ID: 1147970901

View in Genome Browser
Species Human (GRCh38)
Location 17:44218869-44218891
Sequence CGGCGAAGGGAGCCCGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 232}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147970901_1147970909 -4 Left 1147970901 17:44218869-44218891 CCCCTCCCGGGCTCCCTTCGCCG 0: 1
1: 0
2: 2
3: 25
4: 232
Right 1147970909 17:44218888-44218910 GCCGTCCCCGCCCGCACAGGCGG 0: 1
1: 0
2: 3
3: 6
4: 97
1147970901_1147970918 18 Left 1147970901 17:44218869-44218891 CCCCTCCCGGGCTCCCTTCGCCG 0: 1
1: 0
2: 2
3: 25
4: 232
Right 1147970918 17:44218910-44218932 GGCAAGCAGCCGGAGAGAAGCGG 0: 1
1: 0
2: 2
3: 27
4: 286
1147970901_1147970908 -7 Left 1147970901 17:44218869-44218891 CCCCTCCCGGGCTCCCTTCGCCG 0: 1
1: 0
2: 2
3: 25
4: 232
Right 1147970908 17:44218885-44218907 TTCGCCGTCCCCGCCCGCACAGG 0: 1
1: 0
2: 1
3: 2
4: 68
1147970901_1147970917 8 Left 1147970901 17:44218869-44218891 CCCCTCCCGGGCTCCCTTCGCCG 0: 1
1: 0
2: 2
3: 25
4: 232
Right 1147970917 17:44218900-44218922 CGCACAGGCGGGCAAGCAGCCGG 0: 1
1: 0
2: 1
3: 7
4: 129
1147970901_1147970911 -3 Left 1147970901 17:44218869-44218891 CCCCTCCCGGGCTCCCTTCGCCG 0: 1
1: 0
2: 2
3: 25
4: 232
Right 1147970911 17:44218889-44218911 CCGTCCCCGCCCGCACAGGCGGG 0: 1
1: 0
2: 0
3: 14
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147970901 Original CRISPR CGGCGAAGGGAGCCCGGGAG GGG (reversed) Intronic
900992218 1:6103320-6103342 AGGAGAAGGGAGCCCTGGCGAGG + Exonic
901112579 1:6810243-6810265 TGGCCAAGGGAGCCTGGAAGTGG - Intronic
901556930 1:10039211-10039233 ATGAGAAGGGACCCCGGGAGAGG + Intronic
901844038 1:11971061-11971083 AGGAGTAGGGAGCCTGGGAGGGG + Intronic
902498065 1:16888878-16888900 CTGGGAAAGAAGCCCGGGAGCGG - Intronic
903420862 1:23217221-23217243 CGGGGAACTGAGGCCGGGAGCGG - Intergenic
904299824 1:29547016-29547038 GGGCAAACTGAGCCCGGGAGAGG - Intergenic
904724909 1:32539732-32539754 CGGCGGGAGGCGCCCGGGAGGGG + Intronic
905214564 1:36397729-36397751 CGGTGCAGGGAGCCCCGGGGCGG - Intronic
906866828 1:49430275-49430297 CAGAGAAGGGAGCCTGGGACAGG - Intronic
907850548 1:58250679-58250701 CGGAGAAGGGAGTCTGCGAGTGG - Intronic
911041560 1:93594884-93594906 CTGAGAAAGGAGCCGGGGAGAGG - Intronic
912716983 1:111989925-111989947 CGGGAAAGGGACCTCGGGAGAGG - Intergenic
913644735 1:120845127-120845149 CGGTGAAAGAAGCCGGGGAGCGG + Intergenic
914081992 1:144418456-144418478 CGGGGAAAGAAGCCGGGGAGCGG - Intergenic
914095467 1:144540649-144540671 CGGGGAAAGAAGCCGGGGAGCGG + Intergenic
914099112 1:144568373-144568395 CGGGGAAAGAAGCCGGGGAGCGG + Intergenic
914176899 1:145286956-145286978 CGGGGAAAGAAGCCGGGGAGCGG - Intergenic
914299875 1:146369291-146369313 CGGGGAAAGAAGCCGGGGAGCGG - Intergenic
914303058 1:146393244-146393266 CGGGGAAAGAAGCCGGGGAGCGG - Intergenic
914313484 1:146487436-146487458 CGGGGAAAGAAGCCGGGGAGCGG + Intergenic
914500864 1:148245945-148245967 CGGGGAAAGAAGCCGGGGAGCGG - Intergenic
914531627 1:148528448-148528470 CGGGGAAAGAAGCCGGGGAGCGG - Intergenic
914636764 1:149559281-149559303 CGGGGAAAGAAGCCGGGGAGCGG + Intergenic
914852793 1:151327346-151327368 CGGCCAATGGAACCCGGGAGCGG - Exonic
920365278 1:205444983-205445005 GTGCTAAGGGAGCCGGGGAGGGG - Intronic
920418411 1:205813464-205813486 CGGCGCAGCGGGCCCGGGGGCGG - Intronic
920920418 1:210293315-210293337 CGGGGAAGGGGGCCAGGAAGAGG - Intergenic
923279398 1:232428217-232428239 ATGTGAAGGGAGCCTGGGAGAGG - Intronic
924242862 1:242057235-242057257 CGGGGCAGGGAGCCCAGGGGCGG - Intergenic
1062860237 10:804962-804984 GGGAGAGAGGAGCCCGGGAGAGG - Intergenic
1063201080 10:3785658-3785680 CGGGGAAGAGAGACCGGGACTGG - Intergenic
1065189453 10:23196634-23196656 CGGGGGAGGGAGCCCTGGAGTGG + Intergenic
1066197470 10:33115312-33115334 GGGGGAAGAGAGGCCGGGAGTGG + Intergenic
1067553104 10:47248764-47248786 TGGCAAAGTGAGCCAGGGAGAGG + Intergenic
1070967037 10:80536133-80536155 CGCGGATGGCAGCCCGGGAGCGG - Intergenic
1072349697 10:94545019-94545041 TGGGAAAGGGAGCCCTGGAGAGG + Intronic
1073486054 10:103819840-103819862 GGGAGATGGGAGCCCAGGAGGGG + Intronic
1075522879 10:123154621-123154643 GGGCGACGGGACCCCGGGAGAGG + Intronic
1076442155 10:130487401-130487423 CAGCGAAGGGAGATGGGGAGGGG - Intergenic
1077074888 11:695840-695862 CGGCGAGGTGAGCTCGGGCGGGG + Exonic
1077307239 11:1873883-1873905 CAGAGCAGGGAGCCCGGCAGAGG + Intronic
1077307253 11:1873917-1873939 CGGAGGAGGGAGGCCGGCAGAGG + Intronic
1082059482 11:47848292-47848314 CGGCGGCGGGAGCCCTGGAACGG - Exonic
1083187675 11:61026983-61027005 GGGGGAAGGGAGCCAGGGAGGGG - Intergenic
1083618048 11:64036034-64036056 CGCCCAGGGGGGCCCGGGAGAGG - Intronic
1084180562 11:67443583-67443605 CGGCGCCGGGGGGCCGGGAGCGG + Intronic
1084268909 11:68018910-68018932 CGGAGAAGGGTGACCGGAAGGGG - Intronic
1084516737 11:69641729-69641751 GGGAGAAGGGGGTCCGGGAGGGG + Intronic
1088522075 11:110711676-110711698 CGGCGATGTCTGCCCGGGAGCGG - Intronic
1089335743 11:117722381-117722403 GGGGGAGGGGAGCCAGGGAGAGG + Intronic
1089713637 11:120336200-120336222 CGGCGGAGGGATCCCGGGTGAGG + Intergenic
1089743018 11:120598065-120598087 AGGCCAAGGGAGCGCAGGAGGGG - Intronic
1090664461 11:128905499-128905521 AGGGGAGGGGAGCCTGGGAGAGG - Intronic
1091452490 12:581964-581986 CAGTGCAGGGAGCCAGGGAGAGG - Intronic
1092218965 12:6700298-6700320 CGGCGAAGGGACCCCGAGGCAGG + Exonic
1096191679 12:49623729-49623751 GAGGGAAGAGAGCCCGGGAGGGG + Intronic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096782836 12:54000813-54000835 CCGTGCAGGGAGCGCGGGAGAGG + Intronic
1097990373 12:65826013-65826035 CGCCGGAGGGAGCCCGGGGCAGG + Intronic
1099304560 12:80937582-80937604 CGGGGAAGGGAGGAGGGGAGAGG + Intronic
1100591617 12:96035310-96035332 AGGGGCAGGGAGCCCGGGAGAGG + Intronic
1101604837 12:106240149-106240171 TGGTGAAGGACGCCCGGGAGCGG - Exonic
1101838003 12:108308540-108308562 CAGTGATGGGAGCCCTGGAGGGG - Intronic
1102956711 12:117063641-117063663 CAGTGCAGGGAGCCCTGGAGCGG - Intronic
1103500676 12:121399747-121399769 CGGGGAGGGGAGCGCGGGAAGGG - Intronic
1103917582 12:124384016-124384038 AGGCGGAGGGAGCCCCAGAGAGG + Intronic
1105064013 12:133181379-133181401 CGGCCAAGGGCCACCGGGAGGGG - Intronic
1105768020 13:23579682-23579704 CGGCGAAGGGAACCCCCGAAGGG + Intronic
1106226493 13:27790593-27790615 CGGAGCTGGGAGCCCGCGAGTGG - Intergenic
1106776636 13:33016236-33016258 GGGCGAGGGGTGCCCGGGAGGGG - Intergenic
1108269503 13:48745848-48745870 CAGAGAAGGGAGCCCAGAAGAGG + Intergenic
1113881032 13:113626473-113626495 CGGGGAAGGGAGCGCGGGGAAGG - Intronic
1116704397 14:48278571-48278593 CAGCGAAGGGAGACGGGGTGCGG + Intergenic
1117875887 14:60249611-60249633 CGGCGGCGGCAGCCGGGGAGGGG - Intronic
1120809973 14:88793001-88793023 GGGCGGAGTGAGCGCGGGAGGGG - Intergenic
1121774972 14:96584445-96584467 CGGCTGAGGGAGCCCCGGAGCGG + Intergenic
1122516859 14:102314850-102314872 CCGCGGAGGGAGCCGGGCAGGGG + Intergenic
1123115267 14:105891561-105891583 CGGTGGAGGGTGCCCTGGAGGGG + Intergenic
1127674837 15:61229002-61229024 GGGCGGCGGGAGCCCGGGCGCGG - Intronic
1130137485 15:81193676-81193698 AGGGGAAGAGAGCCGGGGAGCGG + Intronic
1131832320 15:96361550-96361572 CGGCGGCGGCAGCCCGGGAGTGG + Intergenic
1132682862 16:1150771-1150793 GGCCGGAGGGAGCCGGGGAGCGG - Intergenic
1132874467 16:2130194-2130216 CGGCTCAGGGACCCCGGGTGAGG + Intronic
1133027596 16:2995477-2995499 CTGGGAAGGGAGGCAGGGAGAGG - Intergenic
1133097606 16:3458105-3458127 AGGCGAAGGGAGCCGGGAAGTGG - Intronic
1133221717 16:4321769-4321791 CCAAGAAGGGAGCCTGGGAGTGG - Intronic
1134553412 16:15149027-15149049 CGGCTCAGGGACCCCGGGTGAGG + Intergenic
1134656102 16:15949594-15949616 CGGCGCAGGGAGCCGGGGCCGGG - Exonic
1135821715 16:25691874-25691896 CTGCGAAGGGGGCGGGGGAGCGG - Intergenic
1138584322 16:57960456-57960478 CAGGGAGGGGAGCTCGGGAGGGG - Intronic
1140442758 16:74999698-74999720 CCGGGAAGGGGCCCCGGGAGCGG - Exonic
1141409483 16:83822690-83822712 AGACAAAGGGAGCCCGGGAGGGG - Intergenic
1141446629 16:84062962-84062984 CGGCGTAGGAAGCCTGGGAGGGG + Intronic
1141639795 16:85334466-85334488 CAGAGAAGGGATGCCGGGAGAGG - Intergenic
1142066526 16:88065973-88065995 TGGGGATGGGAGCACGGGAGAGG + Intronic
1144222733 17:13114717-13114739 GGGAGACGGGAGCCCAGGAGCGG - Intergenic
1144659368 17:17058367-17058389 AGGAGTAGGGACCCCGGGAGGGG + Intronic
1145246472 17:21273029-21273051 CGGGGAAGGCTGCCCTGGAGAGG + Intergenic
1146123250 17:30213006-30213028 AGGCGAAGGGACTCCGGGACAGG - Intronic
1146123733 17:30216278-30216300 AGGAGAAGGGAGCGGGGGAGGGG + Intronic
1146339622 17:32007703-32007725 CGGCGAGGGGAGCCCCCGATGGG - Intergenic
1146566807 17:33920553-33920575 CAGAGAAGGGAGACAGGGAGGGG + Intronic
1147386202 17:40083826-40083848 CGGCGAAAGAAGCCCTGGGGTGG - Exonic
1147970901 17:44218869-44218891 CGGCGAAGGGAGCCCGGGAGGGG - Intronic
1148437314 17:47694389-47694411 CGGGGAAGGGGCTCCGGGAGTGG - Intronic
1148556555 17:48582093-48582115 CGGCGGAGGGTGGCTGGGAGGGG - Intronic
1150561867 17:66302138-66302160 GGGAGAAGGAAGACCGGGAGAGG + Intergenic
1152675295 17:81637019-81637041 CGGCGTAGGGAGGCCGGGGCCGG - Exonic
1152702556 17:81826197-81826219 AGGCAAAGGGAGCCCCGGAAGGG - Exonic
1156036667 18:32772299-32772321 CGGCGGAGGGAGCGCGAGGGAGG - Intronic
1157529585 18:48409676-48409698 CGGCGGGGGGCGCCCGGGACTGG + Intronic
1160246473 18:77163994-77164016 CGGCTAGGTGAGGCCGGGAGGGG + Intergenic
1160966466 19:1749002-1749024 CGCCGGAGGGTGCGCGGGAGGGG - Intergenic
1161491587 19:4565049-4565071 GGGGGGAGGGAGCCGGGGAGGGG + Intergenic
1162127172 19:8505964-8505986 CGGAGAAGGGAGCCCGGACCAGG + Intergenic
1162591888 19:11597498-11597520 CGGAGACGCGAGCCCGGGTGGGG - Exonic
1162747592 19:12807328-12807350 CGGTGAGGGGTCCCCGGGAGGGG + Exonic
1163364873 19:16870256-16870278 CGGCCAGGGGAGCCTGGGCGAGG - Intronic
1164594970 19:29526543-29526565 TGGCGGCGGGGGCCCGGGAGCGG - Exonic
1164643557 19:29843264-29843286 CGGCGGAGGAGGCCTGGGAGGGG - Intergenic
1165065490 19:33225860-33225882 GGGCGGCGGGGGCCCGGGAGGGG + Intergenic
1166306849 19:41940237-41940259 GGGCGCGGGGAGCCCGGGGGCGG + Intergenic
1166329469 19:42069846-42069868 GGGCGGGGAGAGCCCGGGAGTGG + Intronic
1167134539 19:47609013-47609035 CGGCGGCGGGGGCCCGGCAGCGG + Intronic
1167238689 19:48330498-48330520 CGGCGAGGGGGGCCGGGAAGGGG - Exonic
1167643827 19:50695391-50695413 CGGCGGAGGGGGCCGGGCAGGGG + Intronic
1167648692 19:50718726-50718748 AGGCGGAGGGAGGCGGGGAGGGG + Intronic
1167960977 19:53103677-53103699 AGGCGAAGGGACCGCGGGGGAGG + Intergenic
1168247002 19:55117481-55117503 CGGCGGCGGCTGCCCGGGAGCGG - Exonic
926174698 2:10580360-10580382 CGGGGCAGGGAGCGGGGGAGGGG - Intronic
927875962 2:26655304-26655326 AGGGGAAGGGAGCGAGGGAGGGG + Intergenic
930198450 2:48530638-48530660 AGGAGGAGGGAGTCCGGGAGCGG - Intronic
932328963 2:70886692-70886714 AGGCAATGGGAGCCGGGGAGTGG - Intergenic
932591464 2:73070631-73070653 CGGAGACCGGAGCCGGGGAGGGG - Intronic
933589914 2:84221040-84221062 CAGCGAAGGGAGACAGGGTGGGG + Intergenic
936985774 2:118310486-118310508 CGGGGAGGGGAGCCCGGGAGGGG - Intergenic
937308731 2:120888159-120888181 GGGAGAAGGGAGTCGGGGAGGGG + Intronic
941772706 2:169361878-169361900 GCGCGAAGGGATCCCGGGAGGGG + Intronic
942451052 2:176108087-176108109 CGGCGAGGGCCCCCCGGGAGAGG + Exonic
946153625 2:217792737-217792759 GGGCAAAGGGAGCCAGGGGGAGG - Intergenic
947754306 2:232550760-232550782 CGGGGAAGGGGCCCCGGGGGCGG - Intronic
947869996 2:233429749-233429771 CGGCAAAGGCAGGCCCGGAGGGG - Intronic
947918234 2:233848464-233848486 GGGCGGAGGGAGCCCGGGTGGGG + Intronic
948342432 2:237265124-237265146 AGGCGAGAGGAGCCCAGGAGCGG - Intergenic
1168933982 20:1647222-1647244 CAGGGAAGGGGGCCAGGGAGTGG - Intronic
1170948111 20:20910018-20910040 AGGAGAAGGGAAGCCGGGAGAGG + Intergenic
1171013544 20:21521657-21521679 CGTCGCAGGGAGCTCGGGATCGG - Intergenic
1172181674 20:33007628-33007650 CTGGGAAGGGACCCAGGGAGCGG - Exonic
1172692927 20:36803072-36803094 CAGGGAAGGGGGCCGGGGAGCGG - Exonic
1176086588 20:63298032-63298054 TGGGGAAGGGGGCCTGGGAGGGG - Intronic
1179572328 21:42285008-42285030 CAGCGAAGGGGGCTGGGGAGTGG + Intronic
1180002595 21:45002065-45002087 CTGAGAAGGGAGCTGGGGAGGGG + Intergenic
1180098647 21:45574147-45574169 CAGCGAGGAGAGCCCGGCAGAGG - Intergenic
1180622591 22:17171820-17171842 GGACGAAGGGAGCCCGCGGGCGG + Intergenic
1180625589 22:17191575-17191597 CGGGGCTGGGAGGCCGGGAGAGG - Intronic
1181473999 22:23157676-23157698 CGGCTAAGGGAGCTCAGGTGAGG - Intronic
1182282443 22:29225250-29225272 GGGCTGAGGGAGCCCTGGAGGGG + Intronic
1183535288 22:38397862-38397884 CGTCTAAGGGACCGCGGGAGGGG - Intronic
1183977299 22:41519983-41520005 GGCTGGAGGGAGCCCGGGAGCGG + Intronic
1184415476 22:44349569-44349591 CAGCGAATGGAGCCTGAGAGAGG - Intergenic
1185291574 22:50030265-50030287 CGCCGGCGGGAGCCGGGGAGCGG - Intronic
1185375566 22:50481437-50481459 CGGCGAAGGGAGCGGTGGAGGGG - Intergenic
950506300 3:13396975-13396997 CAGCGATGGGAGGCAGGGAGAGG - Intronic
952234859 3:31468602-31468624 CAGAGAAGGGAGCCTGGCAGGGG + Intergenic
953865134 3:46577126-46577148 CGGCGCCAGGTGCCCGGGAGAGG - Intronic
954152083 3:48662708-48662730 CGGCGGCAGGGGCCCGGGAGGGG - Exonic
956678083 3:71753885-71753907 CGGCTCGGGGAGCCCAGGAGGGG + Intronic
960057223 3:113284282-113284304 AGGCCAAGGTAGCCCGGGATGGG - Intronic
960963475 3:123088975-123088997 AGGGGAAGGGAGACTGGGAGTGG + Intronic
961322222 3:126083991-126084013 CGGGAGAGGGCGCCCGGGAGTGG - Intronic
961481358 3:127183051-127183073 CGCCTAAGGCAGCCCTGGAGAGG + Intergenic
963070700 3:141302925-141302947 AGGCGGGGGGAGCCCGGCAGGGG + Intergenic
964472972 3:157073754-157073776 AGTCGAAGGGAGCCTGGGAGAGG + Intergenic
966883343 3:184361821-184361843 CGGAGAGGGGCGCCCGGGAGGGG + Intronic
966924729 3:184636828-184636850 TGGGGAAGGGAGCCCTGAAGGGG + Intronic
967712729 3:192727639-192727661 AGGCGAAGGGGGCGGGGGAGCGG - Intronic
967839729 3:193995493-193995515 CGGTGAAGAGAGCTGGGGAGGGG - Intergenic
968123800 3:196144048-196144070 AGGCGAAGGGAGGCAGGGAGAGG - Intergenic
968511536 4:997813-997835 CAGCGAGGGGAGCCCGGGACAGG - Intronic
969021447 4:4142758-4142780 AGGAGAAGGGAGCGGGGGAGCGG - Intergenic
969297097 4:6276626-6276648 AGGGGAAGGGAGCTGGGGAGGGG - Intronic
969422892 4:7107600-7107622 CTGTGATGGGAGCCCGAGAGGGG + Intergenic
972266541 4:37465466-37465488 CGGCAAAGGGAGCCCCAGAGAGG + Intronic
973774251 4:54230668-54230690 CGGAGAAGGGTGCCGGGTAGGGG - Intronic
985518146 5:357576-357598 TGGGGAAGAGCGCCCGGGAGTGG + Intronic
985518246 5:358010-358032 TGGGGAAGAGCGCCCGGGAGTGG + Intronic
985518346 5:358444-358466 TGGGGAAGAGCGCCCGGGAGTGG + Intronic
985518429 5:358816-358838 TGGGGAAGAGCGCCCGGGAGTGG + Intronic
985518446 5:358878-358900 TGGGGAAGAGCGCCCGGGAGTGG + Intronic
985757473 5:1727568-1727590 CTGCCAAGGGAGCCCTAGAGGGG + Intergenic
991064772 5:62413113-62413135 TGGCCGAGGCAGCCCGGGAGTGG + Intronic
992093569 5:73340159-73340181 CAGCCAAGGGAGGCTGGGAGAGG - Intergenic
997585025 5:135038983-135039005 GGGCGAAGAGAGCCAGGGCGCGG + Intronic
997635100 5:135398986-135399008 CGGCCGCGGGTGCCCGGGAGCGG - Intronic
998383665 5:141743540-141743562 GGGCTGAGGGAGCCTGGGAGCGG - Intergenic
998957638 5:147453732-147453754 CCGCCGCGGGAGCCCGGGAGGGG - Intronic
1003946008 6:11076692-11076714 AGGAGTAGGGAGCCAGGGAGAGG - Intergenic
1004441980 6:15662732-15662754 CGGGGAAGGGAGCGAGGCAGGGG + Intronic
1005969174 6:30747897-30747919 AGGGGAAGGGAGCATGGGAGAGG + Intergenic
1006134502 6:31887660-31887682 CTGCCAAGGGAGCACGGGAGCGG + Intronic
1006298423 6:33180319-33180341 CGGCCAGGGGGGCCCTGGAGTGG + Exonic
1006491566 6:34392456-34392478 CGGCCAAGGGAAGCAGGGAGGGG + Exonic
1007652530 6:43432364-43432386 AGGCCAAGGGACCCCGGGAGTGG - Exonic
1007775810 6:44223749-44223771 CGGAGAAGGGACGCCGGGTGGGG + Exonic
1007970720 6:46049398-46049420 GGGAGAAGGGAGACAGGGAGAGG - Intronic
1009808720 6:68635029-68635051 AGGCGAAGGGAGCCGCGGGGTGG - Intergenic
1013514825 6:110875671-110875693 CGGGGAATGGAGGGCGGGAGCGG + Intronic
1014137789 6:117908080-117908102 CGGCGCAGGGAGCCCTGGAGTGG + Intronic
1015842233 6:137488409-137488431 TGGCGCAGGGGGCCCGGGGGCGG - Intergenic
1016590019 6:145734827-145734849 GGGCGAAGGGAGCCCCGGGCGGG + Intronic
1017024944 6:150173406-150173428 TGGGGAAGGGAGTCCAGGAGAGG - Intronic
1017282201 6:152637086-152637108 CGGGGCACGGAGCCGGGGAGGGG - Intronic
1017793618 6:157823021-157823043 CGACCAAGGGCGCCCGGGGGCGG + Intronic
1019472835 7:1230267-1230289 CGGGGAAGGGCGCGGGGGAGGGG + Intergenic
1020308870 7:6854787-6854809 AGGAGAAGGGAGCGGGGGAGCGG - Intergenic
1022449838 7:30504538-30504560 CGGCGTGGGTAGCGCGGGAGGGG + Intronic
1023000302 7:35801381-35801403 CGGCGAGGGGAGCCGGGATGGGG + Intronic
1023972285 7:45000226-45000248 CGGCGCCGGGAGCGCGGGGGCGG + Intronic
1024424237 7:49207283-49207305 CAGAGATGGGAGCCAGGGAGGGG + Intergenic
1026737791 7:72960084-72960106 AGGCCCAGGGAACCCGGGAGCGG - Exonic
1026788826 7:73318885-73318907 AGGCCCAGGGAACCCGGGAGCGG - Exonic
1027105943 7:75404984-75405006 AGGCCCAGGGAACCCGGGAGCGG + Exonic
1029591687 7:101511274-101511296 AGGCCAAGGGAGGCAGGGAGAGG - Intronic
1032016377 7:128382797-128382819 CAGAGAAGGGAGCCCAGGAAAGG + Intergenic
1032151776 7:129435040-129435062 CGCCGCAGGCAGCCTGGGAGGGG - Intronic
1032190483 7:129762653-129762675 GGGCGAAGGCGGCCCGGGTGCGG + Intergenic
1034540794 7:151756672-151756694 CGGCGCTGGGAGCCCTGGCGGGG - Intronic
1034830535 7:154304386-154304408 CGGTGCAGGGAGCCAGGCAGGGG + Intronic
1035747749 8:1974089-1974111 CGGGGAGGGGAGGCCGGCAGGGG + Intronic
1037260486 8:17002017-17002039 CGGCTAAGGGAGCCATGGAGGGG + Exonic
1037529122 8:19757013-19757035 CGGCGGAGGGAGGCCAGGCGCGG + Intronic
1038568754 8:28641718-28641740 CGGCGGAGGGGGTCGGGGAGGGG - Intronic
1042937094 8:74070379-74070401 TGGCAAAGGGAGGCCGGGCGCGG - Intergenic
1044698845 8:94948990-94949012 CGGCGAGGGGAGGCAGCGAGGGG + Intronic
1048873222 8:138815869-138815891 CTGAGAAGGGAGCAGGGGAGTGG - Intronic
1048981292 8:139704334-139704356 ACGCGGAGGGAGCCCGGGAGGGG + Intergenic
1049349279 8:142155348-142155370 CTGAGCAGGGAGCCTGGGAGGGG - Intergenic
1049623927 8:143611780-143611802 CGGCACAGGGCGCCCAGGAGAGG + Intergenic
1050418418 9:5437833-5437855 GGGCGAAAGGAGCCCGGGCCTGG - Exonic
1051780599 9:20684463-20684485 CGGCGAGGGGCAGCCGGGAGGGG + Intronic
1053050555 9:34958052-34958074 CGGCGACGGGCGCGCGGGCGTGG - Intronic
1055758803 9:79584131-79584153 CAGCGAAGGGAGCCCTGGAAGGG - Intronic
1057432190 9:95004796-95004818 GGGCGGCCGGAGCCCGGGAGCGG + Intronic
1057995993 9:99822108-99822130 TTGCAAAGTGAGCCCGGGAGGGG - Exonic
1059375128 9:113875885-113875907 GGCAGAAGGGAGCCGGGGAGCGG + Intergenic
1060756805 9:126219718-126219740 CGGAGAAGGGGGGCAGGGAGGGG - Intergenic
1061170214 9:128948051-128948073 CGGAGAAGGAAGCGCGGGTGGGG - Intronic
1061348231 9:130043306-130043328 CGGCCGGGGGAGCCCGGGGGAGG - Intergenic
1061507380 9:131039121-131039143 AGGTGTAGGGAGCCTGGGAGAGG - Exonic
1062517582 9:136944141-136944163 CCGGGAAGGGAGGCCGAGAGCGG + Intronic
1062547555 9:137070454-137070476 CGGCCATGGGCGCCCGGGATCGG + Exonic
1062618079 9:137407110-137407132 CGGCGTGGGGTGCCCGGGACTGG - Intronic
1188080324 X:25830936-25830958 CAGGGAAGGGAGACTGGGAGGGG - Intergenic
1189705006 X:43750935-43750957 AGGAGAAGGGAGCTGGGGAGAGG + Intergenic
1189988432 X:46573828-46573850 CGGCGCAGAGGGGCCGGGAGAGG + Exonic
1195285236 X:103376912-103376934 CAGCGAGGGGAGCCCGGGCTCGG + Intronic
1195923197 X:110002712-110002734 CGGCGCGGAGAGCGCGGGAGCGG + Intronic
1198378824 X:136065193-136065215 CGGCGACAGGAGGCTGGGAGGGG - Intergenic
1200740406 Y:6847652-6847674 AGGAGAAGGGAGGCAGGGAGGGG - Intergenic