ID: 1147971297

View in Genome Browser
Species Human (GRCh38)
Location 17:44220070-44220092
Sequence TGCCGCCGCCGGGGAAGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 301}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147971297 Original CRISPR TGCCGCCGCCGGGGAAGGGG GGG Intronic
900101270 1:963095-963117 TCCCGCCGCCTGGGGAGGGCAGG - Exonic
900175076 1:1287977-1287999 CACCGCCGGCGGGGAAGGCGTGG + Exonic
900180124 1:1307648-1307670 CGCGGCCGCCGGGGAGGGGCTGG - Intronic
900240771 1:1616226-1616248 CGCCGGCGCAGGGGAACGGGCGG - Intronic
900313850 1:2047646-2047668 TGATGCCGCCGGTGGAGGGGGGG - Intergenic
900371738 1:2335311-2335333 TGCTTCCGCCGGGGGTGGGGCGG - Intronic
900438679 1:2642971-2642993 TGCCTCCGCCCGGAGAGGGGCGG - Intronic
900586676 1:3435932-3435954 TGGCCCCGCCGGGGCAGCGGGGG + Exonic
900634402 1:3654985-3655007 TACCGCCGCTGGGCAAGGGCAGG - Intronic
902049910 1:13555006-13555028 TGCCACGGCCGGGCACGGGGCGG - Intergenic
902349980 1:15847447-15847469 TTCCCGCGCCGGGCAAGGGGCGG - Intergenic
902649232 1:17825907-17825929 TGCCGCTGGCGGGCAAGGGGCGG - Exonic
903555128 1:24187419-24187441 CCCCGCCGCGGGGGGAGGGGGGG + Intronic
903652332 1:24929796-24929818 CGCCGCCGCAGGGGAAGGCCGGG + Exonic
904128825 1:28260532-28260554 TGCCGCCGCCGCGTACCGGGCGG - Intronic
904181401 1:28668997-28669019 CGCCGCCGCCGGGGAGCGAGCGG + Intronic
904750986 1:32741579-32741601 TGGGGCCGCCCGGGAGGGGGCGG - Intergenic
904924552 1:34037297-34037319 TGCCGCCGGTGGGGGCGGGGAGG - Intronic
905482415 1:38270701-38270723 TGCTGCCGCCGGGAAGGGGTTGG - Intergenic
905647259 1:39633203-39633225 TGCGGCCGGGGGCGAAGGGGAGG + Intronic
905867252 1:41382818-41382840 GCCGGCCGCCGGGGAAGGGGAGG + Exonic
906168956 1:43707760-43707782 CGCGGCCGGCGGGGGAGGGGCGG - Intronic
906640297 1:47437500-47437522 AGCCGCAGCCAGGGAAGTGGCGG - Exonic
906962543 1:50427147-50427169 CGGCGCGGCCAGGGAAGGGGTGG - Intergenic
909433460 1:75615711-75615733 TGCCGTGTCCGGGGAGGGGGTGG - Intergenic
915485414 1:156216783-156216805 TCCCCACTCCGGGGAAGGGGCGG - Intronic
916651796 1:166839984-166840006 TGCCGGCTCCGGGGCAGAGGTGG - Intronic
917975626 1:180235757-180235779 GTGCGCCGCCGGGGAAGGCGAGG + Intronic
920524763 1:206658609-206658631 TGCAGCCGCAGGGGTTGGGGAGG - Intronic
921138616 1:212285271-212285293 TGCGGCGGCGGGGGAGGGGGCGG - Intergenic
922168304 1:223134139-223134161 TGTTGCTGCCGGGGTAGGGGCGG - Intronic
922560468 1:226565623-226565645 TGCCTCAGCTGGGGGAGGGGTGG + Intronic
1063048446 10:2418263-2418285 TGCCAGAGCCTGGGAAGGGGAGG - Intergenic
1063369603 10:5512517-5512539 TGCCCACGGCGAGGAAGGGGCGG - Intergenic
1063664716 10:8054460-8054482 GGCGGCCGCCGGCGGAGGGGCGG - Intronic
1066472048 10:35708621-35708643 TGCTTCAGCCCGGGAAGGGGAGG + Intergenic
1069947805 10:71999658-71999680 GGCCTCCTCCGGGGAAGGTGGGG - Intronic
1070800698 10:79243115-79243137 AGCCGCGGCGGGGGGAGGGGAGG - Intronic
1072152317 10:92692568-92692590 GGCCGCCTCCGGGGAAGGGAAGG + Intronic
1072249205 10:93568374-93568396 TGACCCCGGCAGGGAAGGGGAGG - Intronic
1072637364 10:97186434-97186456 TGCTGCCGTCGGGGGATGGGGGG - Intronic
1073414261 10:103368201-103368223 CGCCCCCGCCGGGGCAGCGGCGG - Exonic
1073632419 10:105161999-105162021 TGCCCCTGCAGGGGCAGGGGCGG - Intronic
1074484005 10:113855089-113855111 CGCCGTCCCCGAGGAAGGGGAGG - Intronic
1075923063 10:126229145-126229167 GCCCGCCTCCTGGGAAGGGGAGG - Intronic
1076820777 10:132938503-132938525 TCCCCCCCCCGGAGAAGGGGTGG + Intronic
1077032211 11:473664-473686 TGCCGCCTCCGCGGCAGGGAAGG - Intronic
1077309697 11:1882894-1882916 TGCCGGCTGCGGGGGAGGGGAGG - Intronic
1077444222 11:2582840-2582862 TGCCAGCGCGGGGGAAAGGGTGG + Intronic
1077528278 11:3082158-3082180 TGGAGACGCTGGGGAAGGGGAGG - Intergenic
1081700080 11:45147107-45147129 TGCCGCCGCCGCGGGAGCCGGGG + Intronic
1082079175 11:47998852-47998874 TGCAGCTGCCAGGGAAGGGAGGG + Intronic
1083419665 11:62545882-62545904 CGCCTCCGGAGGGGAAGGGGCGG + Intronic
1083672337 11:64306235-64306257 TCCCGCGGGCGGGGAGGGGGAGG + Exonic
1083682813 11:64359126-64359148 TGCCGCCTCCGGGGCCGAGGCGG - Intronic
1083901165 11:65644228-65644250 TGCTGCAGCCAGGGAGGGGGAGG + Intronic
1084516850 11:69642129-69642151 GGACGCCGCTAGGGAAGGGGGGG + Intronic
1084598968 11:70133632-70133654 TGCAGCCTCCGGAGCAGGGGAGG - Intronic
1085010995 11:73141851-73141873 AGCCGCCGCCGAGGAAGGTAAGG - Exonic
1087755116 11:102047330-102047352 TGCCGCCGCGGGTGCAGGGAGGG - Intergenic
1089253013 11:117178903-117178925 TGGAGACGCCGGGAAAGGGGAGG - Exonic
1089573006 11:119422625-119422647 TGCCGCAGGCGGGGACTGGGTGG - Intronic
1089839253 11:121400149-121400171 TGCCCCTGCCTGGGAAGGGTGGG - Intergenic
1091224646 11:133950198-133950220 CTCCTCCGCCGGGGAAGGGCTGG + Intronic
1091616122 12:2052686-2052708 GGCCGCCGGCGGGCGAGGGGCGG - Intronic
1092246757 12:6868104-6868126 GGACGCCGGCGAGGAAGGGGAGG - Intronic
1092271071 12:7023852-7023874 TGCCTCCACTGGGGATGGGGAGG - Intronic
1093464840 12:19439368-19439390 TGCAGGCGCCGGGGCGGGGGCGG + Intronic
1093562062 12:20552978-20553000 TGCCGTAGCCGGGGAAGAGCTGG - Intronic
1096077642 12:48815146-48815168 AGCCGCCGCCGGAGGATGGGCGG + Intronic
1096154322 12:49333324-49333346 AGCCGCCGCAGGGGCTGGGGAGG + Intronic
1096191338 12:49622230-49622252 AGCCGCCGCCGCGGCAGGAGAGG - Intronic
1096493029 12:52023363-52023385 TGCCGCCGCCGCGAGTGGGGTGG + Intronic
1096674679 12:53220160-53220182 GGGCGCCGCCGGGGGAGGAGGGG - Intronic
1096777660 12:53973930-53973952 AGCAGCGGCCGGGGAACGGGCGG + Intronic
1100869316 12:98894538-98894560 TGCCGCAGCCGGGGCAGAGGCGG - Intronic
1101466926 12:104958370-104958392 CGCCGCCGCCGGGGAAGCCCGGG + Intronic
1102256425 12:111418189-111418211 GGCCGCCGCCGGGGAGGCTGAGG - Exonic
1104093281 12:125533667-125533689 AGCCTCCGCCGGGGAGGGGAGGG - Intronic
1104862366 12:131930183-131930205 TGCGGCCGCCGGGGAAGCGGTGG + Intronic
1105425638 13:20292525-20292547 TGCCGGCCCCGGGGAATGAGGGG + Intergenic
1105698545 13:22915563-22915585 TGCCCGCGCCGGCGCAGGGGCGG + Intergenic
1106246597 13:27954734-27954756 GCCGGCCGCAGGGGAAGGGGCGG + Intergenic
1106322957 13:28659263-28659285 CGCCGCCACCGGGGACGGGTTGG - Intronic
1106756077 13:32824265-32824287 CGCCTCTGCCGGGGAAGGAGAGG - Intergenic
1113427281 13:110219045-110219067 TGCCGCCGCTGGGAAAGGGGTGG + Intronic
1113517598 13:110915178-110915200 TGGAGCCGCCGGGCAGGGGGCGG + Intergenic
1113895071 13:113759178-113759200 TGCAGGGGGCGGGGAAGGGGCGG + Intergenic
1113931761 13:113972484-113972506 TGCCGAGGCCGCGGGAGGGGAGG + Intergenic
1113944692 13:114037478-114037500 GGCTGCCGGTGGGGAAGGGGCGG + Intronic
1115592243 14:34875092-34875114 CGGCGCCGGCGGGGAAGTGGAGG - Intronic
1117253600 14:53956867-53956889 AGGGGCCGCCGGGGAAGAGGAGG - Intronic
1118350995 14:64972357-64972379 CGGCGGCGCAGGGGAAGGGGCGG - Intronic
1119473832 14:74915685-74915707 TGCTGCCACAGGGGAATGGGAGG + Intronic
1119519990 14:75278406-75278428 GGCCGCGGCTGGGGGAGGGGAGG - Intergenic
1119781602 14:77279780-77279802 TGCTGCCGCCAGGTCAGGGGAGG + Intronic
1122183413 14:99971743-99971765 GGCCGCCGCCGGGGGATGGGGGG - Intronic
1122436725 14:101706004-101706026 CGCCGCGGCCGGGCATGGGGAGG + Intergenic
1122736758 14:103847762-103847784 TCCCGGCGGCGGGGGAGGGGCGG + Intergenic
1122941768 14:104984727-104984749 TGCCTCCTCTGGGTAAGGGGAGG - Intergenic
1202857096 14_GL000225v1_random:58452-58474 TCCCGCCGCCAGGGAAGAGCTGG + Intergenic
1124453876 15:29822560-29822582 GGCCGCGGCGGGGGAGGGGGCGG + Intronic
1125554070 15:40569669-40569691 TGCCGCCCCCGAAGAAGCGGCGG + Exonic
1125594236 15:40874069-40874091 CGCCGCCGCGGGGGAGGGGTCGG + Exonic
1126953808 15:53911597-53911619 TGCAGCCGCCGATGAAGGGAAGG - Intergenic
1127050810 15:55081504-55081526 TGCTCCAGCAGGGGAAGGGGAGG - Intergenic
1129082564 15:73052982-73053004 GGGCGCCACCGGGGAAGGGGCGG + Intronic
1129144303 15:73633258-73633280 AGCCGGGGCCGGGGAAGGGAGGG + Exonic
1130531105 15:84748480-84748502 TGCCGCGGCGGGGGATTGGGGGG - Intergenic
1130555908 15:84922447-84922469 TGCCGCAGTGGGGGAAGCGGAGG - Intronic
1131195480 15:90351816-90351838 TCCGGCCGCCGGGGATGAGGTGG + Intergenic
1131268473 15:90932562-90932584 TGCGGCCGCAGGGGCAGGGACGG + Exonic
1131493692 15:92883461-92883483 TGGATCCGCCGGGAAAGGGGCGG + Intronic
1132572374 16:649638-649660 TGGCGTCGCCGGGGAAGGCGCGG + Intronic
1132805484 16:1773270-1773292 GGCCGGGGCCGGGGACGGGGCGG + Exonic
1132876945 16:2144196-2144218 TGCAGCCGCTGGGGAAGGGCTGG + Intronic
1132934582 16:2474219-2474241 AGCTGCCGGCGGGGACGGGGCGG - Intergenic
1133350753 16:5098636-5098658 TGCCGACGCGGGGCCAGGGGCGG + Intergenic
1134784230 16:16926270-16926292 TGCCCCGGCGGGGGCAGGGGGGG - Intergenic
1134903907 16:17962923-17962945 TCCTGCCCCCGGGGCAGGGGGGG - Intergenic
1136427809 16:30180907-30180929 GGCTGCAGCAGGGGAAGGGGTGG - Intergenic
1138590432 16:57996549-57996571 TGCCGCCGCCGCGGCAGCGGAGG - Exonic
1139459429 16:67110036-67110058 CGCTGCCGCCGGGGAGGAGGTGG + Exonic
1141455653 16:84140066-84140088 TGCCACGGCCTGGGAAGGGAAGG - Intronic
1142179781 16:88662795-88662817 AGCCGTCGCGGGGGAACGGGTGG + Intronic
1142300884 16:89257243-89257265 GGCCGCCTCCGGGGACGGGCGGG + Intergenic
1142737249 17:1908715-1908737 TGCAGCCGGCAGGGAAGGCGCGG - Intergenic
1142764167 17:2056443-2056465 AGCGGCCGCCGGTGGAGGGGAGG - Intronic
1142810621 17:2393970-2393992 GGGCGCGGCCGGGGGAGGGGCGG + Intronic
1142811796 17:2399017-2399039 TGCCGCCGCCGCGGCGGGCGGGG - Intronic
1142983628 17:3685464-3685486 TGCGGCCGCCGGGGAGAGGGTGG + Intronic
1143078873 17:4366722-4366744 TTCCGCCGCCGGGGGCGGGGCGG - Intergenic
1143223762 17:5282699-5282721 TGCCGTCGCTGGGGAGGGGGCGG + Intronic
1143311750 17:5997741-5997763 TGCTGCCCTTGGGGAAGGGGAGG - Intronic
1143590666 17:7884686-7884708 CGCCGCCGCCGAGGAGGAGGAGG + Intronic
1143683696 17:8496598-8496620 TGCCTACGGCGGGGAAGGGAGGG - Intronic
1144527244 17:16000179-16000201 GGCCGCTGCCGAGGACGGGGCGG + Exonic
1145879385 17:28342454-28342476 TGCCCCTGCCTGGGTAGGGGAGG + Intronic
1146332332 17:31937410-31937432 TGCCGCCGCGGAGGAGGAGGAGG - Exonic
1146955856 17:36936106-36936128 CGCCGGCGCGGGGGAAGGAGTGG - Intergenic
1147264376 17:39225875-39225897 TGGGGCCGGCGGGGGAGGGGAGG - Intergenic
1147971297 17:44220070-44220092 TGCCGCCGCCGGGGAAGGGGGGG + Intronic
1148060046 17:44830051-44830073 ACCCGCCGCCGGGTGAGGGGCGG - Intronic
1148126690 17:45241062-45241084 TGGCACCGCCGGTGAGGGGGCGG - Intronic
1148331922 17:46818456-46818478 CGCCGCGTCCGGGGAAGGTGGGG - Intronic
1148819858 17:50354141-50354163 TGCCCCCGCCTGGGAAGGGCTGG - Intronic
1148855709 17:50578273-50578295 TGCCCGGGCCGGGGCAGGGGAGG + Exonic
1151557236 17:74852661-74852683 GGCCGAGGTCGGGGAAGGGGCGG - Intronic
1152708915 17:81860503-81860525 TGGCGCCGCCGGGACAGCGGGGG + Exonic
1152831170 17:82497636-82497658 TGTGGTCGCCGGGGAACGGGCGG + Intergenic
1153815279 18:8785441-8785463 TGCCGCCGCTGGGGAGGGCGCGG + Intronic
1155461725 18:26090908-26090930 CGCCGCCGCGGGAGAAGGAGAGG + Intronic
1156502033 18:37566185-37566207 GGCCGCCGACGGGGGAGGCGCGG - Intergenic
1156807896 18:41209054-41209076 TGGCGGCGGCGGGGGAGGGGAGG - Intergenic
1157158674 18:45292019-45292041 TGTCTCCGCCAGGAAAGGGGAGG - Intronic
1157464245 18:47930623-47930645 CGCCGCCCGCGGGGAAGGAGGGG + Intronic
1159230791 18:65605363-65605385 TGCCGGCCCCGGGGAATGAGGGG + Intergenic
1159339809 18:67119863-67119885 AGCCGCTGCCAGGGATGGGGAGG + Intergenic
1160023997 18:75204284-75204306 TGCCGCTTCCTGGGAAGAGGTGG + Intronic
1160024929 18:75209227-75209249 CGCCGGCGCCGGGGAGGCGGGGG - Exonic
1160454603 18:78992072-78992094 AGCCGCCCCGGGGGAAGGTGCGG + Exonic
1160499720 18:79395754-79395776 TGCCGCGGCGCGGGGAGGGGCGG + Intergenic
1160734891 19:657994-658016 TGCTGCCCCCGGAGAAGGTGGGG - Intronic
1160765669 19:806450-806472 TGCCGCCGCCGCCGAGGGGATGG - Exonic
1160768875 19:821650-821672 CGGCGCCGGCGGGGGAGGGGCGG + Intronic
1160797662 19:953349-953371 TGGCGCCGGTGGGGGAGGGGAGG - Intronic
1161388061 19:4007513-4007535 AGGCGCCGCCGGGGTAGGCGTGG + Intergenic
1161490531 19:4558484-4558506 TGACGCCTGCGGGCAAGGGGCGG + Exonic
1161559062 19:4960770-4960792 TGCCGTAGCCGGGGAAGAGCTGG - Exonic
1162465114 19:10835193-10835215 TGAGGCCGCCTGGGAAGGGCAGG + Intronic
1162803225 19:13122514-13122536 TGCCCCTGCCGGGGGGGGGGGGG + Intronic
1162818182 19:13208508-13208530 TGCGGGCGGCGGGGAGGGGGCGG + Intronic
1163537237 19:17883817-17883839 AGCCGGCGTCAGGGAAGGGGAGG - Intronic
1164476216 19:28577891-28577913 TGCCCCCGGAGCGGAAGGGGAGG + Intergenic
1165236925 19:34428807-34428829 TGGCGCTGCCGGGGAGGCGGGGG - Intronic
1165745664 19:38228623-38228645 TGTCACCGCCTGGGAACGGGGGG + Intronic
1165850970 19:38850057-38850079 TCCCGCCGCGGGGGGAGGGTAGG + Exonic
1165861665 19:38912256-38912278 CGCCGCGGGCGGGGAGGGGGCGG - Intergenic
1165923892 19:39315222-39315244 TGCAGCGGCCGGGGCAGGGCTGG + Exonic
1166106692 19:40601246-40601268 CGCGGCCGCCGGGGAGGGAGTGG + Intronic
1166304100 19:41928008-41928030 CGCCGCGGCCGGCGCAGGGGCGG - Intronic
1166750235 19:45161056-45161078 GGCAGGCGCTGGGGAAGGGGCGG - Intronic
1167035271 19:46991531-46991553 TGCAGCAGCCTGGGAAAGGGTGG + Intronic
1167074761 19:47241297-47241319 CCCCGCCCCCGGGGAAGGGCTGG + Intergenic
1167154529 19:47730096-47730118 TGCCCCCGCCGGGCTGGGGGCGG + Intronic
1167649043 19:50719625-50719647 GGCGGCCGCGGCGGAAGGGGGGG - Intergenic
1167960954 19:53103622-53103644 AGGAGCCGCCGGGGAAGGGCGGG + Intergenic
1168294128 19:55370410-55370432 GGCCGCGGCCTGGGGAGGGGAGG + Intronic
1168336517 19:55600333-55600355 GGCCGGCGCGTGGGAAGGGGAGG - Intronic
1168344233 19:55642618-55642640 CCCCGCCGCCGAGGAAGGAGTGG - Exonic
926154932 2:10448420-10448442 GGACACCGCCGGGGGAGGGGCGG + Exonic
926285200 2:11482652-11482674 GACCTCCGCCGGGGAAGGGTCGG - Intergenic
927652291 2:24920039-24920061 CGCCGCCGCGGGTGCAGGGGAGG - Intergenic
928964831 2:36966352-36966374 TGCCGCGGCCGGCGACGGGGCGG - Exonic
929151224 2:38750908-38750930 AGCCGCCGCCGAGGGCGGGGGGG + Intronic
931253503 2:60552413-60552435 CGCCGCCGCCGCCGAAGGGCAGG - Intronic
931253762 2:60553820-60553842 CGCGGCCCCCGGGGGAGGGGCGG + Intergenic
931348878 2:61470939-61470961 CGCCGGCGGCGGGGAAGGGGGGG + Intergenic
931429058 2:62195611-62195633 TGGCCCCGCCGGGGAGGCGGGGG - Intergenic
931708684 2:64969113-64969135 TGCCGGCGCCGGGCAATGAGGGG + Intergenic
932703575 2:74006638-74006660 TGCAGCCTCCGGGGTATGGGAGG - Intronic
934067089 2:88350552-88350574 GGCGGCCACCGGGGGAGGGGAGG - Intergenic
941772800 2:169362268-169362290 TGCCACAGCCGGGGAAGTGGGGG + Intronic
942241107 2:173964673-173964695 CGCCGCCGCCGGGGGGCGGGTGG - Intronic
946573760 2:221051917-221051939 TGTAGTAGCCGGGGAAGGGGTGG + Intergenic
946776550 2:223148355-223148377 TGGCGGCGGCGGGGGAGGGGGGG + Intronic
947636163 2:231681545-231681567 AGCCGCAGCCCGGGAAGGGAAGG - Intergenic
949027465 2:241773359-241773381 TGGCGCTGCCTGGGACGGGGAGG + Intergenic
1171034555 20:21705180-21705202 GGCAGCGGCCGGGGAAGGGTGGG - Intergenic
1171175657 20:23049524-23049546 TGCAGGCGCCGGGGAAAGCGCGG + Exonic
1171223200 20:23420479-23420501 GGGCCCCGCCGGGGAGGGGGCGG - Intronic
1172126317 20:32627133-32627155 CCCGGCCTCCGGGGAAGGGGTGG + Intergenic
1172189485 20:33053544-33053566 GGCCTTCGCTGGGGAAGGGGTGG + Intergenic
1174404288 20:50293712-50293734 TGCCGCCCCAGGGCAAGGTGAGG + Intergenic
1175423501 20:58850657-58850679 TGCCACTGCCGGGCAAGGTGAGG - Intronic
1175994211 20:62805100-62805122 TGTCTCCGCCCGGGATGGGGGGG - Intronic
1176236464 20:64055970-64055992 TGGGGCCTCTGGGGAAGGGGAGG + Intronic
1177905253 21:26966136-26966158 TGCCGCCGCCGGAGTAGAGTTGG + Exonic
1178327915 21:31660107-31660129 TGCCGCGGGCCGGGGAGGGGCGG + Intronic
1178513832 21:33229899-33229921 CGCCGCCGCCGGCGCGGGGGCGG - Intronic
1178915907 21:36705458-36705480 GGCCGCAGGCAGGGAAGGGGTGG + Intronic
1178992450 21:37367039-37367061 TGCCGCCGCCGGCGAGCAGGCGG + Intronic
1179447076 21:41439701-41439723 TGCCATCGCCGGGGAAGGAATGG + Exonic
1179605625 21:42513753-42513775 CGCGGCGGCCGGGGAGGGGGAGG + Intronic
1180188822 21:46153202-46153224 TGCTGCCGCTGGGGCAGGGCTGG - Intronic
1180281508 22:10699949-10699971 TGCCCCCGCCGCGGAACTGGGGG + Intergenic
1182622525 22:31625876-31625898 TGCTGGCTCGGGGGAAGGGGAGG - Exonic
1183036438 22:35144258-35144280 TGCCCCCGCTGTGGAGGGGGTGG + Intergenic
1183102170 22:35590871-35590893 GGCAGCCACTGGGGAAGGGGTGG + Intergenic
1183776264 22:39968153-39968175 TGCTGCTGCAGGGGAAGGGTCGG - Exonic
1184439193 22:44498233-44498255 GGCCGGGGCCGGGGCAGGGGCGG + Exonic
1185333524 22:50261815-50261837 GGCCGCCGCCGGGGGAGGGCCGG + Exonic
1185376824 22:50486530-50486552 TGGGGCAGCCGGGGAAGGGGTGG + Intergenic
949970250 3:9397681-9397703 CGCCGCTGCCGGGGGAGGGGCGG + Intronic
951204207 3:19909202-19909224 TGCTGCTGCCGGGGTTGGGGAGG - Intronic
953598348 3:44338531-44338553 TGCCGCCGCCGGAGCGGGGAGGG + Exonic
954553292 3:51499735-51499757 GGCCGCCGGCGAGGAGGGGGCGG - Intronic
956322050 3:68008015-68008037 GGCCGCCCCGGGAGAAGGGGTGG + Intronic
959530736 3:107431544-107431566 CGCCGCCGCCGGGGCTCGGGCGG + Intergenic
960951519 3:123001443-123001465 TGCAGCCGTCAGGGAAGTGGAGG + Intronic
961663565 3:128482983-128483005 TGCAGCCGCGGGGGCAGGGAGGG + Intronic
961666837 3:128497938-128497960 GGCCGGGGCCGGGGCAGGGGAGG - Intergenic
961831865 3:129627096-129627118 ACCCGCAGCCGGGGAAGCGGAGG - Intergenic
961888692 3:130112382-130112404 TGCCGACGCGGGGCCAGGGGCGG + Intronic
962389939 3:134962838-134962860 TGGGGCTGCTGGGGAAGGGGTGG - Intronic
962686433 3:137852494-137852516 TGCCAGTGCCAGGGAAGGGGCGG - Intergenic
963236849 3:142964039-142964061 TGCGGCTGCGGGGGGAGGGGAGG + Intergenic
963240913 3:143001595-143001617 TGCTGCCGCCGCCGAAGGAGGGG + Exonic
964720401 3:159763925-159763947 AGCCGCGGGCGGGGAAGGGGCGG + Intronic
966182145 3:177197346-177197368 TCCCGCCGCGGGGGGAGGGGCGG + Intronic
968225220 3:196968839-196968861 CGCCGCCGCCGGCGCAGGGCGGG + Intronic
968456734 4:704196-704218 TGCTGCCCCCGGGGGAGGGGAGG - Intergenic
968512963 4:1003365-1003387 GGCCGCCGGCGGGTAAGGGGCGG - Exonic
968727690 4:2255890-2255912 TGCCGCTGCCGGGGAGCTGGGGG + Intronic
969605714 4:8201391-8201413 TCCAGCCCCGGGGGAAGGGGTGG - Intronic
969690348 4:8700832-8700854 TGCCCCCACCAGGGAGGGGGTGG - Intergenic
969713341 4:8857206-8857228 TGCAGCCGCCGAGGAAGCGTCGG + Intronic
971905201 4:32716476-32716498 TGCCGGCGCCGGGCAATGAGGGG - Intergenic
979205536 4:118033546-118033568 CGCCCGCCCCGGGGAAGGGGAGG - Intergenic
979547163 4:121951556-121951578 CGCCGCCGCCGGGGCTGGAGGGG - Exonic
985478466 5:92452-92474 TGGGGGCGCCGGGGTAGGGGCGG + Intergenic
985638064 5:1049635-1049657 TGGACCTGCCGGGGAAGGGGCGG + Intergenic
985936759 5:3103284-3103306 TGCAGCCGCCGGGGGACTGGAGG - Intergenic
997222552 5:132181297-132181319 GGCCTGCGCGGGGGAAGGGGTGG + Intergenic
997292397 5:132747395-132747417 GGGCGCCGCCGGGGGAGGTGGGG - Intergenic
997521612 5:134527161-134527183 TGCCACTGCCGGGGGCGGGGCGG - Intronic
997582468 5:135026480-135026502 TGGAGCCGCTGGGGGAGGGGTGG + Intergenic
1002887665 6:1311237-1311259 AGCCGCCCCAGGGGAAGAGGAGG + Intergenic
1002927776 6:1614755-1614777 TGCCGGGGACGGGGACGGGGCGG + Intergenic
1004690325 6:17987645-17987667 GGCCGCGGCCCGGGGAGGGGCGG + Intergenic
1006136021 6:31897111-31897133 AGCCGAGGCCGCGGAAGGGGGGG - Intronic
1006180386 6:32150515-32150537 TGGCGCCGGCGGGGGCGGGGCGG + Exonic
1006474870 6:34247221-34247243 TGCCCCTGCCTGGGAAAGGGAGG - Intronic
1007636263 6:43301594-43301616 AGTGGCCGCCGGGGAACGGGTGG + Exonic
1009366429 6:62861021-62861043 TGCCGCAGCAGGGGAGAGGGGGG + Intergenic
1009437626 6:63636074-63636096 TGCCGCCGCCGAAGAGGAGGAGG - Exonic
1013184351 6:107744997-107745019 TGCAGCCCCTGGGGAAGGGCTGG + Exonic
1014913186 6:127118123-127118145 CGCCGGCGCTGGGGATGGGGTGG + Intergenic
1016949454 6:149566265-149566287 CGCGGCCGCCCGGGGAGGGGAGG + Intergenic
1017324586 6:153130976-153130998 CGCCCCCGCCGGGGCATGGGCGG + Intronic
1017672067 6:156778039-156778061 TGCCGCCGCGGAGGAGGAGGAGG - Exonic
1018017865 6:159727771-159727793 CGCCCCCGGCGGGTAAGGGGCGG + Intronic
1018613029 6:165662100-165662122 GGCCGGCGCCGGGGAAGCCGGGG + Intronic
1019114783 6:169751487-169751509 GACCGCCGGCGGTGAAGGGGAGG - Exonic
1019258244 7:65213-65235 TGGTCCAGCCGGGGAAGGGGTGG + Intergenic
1019701971 7:2478405-2478427 TGCCGCTGCCTGGGATGAGGGGG + Intergenic
1020055722 7:5116701-5116723 TGCAGCCGGCGGGGAAGGACTGG - Intergenic
1022516680 7:30979198-30979220 TGCCGCCGAGCGGGAAGGCGTGG - Exonic
1027774104 7:82443631-82443653 AGCGGACGCCGAGGAAGGGGCGG + Exonic
1032174351 7:129611689-129611711 CGCCGCCGCCGAGGAGGGGGAGG - Intergenic
1033654374 7:143362821-143362843 CGCCGCGGCCGGGGAGGGGGCGG + Intergenic
1034439145 7:151077675-151077697 TGCTGCCTTCGGGGAAGGCGGGG + Exonic
1036789505 8:11708681-11708703 TGCCGCGGCCCGGGAAGCTGCGG + Exonic
1037305239 8:17497297-17497319 TGGGGCCGGCGGGGAAGGAGCGG + Intronic
1037523832 8:19705651-19705673 TGCCTGAGCCGGGGAGGGGGAGG + Intronic
1038462466 8:27728561-27728583 GGCCGTCGCTGGGGAAGAGGAGG + Intergenic
1038540195 8:28385435-28385457 TGCCACCGCCGGGGAGGGCCAGG + Intronic
1040039147 8:42897920-42897942 CGGCGCGGCCGGGGAGGGGGAGG + Intronic
1040065599 8:43141303-43141325 CGCCGCCGCCTGGGAGGGGCCGG + Intronic
1040471429 8:47738246-47738268 CGGGGCCGCGGGGGAAGGGGCGG + Exonic
1040954931 8:52970098-52970120 TGCCGCCCCCGGGCAATGAGGGG - Intergenic
1041369430 8:57143364-57143386 ATCCGCCGCCGGGGCCGGGGTGG + Intergenic
1042282008 8:67064859-67064881 TGCAGCTGCCGGGGTCGGGGAGG + Intronic
1044656424 8:94553451-94553473 TGCCGCGGGCGGGGAACAGGGGG + Exonic
1045990672 8:108303197-108303219 TACCTGCGCTGGGGAAGGGGAGG - Intronic
1047188902 8:122660367-122660389 TGCCACAGCCGGGGAAGGCCAGG - Intergenic
1049220099 8:141425172-141425194 TGCTGCCACCGGGGGAGGGTGGG + Intronic
1049220330 8:141426026-141426048 TCCCGCTGCTGTGGAAGGGGAGG - Intronic
1049684586 8:143934223-143934245 TTCCCCCGCCGGGGGCGGGGCGG + Intronic
1049762704 8:144338247-144338269 CGCCGCTGCCGGGGCCGGGGCGG - Intergenic
1052982281 9:34458192-34458214 TGCAGCCGCTGGTGAGGGGGCGG - Exonic
1052997663 9:34559749-34559771 TGCCACCGCTGGGGGTGGGGTGG + Intronic
1052999781 9:34571593-34571615 GGCCCCCGCGGGGGGAGGGGTGG + Intronic
1053135274 9:35646918-35646940 CGCCGCCGCCTGGCGAGGGGCGG - Intergenic
1055945264 9:81687750-81687772 CGCCGCCGTGGGGGAAGGGGCGG - Intronic
1056186809 9:84143267-84143289 TGCAGCCGCTGGGGAATAGGCGG - Intergenic
1059234491 9:112750680-112750702 CGCGGCCGCCCGGGAGGGGGCGG - Intergenic
1061075749 9:128340567-128340589 TGCCGGCTTCGGGGAAGGTGCGG + Intergenic
1061257019 9:129459296-129459318 TGCAGCCGTTGGGGAAGGAGAGG - Intergenic
1061804217 9:133129095-133129117 TGCCTCTGCCGGGGAGGGGCTGG - Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062353091 9:136148651-136148673 TGGCCCAGCCAGGGAAGGGGTGG + Intergenic
1062381195 9:136287584-136287606 TGCCGCAGCCGAGGAGGTGGGGG - Intronic
1062543917 9:137053469-137053491 TGCCGCCGCCCCGGAGGGTGCGG - Intronic
1062584277 9:137241894-137241916 TGCCGCCTGCGGGGACGGGAGGG - Exonic
1062609496 9:137367648-137367670 TGCCCACTCCAGGGAAGGGGTGG + Intronic
1203778078 EBV:85270-85292 GGCCTCTGCCGGGGAACGGGTGG - Intergenic
1203778100 EBV:85330-85352 GGCCTCTGCCGGGGAACGGGCGG - Intergenic
1195702646 X:107716556-107716578 TGCAGCATCCTGGGAAGGGGCGG - Intronic
1197734948 X:129843621-129843643 TCCAGGCGCCGCGGAAGGGGAGG + Intronic
1200063609 X:153494724-153494746 TGCCCCAGGCGGGGGAGGGGGGG + Intronic