ID: 1147971404

View in Genome Browser
Species Human (GRCh38)
Location 17:44220399-44220421
Sequence AAACCAGCGGCCACGCTCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147971404_1147971411 1 Left 1147971404 17:44220399-44220421 CCCCGGAGCGTGGCCGCTGGTTT 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1147971411 17:44220423-44220445 GGGCGCACGCACGCCGATCGCGG 0: 1
1: 0
2: 0
3: 0
4: 28
1147971404_1147971413 14 Left 1147971404 17:44220399-44220421 CCCCGGAGCGTGGCCGCTGGTTT 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1147971413 17:44220436-44220458 CCGATCGCGGCGTCCAGCTTCGG 0: 1
1: 0
2: 0
3: 0
4: 17
1147971404_1147971415 28 Left 1147971404 17:44220399-44220421 CCCCGGAGCGTGGCCGCTGGTTT 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1147971415 17:44220450-44220472 CAGCTTCGGTGCCTACCTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147971404 Original CRISPR AAACCAGCGGCCACGCTCCG GGG (reversed) Intronic
904384024 1:30129980-30130002 AAAGCAGGGGCCATGCTCCTTGG + Intergenic
905889590 1:41510937-41510959 ACTCCAGCGGCCTCGCTCCTGGG + Exonic
909562374 1:77020934-77020956 AAACCAGCAGCCATGCTGTGCGG - Intronic
912366510 1:109138106-109138128 TAACCTGGGGCCACGCTCTGGGG - Intronic
924524599 1:244835267-244835289 AAAGCAGCGGCCCCGCCCCTCGG + Intergenic
924770122 1:247072495-247072517 AAACCACAGGCCAGGCTCAGTGG + Intronic
1063200393 10:3781601-3781623 CCACCAGCGGCCGCCCTCCGGGG + Intronic
1066013785 10:31217732-31217754 ACACCAGCGGGCAGGCTCAGGGG - Intergenic
1071544800 10:86521365-86521387 AAAGCACCCGCCAGGCTCCGAGG - Exonic
1072555133 10:96509031-96509053 AATCCAGCTGCCATGCTTCGAGG + Intronic
1073832144 10:107397120-107397142 AAACCATGGGCCAGGCTCAGTGG + Intergenic
1075730394 10:124632128-124632150 AACCCAGGGGCCCCTCTCCGAGG + Intronic
1076767485 10:132644500-132644522 AGCCCAGCGGCCACGGTCCAGGG - Intronic
1085532433 11:77199814-77199836 ATACCAGCAGCCACTCACCGGGG - Exonic
1087071204 11:94082807-94082829 AAACTAGCGGCCAGGCACAGTGG + Intronic
1089775799 11:120834907-120834929 TAAGCAGCGGGCTCGCTCCGTGG + Intronic
1090059060 11:123448154-123448176 AAACCTGGGGCCAGGCTCTGTGG - Intergenic
1093709798 12:22317605-22317627 AAACCAGCTGCCATGCTATGAGG - Intronic
1103684353 12:122719959-122719981 AAAACAGAGGCCAGGCGCCGTGG + Intergenic
1104847846 12:131855748-131855770 AAGCCAGCGGGCACACTCTGAGG + Intergenic
1118137400 14:63045198-63045220 AGAGCAGCGGCCAGGATCCGCGG + Exonic
1129378003 15:75146048-75146070 AAAGCAGAGGCCAGGCACCGTGG + Intergenic
1132035415 15:98479787-98479809 AAACCAGTGGCCAGGCGCAGTGG + Intronic
1137416451 16:48286426-48286448 AAATCAGCGGCCAGGCACGGTGG - Intronic
1142273154 16:89101501-89101523 AGGCCAGCGGCCACACCCCGAGG - Intronic
1203140286 16_KI270728v1_random:1760462-1760484 AAACCAGAGGCCAGGCGCGGTGG + Intergenic
1143373423 17:6454287-6454309 AAACCAGCTGCACCTCTCCGTGG + Exonic
1143494687 17:7305868-7305890 AAACAAGCGGCCAGGCGCAGTGG - Intergenic
1144384431 17:14736414-14736436 AAACCAGAGGCCGGGCTCGGTGG - Intergenic
1145938199 17:28727042-28727064 AAAGCAGCTGCCTCGCTCGGAGG - Intronic
1147971404 17:44220399-44220421 AAACCAGCGGCCACGCTCCGGGG - Intronic
1152663512 17:81553841-81553863 AAACCAGCAGCCTCACCCCGCGG + Intronic
1154120705 18:11650078-11650100 AAACCAGCTGCCATGCTGTGAGG + Intergenic
1160130623 18:76222022-76222044 AGACCAGCGACCTCGCTCTGTGG - Intergenic
1162514331 19:11138970-11138992 ACCCCAGCGGCCATGCTCAGTGG - Intronic
1163434958 19:17289909-17289931 AAAACAGGGGCCAGGCACCGTGG + Intergenic
1164026504 19:21358178-21358200 AAACAAGAGGCCACGCGCAGTGG - Intergenic
1164207334 19:23069942-23069964 AAAACAGCGGCCAGGCGCGGTGG + Intergenic
1166686487 19:44799617-44799639 AAAACAGGGGCCACGCGCGGTGG - Intronic
1167142618 19:47662386-47662408 ACACCATCGGCCAGGCTCCTTGG + Intronic
1167744754 19:51344087-51344109 AATCCAGCCGCCACACTGCGAGG + Intergenic
931839386 2:66132449-66132471 AAATCAGCGGCCTCACTCCCAGG + Intergenic
934882382 2:97995538-97995560 AGGCCGGCGGCCGCGCTCCGCGG + Exonic
936198065 2:110386701-110386723 AGCCCAGCAGCCACGCTCCTTGG - Intergenic
937598632 2:123701882-123701904 AAACCAGCAACCATGCTCCTAGG + Intergenic
945879629 2:215312275-215312297 AAGCCAGCGTCCCCGCTCCCCGG + Intronic
946826629 2:223685839-223685861 AAACCAGGGGCCAGGCGCGGTGG + Intergenic
1172956354 20:38762277-38762299 AAACCAGTGGCCACACTGGGAGG - Intronic
1174193571 20:48757304-48757326 AAACAAGCTGCCACCCTCCTGGG - Intronic
1175352659 20:58336297-58336319 AAACCAGCGGCCGGGCGCCGTGG - Intronic
1178313123 21:31546262-31546284 AAACCAGAGGCCAGGCTCAGTGG + Intronic
1180989719 22:19927977-19927999 AAACCACAGGCCAGGCACCGTGG + Intronic
1181912016 22:26245690-26245712 CAATCAGCGGCCACTCTCAGAGG - Intronic
1182541485 22:31045191-31045213 AAACCGGCTGCCACGCACGGTGG - Intergenic
1183252218 22:36738113-36738135 CAACCAGCAGCCACCCTCCTAGG - Intergenic
950166466 3:10804148-10804170 AAACCAGCTGCCACGTTCTGAGG + Intergenic
950205782 3:11079430-11079452 AAACCACCGGCCCCACTCCCAGG - Intergenic
953856446 3:46502967-46502989 AACCCAGAGGCCACTCTCCTTGG - Intergenic
955836904 3:63065876-63065898 AACCCAGCTGCCACGTTCTGAGG + Intergenic
968274723 3:197431655-197431677 AACCCAGCAGCCACGCTATGGGG + Intergenic
968416536 4:440951-440973 AAACCAGAGGCCAGGCGCGGTGG - Intronic
975752221 4:77535638-77535660 AACCCAGCTGCCATGCTACGAGG + Intronic
978559737 4:110020372-110020394 AATCCAGCAGGCATGCTCCGTGG - Intergenic
980405120 4:132345144-132345166 ATCCAAGCGGCCACGCTCCCAGG - Intergenic
990503827 5:56424780-56424802 AAACAAGTGGCCAAGCTCAGTGG - Intergenic
997835730 5:137191932-137191954 AAACAAGCGGCCAGGCGCAGTGG + Intronic
997933722 5:138092578-138092600 AAACCAGCGGCTAAGCTCCCAGG - Intergenic
1004111378 6:12721914-12721936 GAACCAACGGCAAGGCTCCGAGG + Intronic
1005366658 6:25084977-25084999 AATCCAGCAGCCCCGCTCCTAGG + Intergenic
1007584887 6:42983411-42983433 AAACCTGTGGCCAGGCTCGGTGG - Intergenic
1014872598 6:126614701-126614723 AAGCCAGCGGCCACAGTCAGGGG - Intergenic
1034295335 7:149967320-149967342 AAATTAGCGGCCAGGCACCGTGG - Intergenic
1035337709 7:158140717-158140739 GAACCAGCGGCCACGCTGCACGG - Intronic
1036006143 8:4665523-4665545 TAACCAGCTGCCACCCTCTGGGG - Intronic
1038964130 8:32552194-32552216 AAAAAAGCGGCCAAGCGCCGTGG - Intronic
1044896179 8:96894050-96894072 AAGCCAGCTGCCACGCTGGGAGG + Intronic
1056294262 9:85175807-85175829 AAACAAGGGGCCAGGCGCCGTGG + Intergenic
1056856951 9:90139936-90139958 AAACAACCGGCCAGCCTCCGTGG - Intergenic
1057337234 9:94165905-94165927 AAAGCAGCCGCCCCGCCCCGCGG + Intergenic
1185804652 X:3046171-3046193 AAACCAGAGGCCAGGCGCAGTGG - Intronic
1193523989 X:82566571-82566593 AAAGCTGGGGCCACGCTTCGGGG - Intergenic