ID: 1147972778

View in Genome Browser
Species Human (GRCh38)
Location 17:44228597-44228619
Sequence AGAGTTTGAGTCAGAAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147972778_1147972780 -10 Left 1147972778 17:44228597-44228619 CCCAGGCTTCTGACTCAAACTCT No data
Right 1147972780 17:44228610-44228632 CTCAAACTCTCTCACTTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147972778 Original CRISPR AGAGTTTGAGTCAGAAGCCT GGG (reversed) Intergenic
No off target data available for this crispr