186-135893208 AAGAGAGAAGAGAAGGAGAGAGG + Intronic
1203636635 Un_KI270750v1:118406-118428 CAGAGAAAGGTTAAGGACACAGG - Intergenic
1185490915 X:516392-516414 GAGAGAAGAGAGAAAGAGAGGGG - Intergenic
1185504633 X:622395-622417 GAGAGAAGAGAGAAAGAGAGAGG + Intergenic
1185513684 X:682332-682354 GAGAGAAAAGAGAGAGAAAGAGG + Intergenic
1185545400 X:939789-939811 AAGAGAAAAGAGGAGGAGGGGGG - Intergenic
1185679146 X:1874000-1874022 GAGAGAAAAAAAAAGGAGAGAGG - Intergenic
1185814783 X:3144707-3144729 TAGAGAAAAGAGAGGGAAAAAGG - Intergenic
1185884893 X:3773667-3773689 CAGAGAAATGAGAAGGCAGGAGG - Intergenic
1186011491 X:5139042-5139064 CAGAGAAAGAAGATGGGCAGAGG + Intergenic
1186107102 X:6219414-6219436 AAGAGAAAAAGGAAGGAGAGAGG - Intronic
1186306463 X:8264947-8264969 CAGAAAGGAGAGAAGGACAAGGG - Intergenic
1186546919 X:10459559-10459581 CAGAGAAAAGGAAAAGAAAGGGG + Intronic
1186900979 X:14055686-14055708 AAGAGTAAAGAGTAGAACAGTGG - Intergenic
1187356121 X:18573581-18573603 CAGGGAAAAGAGCATGACAGTGG - Intronic
1187552957 X:20324205-20324227 GAGAGAGAAGAGAAGGAGGGAGG - Intergenic
1188318276 X:28703664-28703686 CAGAAAAAAGAGTGGTACAGAGG - Intronic
1188417829 X:29957909-29957931 CAGATTATAGAGAAGGACACAGG - Intergenic
1188510613 X:30932151-30932173 CAGAGAAAGGGGAAGGGCTGGGG + Intronic
1188993842 X:36857939-36857961 AAGAGAAGAGAGAGGGACATAGG + Intergenic
1189028560 X:37426430-37426452 TAGAGTAAAGAGAAGTAAAGAGG - Intronic
1189908939 X:45790241-45790263 CAGAGAAAAGGAAAAAACAGGGG - Intergenic
1189931007 X:46010843-46010865 CAAAGAACAGAGACGGGCAGAGG - Intergenic
1190016153 X:46828994-46829016 AAAAGAAAAGAGAAAGAGAGAGG + Intergenic
1190446568 X:50531402-50531424 AAAAGAGAAGAGAAGGAAAGAGG - Intergenic
1190581755 X:51897107-51897129 CAAAGAAAAGAGCAAGAGAGGGG - Intronic
1190735768 X:53255256-53255278 ATGAGAAAGGAGAAGGAGAGAGG + Intronic
1190882894 X:54505738-54505760 GTGAGAATAGAGAAAGACAGTGG - Intergenic
1191104196 X:56762261-56762283 AAAAGAAAAGAGAAAGAAAGAGG - Intergenic
1191663726 X:63676689-63676711 CAGAGAAAGGAAAGGTACAGGGG - Intronic
1191940433 X:66474485-66474507 CAGAGGAGAGAGAAAGAGAGAGG + Intergenic
1192190057 X:68985565-68985587 CAGTGGGAGGAGAAGGACAGGGG + Intergenic
1192197341 X:69037240-69037262 AAGAGAAAAAAGAAAGAGAGAGG - Intergenic
1192531936 X:71895587-71895609 AAGAGAAAAGAAAAGGAAAGAGG + Intergenic
1192535278 X:71922219-71922241 CAGAGAAAGGAAGAGGACTGGGG + Intergenic
1192617524 X:72643148-72643170 CAGAGAAAAGGGAAGGAGACTGG + Intronic
1193085271 X:77443314-77443336 CAAAGAAAACAGAAGGAGAGAGG + Intergenic
1193431888 X:81417635-81417657 CAAAGCAAGGAGAAGGATAGGGG - Intergenic
1193678746 X:84490164-84490186 AAGAGAAAAAAAAAGGAGAGAGG - Intronic
1193893188 X:87077529-87077551 AAGGGAAAAGAGAAGGGGAGAGG + Intergenic
1194823080 X:98529549-98529571 CGGAGCAAAGAACAGGACAGGGG + Intergenic
1195234081 X:102879720-102879742 CAGAGAAGGGAGAAGAAGAGAGG - Intergenic
1195841168 X:109178841-109178863 CGGAGCAAAGAACAGGACAGGGG - Intergenic
1196026725 X:111049098-111049120 AAGAGAAAAGAGCAGTGCAGAGG - Intronic
1196156756 X:112438659-112438681 CATAGAGATGAGTAGGACAGGGG - Intergenic
1196265798 X:113645008-113645030 CAGAGAAAAGAATAAGATAGTGG - Intergenic
1196310097 X:114153803-114153825 CAGAGAAAAGAGAGGGAGAATGG + Intergenic
1196484084 X:116183893-116183915 CACAGAAAGGAGAAGGAGAAAGG + Intergenic
1196666431 X:118321901-118321923 AAGAGAAAAGAAAAGAAAAGAGG + Intergenic
1196845391 X:119893100-119893122 CAAAGAAAAAAAAAAGACAGTGG - Intergenic
1197355141 X:125430325-125430347 CAGAGACAGGAGAAGGAGAAGGG - Intergenic
1197355963 X:125437651-125437673 GAAGCAAAAGAGAAGGACAGAGG - Intergenic
1197532498 X:127646899-127646921 GAGAGAAGAGAGAGGGAGAGGGG + Intergenic
1197630463 X:128852469-128852491 CAGGGAACAAAGAAGGACAGGGG + Intergenic
1197673268 X:129302240-129302262 CAGAAAAAGGACAAGGACAAAGG - Intergenic
1198075098 X:133186339-133186361 CAGGGAAAGGAGCAGGAAAGAGG + Intergenic
1198121336 X:133595282-133595304 CAGAGGAAAGAGAATGGCAGTGG + Intronic
1198562697 X:137867944-137867966 CAGGGAAAGGAGAGGGGCAGAGG + Intergenic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1198692332 X:139297927-139297949 CAGAAAACAGATAAGGAGAGTGG - Intergenic
1198704141 X:139429079-139429101 TAGGGAAAAGAAATGGACAGAGG - Intergenic
1199633956 X:149797449-149797471 CAGAGAAAATAGAAGAGAAGGGG - Intergenic
1199680836 X:150223577-150223599 GAGAGAAAAGAGAAGGAACATGG + Intergenic
1199992579 X:152995865-152995887 CAGAAAAAAGAGAGAGAGAGAGG - Intergenic
1200314824 X:155121187-155121209 AAAAGAATAGAGAAGAACAGTGG - Intronic
1200398957 X:156007615-156007637 CAGAGACCACAGAAGGACATGGG + Intronic
1200416071 Y:2911414-2911436 CACAGAAAAGTGAAAGACAAGGG + Intronic
1201453008 Y:14136324-14136346 AAGGGAAAAGAGAAGGAAAATGG - Intergenic
1201458238 Y:14194364-14194386 CAGAGAAGAGAGGTGGAAAGGGG - Intergenic
1201724179 Y:17135546-17135568 CAGAGCAAAGAGAGAGAGAGAGG + Intergenic
1201784716 Y:17762433-17762455 CTGAAAAAAGAGAAATACAGGGG - Intergenic
1201816836 Y:18143554-18143576 CTGAAAAAAGAGAAATACAGGGG + Intergenic
1202110803 Y:21417203-21417225 AGGAGAAGAGAGAAGGACACAGG + Intergenic
1202269243 Y:23054313-23054335 CAGTGAAAAGAAAATGACTGGGG + Intergenic
1202422235 Y:24688053-24688075 CAGTGAAAAGAAAATGACTGGGG + Intergenic
1202448551 Y:24982025-24982047 CAGTGAAAAGAAAATGACTGGGG - Intergenic