ID: 1147968701

View in Genome Browser
Species Human (GRCh38)
Location 17:44207913-44207935
Sequence TGGGGGAGACAGAAGCGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 1, 1: 1, 2: 0, 3: 38, 4: 482}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147968698_1147968701 -6 Left 1147968698 17:44207896-44207918 CCTGGGGAGACAGGCTCTGGGGG 0: 1
1: 1
2: 6
3: 58
4: 361
Right 1147968701 17:44207913-44207935 TGGGGGAGACAGAAGCGGCAAGG 0: 1
1: 1
2: 0
3: 38
4: 482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147968701 Original CRISPR TGGGGGAGACAGAAGCGGCA AGG Intronic
901089043 1:6629424-6629446 TGGGGAGGACAGATGGGGCAGGG - Intronic
901137922 1:7009659-7009681 TCTGGGGGACAGAAGCAGCAGGG - Intronic
902044379 1:13513877-13513899 TGGGAGAGGCGGGAGCGGCAGGG + Exonic
902386412 1:16078388-16078410 TGGGGGAGACAGAGCCCTCAGGG + Intergenic
902468914 1:16634517-16634539 TGTGGGAGACCGAGGCGGGAGGG + Intergenic
902530582 1:17088136-17088158 TGGGGAGGGCAGAAGAGGCACGG + Intronic
903801054 1:25968499-25968521 AGGTGGAGACAGGAGCTGCATGG + Intronic
904010697 1:27388525-27388547 TGGTGAAGACAGAAGAGGCAAGG + Intergenic
904577993 1:31517809-31517831 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
904615039 1:31744986-31745008 TGGGGGAGATTTAAGGGGCATGG + Intronic
905405270 1:37728259-37728281 TGGGGGAGCCAGAACCTGGAGGG + Intronic
905412396 1:37779579-37779601 TGGAGGACACAGAAGGGACAGGG + Intergenic
905447031 1:38034243-38034265 TGGGGGAGACAGAATAGGAATGG + Intergenic
906283243 1:44568237-44568259 TGAGGGAGGCAGAACTGGCAGGG - Intronic
906701150 1:47859189-47859211 TGGGGGAAACAAAAGGGTCAGGG - Intronic
907190646 1:52645069-52645091 TCGGGGAGGTAGAAGGGGCAAGG + Intronic
907456455 1:54579538-54579560 TGGGGGAGAGGGAAGGGGCTGGG + Intronic
907495563 1:54841933-54841955 TGGGGGTGACAGCATGGGCATGG + Exonic
908394541 1:63713453-63713475 GTGGGGAGAGACAAGCGGCATGG + Intergenic
909410600 1:75345999-75346021 TGGGGGTGAAAGAAAGGGCATGG + Intronic
909559434 1:76993099-76993121 TGGGGAAGGCAAAAGGGGCATGG - Intronic
910050945 1:82973446-82973468 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
910477201 1:87620062-87620084 TGGGGGAGACAGAAGGGAGATGG - Intergenic
911587220 1:99704878-99704900 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
912438757 1:109681723-109681745 TGGGGGAGACAGAGACAGAAAGG - Intronic
912441280 1:109700168-109700190 TGGGGGAGACAGAGACAGAAAGG - Intronic
913457604 1:119049290-119049312 TGGGGGAGCCAGAAGGGAGATGG - Intronic
916284718 1:163093733-163093755 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
916677054 1:167072904-167072926 TGGGTGAGACAGGAGAAGCAGGG + Intronic
917254863 1:173103599-173103621 TGGGGAAGTCAGAAGGGGGATGG + Intergenic
918362363 1:183772072-183772094 TGGGGGAGCCAGAAGGGAGATGG - Intronic
918813359 1:189149952-189149974 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
919742987 1:200991727-200991749 TGTGGGAGACAGAAGAGGGCTGG + Intronic
921092199 1:211854982-211855004 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
921116158 1:212093500-212093522 TGGGGGAGCCAGAAGGGAAATGG + Intronic
922968707 1:229715978-229716000 TGGAGGAGACAGAGGCCGCAGGG + Intergenic
923383787 1:233447029-233447051 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
924501506 1:244642824-244642846 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
924697796 1:246418664-246418686 TGGGGGAGCCAGAAGGGAAATGG + Intronic
924947395 1:248855693-248855715 TGGCTGAGACAGAAAGGGCAGGG - Intronic
1062815076 10:493449-493471 GGGGGGAGCGAGAAGGGGCAAGG + Intronic
1062925287 10:1311708-1311730 AGTGGGAGACAGAAGAAGCAAGG - Intronic
1063233245 10:4086728-4086750 CGGGGGAGGCAGAAGAGGGACGG - Intergenic
1063357747 10:5417052-5417074 TGGGGGAGCCAGAAGGGAAATGG + Intronic
1063971809 10:11386239-11386261 TGGTGGAGACAGAACTGGAAGGG - Intergenic
1064215050 10:13393334-13393356 TTGGGGAGACGGGAGGGGCACGG + Intergenic
1064219776 10:13430939-13430961 CAGGGGAGACAGAGGCGCCAAGG - Intergenic
1064251589 10:13710302-13710324 TGGGGGAGACAGGAGTTGCCAGG - Intronic
1065113448 10:22461939-22461961 TGGGGGAGCAAGGAGCTGCAGGG - Intergenic
1065778297 10:29142975-29142997 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1067071676 10:43137514-43137536 GCGGGGAGACTGAAGCCGCAGGG - Intergenic
1068258330 10:54543143-54543165 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1069352923 10:67551378-67551400 TGGGGGAGACAGAAAGGAGATGG - Intronic
1069443760 10:68454124-68454146 TGTGGGTGACAAAAGCAGCATGG - Intronic
1071028133 10:81139979-81140001 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1071220421 10:83459018-83459040 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1073180234 10:101579072-101579094 GGGTGGGGACAGAAGCTGCAGGG - Exonic
1073193354 10:101668129-101668151 TAGGTGAGCCAGAAGCTGCAGGG - Intronic
1073207254 10:101775778-101775800 TGTGGGAGACAAAAGCGGGCGGG + Intronic
1073520200 10:104121603-104121625 TGGGGCGGCCAGAAGCCGCACGG - Intergenic
1073744135 10:106446078-106446100 TGGGGGACAGAGAAACGGGAAGG - Intergenic
1075223772 10:120606907-120606929 TTTGGGAGAGAGAAGAGGCAAGG + Intergenic
1076070253 10:127483058-127483080 TGAGGGAGAGAGAAACGTCAAGG - Intergenic
1076330946 10:129665810-129665832 TGAGGGAGACTGAAGAGACATGG + Intronic
1076785576 10:132748203-132748225 TCGGAGAGACAGAGGCAGCAAGG - Intronic
1077539288 11:3139104-3139126 TGGGGGAGACTGAGGCTGGAGGG - Intronic
1077586705 11:3459388-3459410 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1080036688 11:27719180-27719202 CGGGTGAGATAGAAGCGGCGCGG - Intronic
1081251604 11:40842256-40842278 TGCAGGAGGCAGAAGCTGCATGG - Intronic
1081329993 11:41790749-41790771 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1081352092 11:42066401-42066423 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1081537701 11:44007344-44007366 TGGGCGAGAAAGAAGCCCCAAGG + Intergenic
1083719512 11:64597502-64597524 TGAGGGAGAGAGAGGCGTCATGG - Intronic
1083896035 11:65620286-65620308 TGGCAGAGACAGAAGCACCAAGG - Intronic
1084242702 11:67833420-67833442 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1084830299 11:71763584-71763606 TGGGGGAGTCAGAAGGGAGATGG - Intergenic
1085684076 11:78605830-78605852 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1088103234 11:106177224-106177246 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1088238530 11:107750409-107750431 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1089737129 11:120557219-120557241 CGGGGGGGACAGGAGAGGCAAGG - Intronic
1091688239 12:2578798-2578820 TGAGGGAGGCAGGGGCGGCAGGG + Intronic
1092412936 12:8268121-8268143 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1093089390 12:14904508-14904530 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1093509035 12:19904135-19904157 TGGGGGAGCCAGAAGAGAGATGG - Intergenic
1094844374 12:34355004-34355026 GCGGGGAAACAGAAACGGCATGG - Intergenic
1095715934 12:45345949-45345971 TGGGGGAGAGAGAGGTGGTAGGG + Intronic
1095945167 12:47749565-47749587 TGGGGGCGGCAGGGGCGGCAGGG - Intronic
1096078286 12:48818224-48818246 CGTGGGAGACAGAAGAGGCGCGG - Intronic
1096171667 12:49476346-49476368 TGGGGGAGCCAGAAGGGAGACGG - Intronic
1096584204 12:52608960-52608982 TGGGGGTGACAGAAGAGGGGAGG + Intronic
1097244359 12:57598878-57598900 AGGGGGATTCAGAAACGGCATGG + Intronic
1098547969 12:71731965-71731987 TGGGGGAGCAAGAAGGGGGATGG - Intergenic
1098605060 12:72380398-72380420 TGTGGGGGACAGATGGGGCATGG + Intronic
1099499135 12:83389514-83389536 TGGGGGAGCCAGAAGGGAAATGG - Intergenic
1100641291 12:96484416-96484438 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1100994723 12:100292417-100292439 TGGAGGACACAGAACTGGCAGGG + Intronic
1101389175 12:104284698-104284720 TGGGGGACAAAGAAGAGGGAAGG + Intronic
1101455187 12:104824461-104824483 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1101455761 12:104828288-104828310 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1101828178 12:108236953-108236975 GAGGGGAGACAGAAGAGGGAAGG + Intronic
1102027240 12:109720445-109720467 TGGGGGAGGCAGAGGTGGCAGGG + Intronic
1102152259 12:110696993-110697015 TGTGGGAGACAGAAAAGACAGGG + Intronic
1102821828 12:115915076-115915098 AGGGGGAGAAAGGAGAGGCAAGG + Intergenic
1103058842 12:117842764-117842786 TGGGCAAGACAGAGGGGGCAGGG + Intronic
1103836736 12:123827511-123827533 TGGGTGGGACAGAGGGGGCATGG + Intronic
1104813574 12:131633335-131633357 TGGGGGAGGCAGAAGGTGCCTGG + Intergenic
1105203327 13:18197413-18197435 TCTGGGAGACAGAAGGGGAATGG - Intergenic
1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG + Intergenic
1106169854 13:27279754-27279776 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1106319457 13:28624353-28624375 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1107410112 13:40150672-40150694 TGGGGGAAACAGAGGAGGGAGGG - Intergenic
1107459103 13:40584074-40584096 AGGGGGAGACAGATGGGGAATGG + Intronic
1108604704 13:52026004-52026026 TGGTGGAGACAGGAGCTGCTTGG + Intronic
1109151702 13:58856592-58856614 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1109172876 13:59117960-59117982 TGGGGGAGCCAGAAGAGAGATGG + Intergenic
1109225922 13:59695290-59695312 TGGGGAAGACAAAAGCACCAGGG - Intronic
1109651294 13:65330751-65330773 TGGGGGAGCAAGAAGCGAGATGG + Intergenic
1109735929 13:66484057-66484079 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1109784546 13:67156553-67156575 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1110964515 13:81676151-81676173 TGGGGAAGCCAGAAGGGGGATGG + Intergenic
1111097640 13:83535587-83535609 TGGGGGAGGCAGAAGGGAGATGG - Intergenic
1111292180 13:86185013-86185035 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1111292755 13:86188800-86188822 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1111343934 13:86924524-86924546 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
1112253827 13:97809135-97809157 GGGGGGAGACAGTGGGGGCAGGG + Intergenic
1113141361 13:107154959-107154981 TGAAGGAGACAGAAGAGACAAGG + Intergenic
1113352893 13:109546871-109546893 TGGGGGCGAAAGAAGAGGGAGGG - Intergenic
1114438295 14:22726283-22726305 TGGGGAAGACAGCAGGGGCATGG + Intergenic
1114478210 14:23012789-23012811 TTTGGGAGACCGAAGCGGCACGG + Intergenic
1114657028 14:24322460-24322482 TGTGGGAGAAAGGAGGGGCAGGG + Intronic
1116539021 14:46074634-46074656 TGGGTGAGACAGCAGTGGTATGG - Intergenic
1117135381 14:52730227-52730249 GGAGGGAGACGGCAGCGGCATGG + Exonic
1118745592 14:68770796-68770818 TGGAGGAGAGGGGAGCGGCAGGG - Intergenic
1118929344 14:70225642-70225664 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1119697666 14:76726530-76726552 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1121632839 14:95433411-95433433 TGGGGGAAACAGCAGCGTCATGG + Intronic
1122287454 14:100660038-100660060 TGGAGGGGACAGAAGGGACAGGG + Intergenic
1122302108 14:100737092-100737114 TGGTGGAGACAGGAGGGGAAGGG - Exonic
1122313394 14:100811505-100811527 TGGTGGAGACAGAAGTGGGAAGG + Intergenic
1122371153 14:101229776-101229798 TGGGGGAGCCAGAAGGGAGACGG + Intergenic
1122979697 14:105185906-105185928 TGGGGGAGTCAGGGGCGGGAGGG + Intergenic
1123159934 14:106268529-106268551 TGGGGGGGAAATCAGCGGCAGGG - Intergenic
1123452694 15:20380864-20380886 TGGGGGAGACAAAACTAGCAGGG + Intergenic
1123539249 15:21271689-21271711 TGGGGGAGAGGGAAGAGGAAGGG - Intergenic
1123809072 15:23905248-23905270 TGGGGGAGCCAGAAGGGTGATGG + Intergenic
1125201127 15:37101447-37101469 TGGGGGAGAAAGAAGTTGCCGGG + Intergenic
1125599090 15:40906049-40906071 AGGAGAAGACAGAAGGGGCAGGG - Intergenic
1125632055 15:41155104-41155126 TGGGGGAGACAGGTGGGGCGTGG - Intergenic
1125752308 15:42037030-42037052 TGGAGGGGGCTGAAGCGGCAGGG - Intronic
1125998689 15:44188920-44188942 TCGGGGAGTCAGAAGTGGAAGGG + Intronic
1126228298 15:46296475-46296497 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1128609420 15:69062102-69062124 TGGGGGAGATAGAGGAGCCAAGG - Intronic
1128782898 15:70374634-70374656 TGGGGGAGGCAGCAGAGACAGGG - Intergenic
1128831855 15:70776777-70776799 TAGGGGACTCAGAAGCGGCAGGG - Intergenic
1129393167 15:75230731-75230753 TGGGGAAGGCAGAGGCAGCAAGG - Intergenic
1130404309 15:83584273-83584295 AGGGGGAGACAGGAGTGCCAAGG - Intronic
1130682706 15:86010491-86010513 TGGGGGAGCCAGAAGAGAGATGG + Intergenic
1130828721 15:87577523-87577545 TGGAGGAGGCAGAGGAGGCAAGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132602464 16:779786-779808 TGGGGTGGGCAGAGGCGGCAGGG + Intronic
1132744508 16:1431124-1431146 TGGGGGAGGCAGACGCTGCTGGG + Intergenic
1132810090 16:1793232-1793254 TGGGGGTGGCCGAAGCTGCAAGG + Intronic
1132908953 16:2298706-2298728 AGTGGGAAAAAGAAGCGGCATGG + Intronic
1134149035 16:11791233-11791255 TGGGGGAGGCAGGAGCTGCGTGG - Intronic
1134307421 16:13045751-13045773 TGGGGGACACAGTGGGGGCAGGG - Intronic
1134747348 16:16598543-16598565 TTGGGGAGTCAGAAGCAGGAAGG + Intergenic
1134998123 16:18755115-18755137 TTGGGGAGTCAGAAGCAGGAAGG - Intergenic
1136125807 16:28179549-28179571 TGGAGGAAACAGAAGCATCAAGG - Intronic
1136640820 16:31563748-31563770 TTAGGGAGACAGAGGGGGCAGGG - Intergenic
1136664145 16:31793566-31793588 TTAGGGAGACAGAGGGGGCAGGG + Intronic
1136928561 16:34397332-34397354 GAGGGGAGGCAGAAGCGCCAAGG + Intergenic
1136976013 16:35014472-35014494 GAGGGGAGGCAGAAGCGCCAAGG - Intergenic
1137563897 16:49521558-49521580 ATGGGGAGACAGCAGTGGCATGG + Intronic
1138551476 16:57751235-57751257 TGGGGGAGAGAGAAGCAGAGGGG - Intronic
1139170879 16:64628016-64628038 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1140034799 16:71364029-71364051 TGGGGGAGGGAGCAGAGGCAGGG - Intronic
1140128489 16:72137412-72137434 TGGGGGAAACAGAAGAGCGAAGG + Intronic
1140945540 16:79764947-79764969 TGGAGGAGACAGAAGATGGATGG - Intergenic
1143852234 17:9821718-9821740 TGGGGAAGACAGGTGCGGGATGG - Intronic
1143954348 17:10657044-10657066 TGGAGGAGAGAGAACCTGCAGGG + Intronic
1144044877 17:11446427-11446449 AGGGGCAGCCAGAGGCGGCAGGG - Intronic
1144969146 17:19096212-19096234 AGTGGGAGGCAGAAGCGGCGGGG + Intronic
1144978770 17:19155854-19155876 AGTGGGAGGCAGAAGCGGCGGGG - Intronic
1144989452 17:19222378-19222400 AGTGGGAGGCAGAAGCGGCGGGG + Intronic
1145353934 17:22119148-22119170 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1145752871 17:27367759-27367781 TGGGGGAGAAAGAGAAGGCAAGG - Intergenic
1145990887 17:29078816-29078838 TGGGGGAGGCAGGAGAGCCAGGG + Exonic
1146679659 17:34797932-34797954 TAGGTGGGACAGAAGCGGCTGGG - Intergenic
1146803354 17:35844865-35844887 TGGAGGAGACAGAAGCCGGGGGG + Exonic
1147318494 17:39632382-39632404 TGGGGGAGAAGGAAGCTGCCTGG + Intronic
1147533092 17:41298589-41298611 CGGGGGAGCCAGAAGGGGGATGG - Intergenic
1147597907 17:41728396-41728418 TGGGGGAGACAGAGGCATCTGGG - Intronic
1147629080 17:41918597-41918619 TGGCAGAGGCAGAAGAGGCAAGG + Intronic
1147968701 17:44207913-44207935 TGGGGGAGACAGAAGCGGCAAGG + Intronic
1148084506 17:44985807-44985829 TGGGGGAGCCAGAAGGGGGATGG - Intergenic
1148892972 17:50820974-50820996 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1149503764 17:57175660-57175682 TGTGGGACACAGAAACGGGAAGG - Intergenic
1149888147 17:60361230-60361252 TGGGGAAGACTGAATGGGCACGG - Intronic
1149980026 17:61303335-61303357 TTGGGGATACAGCAGCGGCCTGG + Intronic
1150069196 17:62137914-62137936 GGTGGGAGACATAGGCGGCAGGG + Intergenic
1150597602 17:66620160-66620182 TGAGTTAGAAAGAAGCGGCATGG - Intronic
1151465132 17:74280152-74280174 TGGGGGAGTCAGAAAGGTCAAGG + Intronic
1151872296 17:76844592-76844614 TGGGGAAGAGAGAAGGGGGACGG + Intergenic
1152577971 17:81151273-81151295 TGGGGGAGACAGGTGGGGCTGGG - Intronic
1152892744 17:82891753-82891775 TGGGGGACACAGAGGGGGCTGGG + Intronic
1153990481 18:10394731-10394753 TGGGGGAGACAGAAGGGAGATGG + Intergenic
1155703495 18:28778985-28779007 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1156432048 18:37085520-37085542 TGGGGGAGATGGGAGGGGCAGGG + Intronic
1156551915 18:38027422-38027444 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1157534976 18:48451469-48451491 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1157858914 18:51124003-51124025 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1158015220 18:52775527-52775549 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1159328050 18:66949495-66949517 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1159576837 18:70189334-70189356 TGGAGGAGAAAGAAGCAGGAAGG - Intronic
1160726593 19:620379-620401 GGTGGGAGACATAGGCGGCAGGG + Exonic
1160731293 19:642779-642801 TGTGGGAGTCAGAAGGGGCAGGG - Intronic
1160996370 19:1883943-1883965 TGAGGGAGCCAGGAGTGGCAGGG - Intronic
1161238569 19:3209641-3209663 AGGGGGTGACAGTAGGGGCAGGG + Intergenic
1161919308 19:7254271-7254293 TGGGGGAGGCTGAAGCGAGAGGG + Intronic
1162200288 19:9015085-9015107 TGGCGGAGACAGAGGAGGCAGGG + Intergenic
1162639893 19:11999998-12000020 TAGGGGAGCCAGAAGCGAGATGG - Intergenic
1163686895 19:18716868-18716890 TGGGGGAGCCAGGTGGGGCATGG + Intronic
1165264024 19:34645720-34645742 TGGGTGAGAAAGAAGCGGGCAGG + Intronic
1165295830 19:34925372-34925394 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
1165505858 19:36228787-36228809 TGGTGGAGAAAGAAGTGGGAAGG + Exonic
1165952738 19:39483270-39483292 TGGGGGAGCCAGCAGCTGGATGG + Intronic
1166123256 19:40698659-40698681 TTGTGGAGAAAGAAGAGGCAAGG + Intronic
1166890096 19:45986234-45986256 TGGGGGCGATAGCAGCAGCAGGG - Intergenic
1167256973 19:48436464-48436486 CGGGGGAGCCAGAGGCTGCATGG + Intronic
1168011848 19:53539192-53539214 TGGGGAAAACAGAACCGGAAGGG - Intronic
1168329318 19:55557537-55557559 TGGGGGAGGCAGTGGGGGCAGGG - Intergenic
925070996 2:966035-966057 TGGAGGCGAGAGAAGCAGCAAGG - Intronic
925640977 2:5985629-5985651 CGGTGTAGACAGCAGCGGCAGGG + Intergenic
925839810 2:7980506-7980528 TGGGGGAGGCAGAAGGGAGATGG - Intergenic
926139263 2:10358738-10358760 TGGGGGAGCCAGAAGGGAGATGG - Intronic
926482505 2:13417423-13417445 TGGGGGAGACAAAACTAGCAGGG - Intergenic
927003583 2:18824935-18824957 TGTGGGAGACAGCAGCAGAAAGG - Intergenic
927097053 2:19755257-19755279 TGGGGCAGACAGATGCGAGAAGG + Intergenic
927584014 2:24282372-24282394 TGGGGGAGCCAGAAGGGAGACGG - Intronic
927963566 2:27255494-27255516 CGGGGGAGAAAGAACAGGCAGGG + Intronic
928019936 2:27696204-27696226 TGAGGCAGACATAAGCAGCAGGG + Intergenic
928107201 2:28478172-28478194 TTTGGGAGACTGAAGGGGCATGG - Intronic
928167019 2:28979136-28979158 TGGGGGAGCCAGGAGCTGCCTGG - Intronic
928174551 2:29024799-29024821 TGGGGGTGACAGGAGCTCCAGGG - Intronic
928815163 2:35285098-35285120 TGGGGTAGAGAGAAGAGGTAAGG - Intergenic
928924968 2:36568163-36568185 AGGGAGAGACAGAAGGGGTAGGG + Intronic
930297943 2:49578887-49578909 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
930717799 2:54609076-54609098 AAGGGGAGGCAGAAGAGGCAGGG + Intronic
931034746 2:58227440-58227462 TGTGGGAGACAGAAGGGAGACGG + Intronic
931470164 2:62531652-62531674 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
933947466 2:87299002-87299024 AAGGAGAGACAGAAGGGGCATGG - Intergenic
934539555 2:95162601-95162623 TGAGCAAGACAGAAGCTGCATGG - Intronic
934567986 2:95351117-95351139 TGGGGAAGAGAGAAGCCGCTGGG - Intronic
934957063 2:98631674-98631696 TGGGGGAGCCAGAAGGGAGATGG - Intronic
935308448 2:101759737-101759759 TGGGGGAGAGAAAAGGGGGAGGG - Intronic
935543659 2:104378278-104378300 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
935663998 2:105494506-105494528 TGGGGGAGCCAGAAGGGTGATGG + Intergenic
936020153 2:108988580-108988602 TGGGGAAGGCAGGCGCGGCAGGG - Intronic
936022800 2:109007629-109007651 TGTGGGGGACAGGAGAGGCAGGG + Intergenic
936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG + Intergenic
937302704 2:120852908-120852930 TGGGGGAGACAGACGCAGGAAGG + Intronic
939649722 2:144745727-144745749 TGGGGGAGCCAGAAGTGAGATGG - Intergenic
940102326 2:150055425-150055447 AGAGAGAGAGAGAAGCGGCAGGG - Intergenic
940360491 2:152791111-152791133 TGGGGGAGCCAGAAGAGAGATGG - Intergenic
941106840 2:161364080-161364102 TGGGGGAGCCAGAAGGGAGATGG + Intronic
941325498 2:164109337-164109359 TGGGGGAGACAAAAGGGAAATGG - Intergenic
942715453 2:178886443-178886465 TGGGGGTGGCAGAGGAGGCAGGG - Intronic
943838878 2:192552264-192552286 TTGGGGAGCCAGAAGAGGGATGG + Intergenic
946204438 2:218093243-218093265 GGGGGGAGACTGAAGTGACAGGG + Intergenic
948101033 2:235373527-235373549 GGGGGGGGATAGAAGGGGCAGGG - Intergenic
948302665 2:236919758-236919780 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
948667214 2:239544097-239544119 TGGGGAAGGCACAAGAGGCAGGG + Intergenic
948877976 2:240840405-240840427 TGGGGGAGACAGAATTTGCCTGG - Intergenic
948949099 2:241237239-241237261 TAGGGGAGACAGAAAGGGCAAGG + Intronic
1168851327 20:979060-979082 TGAGGGAGAGAGAAGAGACAAGG - Intronic
1169135740 20:3195992-3196014 TGGAGGAGAGAGAAGAGGCAGGG - Intronic
1169227747 20:3866634-3866656 TGAGGCAGGCAGGAGCGGCAGGG + Exonic
1169550672 20:6698232-6698254 AGGTGGAGACAGAAGAGGCAGGG - Intergenic
1170270972 20:14527037-14527059 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1170695868 20:18658040-18658062 AGTGGGAGAGAGAAGTGGCAAGG + Intronic
1170845211 20:19956591-19956613 TAGGAGAAAGAGAAGCGGCACGG - Intronic
1171145734 20:22780535-22780557 GTGGGGAGAGAGAAGCAGCATGG - Intergenic
1171150519 20:22823039-22823061 TGGAGGCGAAAGAAGCCGCAAGG + Intergenic
1171371729 20:24666727-24666749 TGGTGGAAATTGAAGCGGCAGGG - Intergenic
1171564190 20:26163273-26163295 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1172007325 20:31826463-31826485 TGGGGGAGAGAGGAGAGGCAAGG + Intronic
1172047313 20:32089644-32089666 TGGGGGTGAGAGGAGCTGCAAGG - Intronic
1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG + Exonic
1172479027 20:35260203-35260225 AGGGGGAGACAGAGGGAGCAGGG - Intronic
1173423379 20:42922732-42922754 TGGGGCAGATGGAAGCAGCAGGG - Intronic
1173970111 20:47146075-47146097 TGGGGGAGAGAGAGGTGGCAAGG + Intronic
1174056636 20:47802732-47802754 TCGGGGAGACAGAAGCTGCCTGG - Intergenic
1174193380 20:48756063-48756085 TGGGGAACAGAGCAGCGGCAAGG + Intronic
1175123351 20:56733978-56734000 TGGAGGAGCCAGAAACGCCAGGG - Intergenic
1175286111 20:57837899-57837921 TGGGTGAGAGGGAAGCGGGATGG + Intergenic
1175421260 20:58835390-58835412 TGGGGGAGACAGATGAATCATGG - Intergenic
1175956732 20:62614471-62614493 CGGAGGAGGCAGAAGCAGCAGGG + Intergenic
1176071812 20:63230881-63230903 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1176714636 21:10340605-10340627 TCCGGGAGACAGAAGGGGAATGG + Intergenic
1177264483 21:18765115-18765137 TGGGGGAGCCAGAAGAGAGATGG - Intergenic
1177339526 21:19782149-19782171 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1177837067 21:26196444-26196466 TGGGGGAGAGAGAAGCAGAGGGG - Intergenic
1178195815 21:30344281-30344303 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1178438671 21:32581278-32581300 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1178843593 21:36156862-36156884 TGGGGGAGAGAGACTGGGCAGGG - Intronic
1179342283 21:40523573-40523595 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1180930439 22:19586914-19586936 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1181531777 22:23521389-23521411 TGGGGGAGCCTGGGGCGGCAAGG + Intergenic
1181593036 22:23896316-23896338 TGGGGGAGACATGGGGGGCATGG + Intronic
1182516457 22:30861824-30861846 AGTGGGAGATAGAAGCGGCGAGG - Intronic
1182520315 22:30881211-30881233 GGGGGTAGGCAGAAGGGGCAGGG + Intronic
1182548737 22:31090100-31090122 GGGGCCAGACAGAAGCTGCAAGG - Exonic
1182719591 22:32386610-32386632 TGGGAGAGGCAGATGTGGCATGG - Intergenic
949758330 3:7439489-7439511 GGCGGAAGACAGAAGCAGCATGG - Intronic
950004730 3:9684464-9684486 TGGGGAAGACAGAAGCTGGTGGG + Intronic
950080760 3:10220419-10220441 TGGGGGAGAGAAAAGAGGAAAGG - Intronic
952580259 3:34824564-34824586 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
952860492 3:37808390-37808412 TGGGGGAGAAAGATGCAGGATGG + Intronic
953088387 3:39697469-39697491 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
954574052 3:51665158-51665180 TGGGGGATACAGAGGGGGCGGGG - Exonic
954795254 3:53158101-53158123 TGGAGGAGGCAGAGGTGGCAGGG + Intronic
955700897 3:61680907-61680929 TGTGGGAGACAGGAGCTGTATGG + Intronic
958663712 3:97106515-97106537 TGGGGAAGCCAGAAGGGGGATGG - Intronic
960950123 3:122993775-122993797 TGGGGGAGGCAGGAGCGGGAGGG - Intronic
961077049 3:123992068-123992090 CGGGGGTGACAGCAGCGGCGGGG + Intronic
961307527 3:125969232-125969254 CGGGGGTGACAGCAGCGGCGGGG - Exonic
961393183 3:126568826-126568848 TGGGGACCACAGAGGCGGCAGGG + Intergenic
961542199 3:127607602-127607624 TGAGGGAGACAGACAGGGCATGG - Intronic
961890500 3:130126774-130126796 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
962095098 3:132285166-132285188 TGGGGGAGCCAGAAGGGAGATGG + Intronic
962260009 3:133896030-133896052 TGGGGAAGACAGACGCAGCGGGG - Intergenic
962288058 3:134105228-134105250 TGGAGGACACAGAAGCAACAAGG - Intronic
962867316 3:139458420-139458442 TGGGGCAGACAGTAAGGGCAGGG - Intronic
962902377 3:139772578-139772600 TGGGGGACAGAGAAGCAACAAGG + Intergenic
963433355 3:145237178-145237200 TGGGGGAGAGAAAAGAGTCAGGG - Intergenic
964155692 3:153582451-153582473 TGGGTGAGACAGAAGGGGAATGG - Intergenic
964183008 3:153910402-153910424 TGGGGGAAAAAGAAGCCCCAGGG + Intergenic
965321020 3:167251168-167251190 TGGGGGAGCCAGAAGGGAGATGG - Intronic
966268037 3:178070415-178070437 TGGGGGAAGCAGAATTGGCAAGG + Intergenic
969056031 4:4403373-4403395 TCCAGAAGACAGAAGCGGCAGGG - Intronic
969752119 4:9119346-9119368 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
970033328 4:11702442-11702464 TGTGGGAGACAGAAGATGAAGGG - Intergenic
970054648 4:11957219-11957241 TGGGGGAGACAGAAGGGAGATGG + Intergenic
970542510 4:17094209-17094231 TGGGAGAGAGAGAAGGAGCAAGG + Intergenic
971618803 4:28828287-28828309 TGGGGGAGAGAGGAGCCGCGGGG - Intergenic
971940762 4:33212403-33212425 TTTGGGAGGCAGAAGTGGCAGGG + Intergenic
971986915 4:33837988-33838010 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
972749085 4:41970693-41970715 TGGGGGAGGCTGAAGTGGGAAGG + Intergenic
973057446 4:45678812-45678834 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
973686193 4:53372299-53372321 TGGGGAAGACAGAAAAGTCAAGG + Intergenic
973756911 4:54083903-54083925 TGCAGGAGACAGAAGCAGGAAGG - Intronic
974012277 4:56617832-56617854 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
974250097 4:59374902-59374924 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
974260343 4:59518170-59518192 TAGAGGGGACAGAGGCGGCAGGG + Intergenic
974993970 4:69129407-69129429 TGGGGGAGCCAGAAAGGGGACGG - Intronic
975662844 4:76704783-76704805 TGGAGGGGACAGAAGTGGAAGGG + Intronic
975779643 4:77824782-77824804 TGGGAGAGACAGAGGAGGGAGGG - Intergenic
976070635 4:81236081-81236103 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
978703398 4:111675635-111675657 TGGGGAGGACAGAAGCGGGAGGG - Intergenic
978995273 4:115143701-115143723 TGGTGGAGACAGTGGCTGCAGGG - Intergenic
980085653 4:128387471-128387493 TGGGGGACACAGTAGCAGCATGG + Intergenic
980088940 4:128421371-128421393 TGGTGGAAACAGAGGCAGCAAGG + Intergenic
981761069 4:148195543-148195565 TGGGGGAGACATAATAGACAAGG + Intronic
982033502 4:151324592-151324614 TTGGGTACACAAAAGCGGCACGG - Intronic
982315111 4:154023985-154024007 TGGGGGAGCCAGAAGAGAGATGG - Intergenic
983145961 4:164215215-164215237 TGGGGGAGCCAGAAGAGAGATGG + Intronic
983409396 4:167377766-167377788 TGGGAGATGGAGAAGCGGCATGG + Intergenic
984271896 4:177557716-177557738 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
985212801 4:187613269-187613291 TTGGGGAGACGGCAGCGCCAGGG + Intergenic
986484018 5:8217288-8217310 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
986598542 5:9448446-9448468 TGGGGTAGGCAGAAGGGGCGGGG - Intronic
988038103 5:25853472-25853494 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
988516766 5:31911861-31911883 TGTGAGTGACAGAGGCGGCAAGG - Intronic
990698236 5:58446574-58446596 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
990792351 5:59496099-59496121 TGGGGGAGCCAGAAGGGAGATGG + Intronic
991937703 5:71818139-71818161 TGTGGGAGGCAGAAGAGGTAGGG + Intergenic
991976329 5:72186824-72186846 TGGGGGAGACAAAAGAAGAAGGG + Intronic
992093648 5:73340611-73340633 TGGGGGAGGCAGAAGGGGGATGG - Intergenic
992268744 5:75044306-75044328 TGGGGCAGAAAGAAGAGGAATGG - Intergenic
994661651 5:102661236-102661258 TGGGGAGGCCAGAAGCGGGATGG - Intergenic
997474161 5:134133145-134133167 TGGGGGAGACAGAGGGGCAAAGG + Intronic
998114774 5:139528071-139528093 GTTGGGAGACAGAAGCTGCATGG - Intronic
998370244 5:141656121-141656143 TGGGGCAGTCAGAAAGGGCAGGG + Intronic
999793388 5:154964736-154964758 TGGGGGAGATAGAAGGGAAATGG + Intronic
1001065559 5:168532621-168532643 AGGGGAAGACAGAAGCAGCTGGG + Intergenic
1001940118 5:175734337-175734359 TGGGGGAGACAGAAGGGAGATGG - Intergenic
1002271346 5:178074533-178074555 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1002812073 6:640259-640281 TGGGAGAGACAGAAGGGGTGCGG + Intronic
1002842772 6:920794-920816 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1003394785 6:5743716-5743738 TGGGGGAGAAAGAAGATGAATGG + Intronic
1003426173 6:5999679-5999701 GGAGGGAGACAGAAGGGGCGAGG - Intronic
1003487841 6:6595197-6595219 AGGGGGAGAAAGAAGAGGAAGGG + Intronic
1003499783 6:6694838-6694860 TGGGGGAGCCAGAAGGGAGACGG + Intergenic
1003533388 6:6955960-6955982 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1004027307 6:11831705-11831727 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1004683334 6:17917956-17917978 AGGGGGAGAAAGAACCAGCAGGG - Intronic
1004953621 6:20702502-20702524 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1005794758 6:29347960-29347982 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
1005969468 6:30749876-30749898 TGGCGGAGGCAGAATGGGCAGGG + Intergenic
1006208931 6:32376045-32376067 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1006388221 6:33744077-33744099 TGGGGGAGGCAGAGGCTGCGAGG + Intronic
1006450477 6:34103121-34103143 ATGGGGAGACAGAGGTGGCATGG - Intronic
1006937040 6:37725769-37725791 TGGAGGCCACACAAGCGGCAGGG + Intergenic
1007394000 6:41566931-41566953 TGGGAGAGACAGCAGGGCCATGG - Intronic
1007655053 6:43446723-43446745 TGTGGGAGACTGAAGCGGGCTGG - Intronic
1007807985 6:44465027-44465049 TGGGGGAAACAGAATCATCAGGG + Intergenic
1008730865 6:54481193-54481215 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1009942404 6:70304539-70304561 TGGGGGAGGCAGAAACTGAAAGG - Intergenic
1011121470 6:83958416-83958438 TTGGAGAGACAGGAGCTGCATGG + Intronic
1012179591 6:96135643-96135665 CGGGGGAGAAAGAAGTGGGAGGG + Intronic
1012440198 6:99255180-99255202 TGGGGGAGGCAGAAGGGAGACGG - Intergenic
1015431701 6:133138394-133138416 TGGGAGAGAGAGAAGGGGAAAGG - Intergenic
1016211753 6:141544458-141544480 TGGGGAAAACAGGAGGGGCAGGG + Intergenic
1016557254 6:145352804-145352826 TGAGGAAGACAGAAGCTGGATGG + Intergenic
1016783528 6:147986099-147986121 TGGGGAGGACAGAAGTGGGATGG - Intergenic
1019556185 7:1632726-1632748 GGGGGGAGGCAGAAGAGGCAAGG - Intergenic
1020014010 7:4820676-4820698 TGGGGGAGGCAGAGCCGGCCAGG - Intronic
1020085672 7:5308955-5308977 TGGGGGAGAGAGGAGGGGCTTGG + Intronic
1020120040 7:5497984-5498006 TGGGGGAGAAAGTGGAGGCAGGG - Intronic
1021202975 7:17746261-17746283 TGGGGGGGAGAGAAGGGGAAAGG - Intergenic
1021989941 7:26131413-26131435 TGAGGGAAACAGAAGGGGAATGG + Intergenic
1022205505 7:28159644-28159666 TGGTGGAGAAAGTAGAGGCAGGG + Intronic
1022340411 7:29462599-29462621 TGGGGGAAGCATAAGCTGCATGG - Intronic
1022692015 7:32665423-32665445 TGGGGAAGACAGATGGGGCAAGG + Intergenic
1022820610 7:33956542-33956564 AAGGGGAGACAGGAGAGGCAGGG - Intronic
1022919684 7:34999976-34999998 TGGGGAAGACAGATGGGGCAAGG + Intronic
1023366109 7:39464957-39464979 TGGGGGAGACAGGTGGGGGAAGG - Intronic
1024203063 7:47126034-47126056 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1024268132 7:47622097-47622119 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1025208638 7:57008209-57008231 TGGGGGAGAGAGGAGGGGCTTGG - Intergenic
1025663309 7:63568669-63568691 TGGGGGAGAGAGGAGGGGCTTGG + Intergenic
1026986966 7:74560901-74560923 TGGTGGAGACAGAAGTGGATGGG - Intronic
1027189979 7:75990947-75990969 TGGGGATGACAGAAGAGCCAAGG - Intronic
1029458468 7:100682675-100682697 TGGGGGCGGCAGCAGCGGCCTGG - Exonic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1030152459 7:106420886-106420908 TCTGTGAGACAGAAGCAGCACGG + Intergenic
1030746563 7:113173039-113173061 TGGGGAAGCCAGAAGGGGAATGG - Intergenic
1030794414 7:113770292-113770314 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1031119029 7:117699532-117699554 TGGGGGAGATAGAAAGGACAGGG - Intronic
1031483001 7:122300504-122300526 TGGTGGAGTCCGAAGCGGCGAGG + Intergenic
1031870256 7:127083277-127083299 TGAGGGAGAAGGAAGAGGCAGGG - Intronic
1032544993 7:132734370-132734392 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1034099272 7:148437308-148437330 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1034648998 7:152674968-152674990 TGGCTGTGACAGAAACGGCATGG + Intronic
1035111228 7:156483713-156483735 AGGGGGAGACAGGAGGGGGAGGG + Intergenic
1035253797 7:157613644-157613666 TGTGGGAGACGGAGGCGGCGGGG - Intronic
1035260398 7:157658338-157658360 TGCGGGAGACAGAAGGCACAGGG + Intronic
1035352517 7:158256556-158256578 TGGAGGAGACAGAAGCTGGCGGG + Intronic
1035725951 8:1824697-1824719 TGGGGGGGACAGCTGCGGCGCGG - Intronic
1036021441 8:4851494-4851516 TAGGGGAGTGAGAAGCGCCATGG - Intronic
1036635819 8:10548868-10548890 TGGGGGAGACAGACTAGGAATGG + Intronic
1036649780 8:10634887-10634909 TTGGGGAGACTGGAGGGGCAAGG - Intronic
1036854201 8:12228398-12228420 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1037238194 8:16746123-16746145 TGGTGGGGACAGAAGCACCAGGG - Intergenic
1037314953 8:17592077-17592099 TGGGGGAGAGGGAGGAGGCATGG - Intronic
1037577107 8:20217400-20217422 TGGGGAAGAGAGAAGTGGTAAGG - Intronic
1037635781 8:20700230-20700252 TGGGGGAGACAGCAGGAGCTAGG + Intergenic
1037876826 8:22552521-22552543 GGGGGGCGACACAAGGGGCAGGG + Intronic
1038451209 8:27640033-27640055 GGGGAGGGACAGAAGAGGCATGG + Intronic
1038455876 8:27671481-27671503 TGGGGGAGCCCAAAGCTGCAGGG - Exonic
1038862381 8:31401625-31401647 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1039086315 8:33783604-33783626 TGGGGGAGCCAGAAGGGGGATGG + Intergenic
1041312353 8:56529762-56529784 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1041934719 8:63322440-63322462 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1042598198 8:70471749-70471771 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1043238457 8:77899699-77899721 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1044085340 8:87936428-87936450 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1044730587 8:95225812-95225834 TGGGAGGGACAGAAGGGGCCAGG - Intergenic
1045300791 8:100908367-100908389 TGGAGGGGGCAGAGGCGGCAGGG + Intergenic
1045861522 8:106819235-106819257 TGGGGGAGCCAGAAGGGAGACGG - Intergenic
1045938499 8:107710982-107711004 TGGGGGAGTCAGAAGGGAGATGG + Intergenic
1046138915 8:110064051-110064073 TGGGGGAGCCAGAAGGGAAATGG - Intergenic
1046870163 8:119197120-119197142 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1047202103 8:122775977-122775999 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1047203695 8:122786700-122786722 GGGGGGAGGCAGAAGGGGAATGG - Intronic
1047231627 8:123002536-123002558 TGGGGGACACAGAATACGCAAGG - Intergenic
1047522465 8:125605636-125605658 TTAGGGAGACAGAAGCTACAGGG + Intergenic
1047903101 8:129445015-129445037 TGGAGGAGACAGGAGGGGCCAGG + Intergenic
1049480689 8:142821059-142821081 TGGCTGAGACACAAGGGGCAGGG + Intergenic
1049833634 8:144718667-144718689 TGGGGGAGACAGAACCTGAGCGG + Intergenic
1049840569 8:144768578-144768600 TGAGGGAGAAAGAAGGGGAAAGG - Intergenic
1050043620 9:1521102-1521124 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1050847831 9:10245749-10245771 GGGGGAAGACAGATGTGGCAGGG + Intronic
1052025810 9:23571908-23571930 TGGGCTAGACAGAAGAGGTACGG + Intergenic
1052830245 9:33209367-33209389 TGGGGAAGACAGAAGGGATATGG + Intergenic
1053514770 9:38721578-38721600 TTGGGAAGACAGAGGCCGCATGG + Intergenic
1055141639 9:72883210-72883232 TGGGGGAGAAAGAAGGGGAAAGG - Intergenic
1056004606 9:82255544-82255566 TGAGGGAGACAGAACAGGAAAGG + Intergenic
1057493346 9:95540090-95540112 TGGAGAAGAGAGAAGCGGAAGGG - Intergenic
1057705154 9:97390548-97390570 TGGAGGAGACAGAAGCCCCGGGG + Intergenic
1058311933 9:103514845-103514867 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1058584468 9:106492243-106492265 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
1058836179 9:108860205-108860227 TGGGGGATACAGGAGGGTCAAGG + Intergenic
1059042603 9:110830565-110830587 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1059336538 9:113572595-113572617 TGGGGCAGACAGATAAGGCAAGG + Intronic
1059930469 9:119255403-119255425 TGGGGGAGCCAGAGGTGGGAGGG + Intronic
1060105378 9:120869799-120869821 TGGAGGAGGCAGGAGAGGCAGGG + Intronic
1060158097 9:121334308-121334330 TGTGGGAAACAGAGGCAGCAGGG - Intergenic
1060792708 9:126496968-126496990 TGGAGGAGACAGGAGGGGCTGGG + Intronic
1060844804 9:126827621-126827643 TGGTGGAGTCAGAAGCTCCATGG - Intronic
1061625316 9:131837870-131837892 TGGGGGAGACAGCAGGAGCTGGG - Intergenic
1062090661 9:134677073-134677095 GGGGAGACACAGAAGAGGCAGGG + Intronic
1062158389 9:135066677-135066699 GGGGGGAGACACATGCAGCAGGG + Intergenic
1062158507 9:135067153-135067175 CGGGGAAGACACACGCGGCAGGG + Intergenic
1062158580 9:135067447-135067469 TGGGGAAGACACACGCGGCAGGG + Intergenic
1062374114 9:136254340-136254362 AGGGGGTGTCAGAAGCGGCATGG - Intergenic
1062385080 9:136306090-136306112 TGGGGTGGACAGGAGCAGCAAGG + Intronic
1185803289 X:3032598-3032620 AGGGAGAGACAGAAGAGGGAGGG + Intronic
1185837749 X:3360948-3360970 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1192157397 X:68756874-68756896 AGAGGGAGAGAGAAGCAGCAGGG + Intergenic
1192219555 X:69188158-69188180 TTAGGGAGACTGAAGAGGCAGGG - Intergenic
1193702468 X:84779913-84779935 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1195310622 X:103629088-103629110 TGGGGTTGACAGAATCGGGATGG + Intronic
1196242066 X:113353424-113353446 TGGGGGAGCCAGAAGGGGGATGG - Intergenic
1198388545 X:136150354-136150376 CGGGGGAGAAAGGAGAGGCATGG - Intronic
1198524862 X:137490981-137491003 GGGGGGATACAGAAGAGGCAAGG - Intergenic
1198964274 X:142210757-142210779 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1199623613 X:149720861-149720883 TGAGGGAGATAGAAGTGGTAAGG - Intergenic
1199683019 X:150240426-150240448 TGGGGGACACAGCAGGAGCAAGG + Intergenic
1199713788 X:150491608-150491630 TGGGGAAGCCAGAAGCTGAATGG + Intronic
1199799035 X:151231110-151231132 TGGGCCAGATAGAAGAGGCAGGG + Intergenic
1200955187 Y:8937524-8937546 TGGGGGAGCCAGAAGGGAGATGG - Intergenic