ID: 1147972780

View in Genome Browser
Species Human (GRCh38)
Location 17:44228610-44228632
Sequence CTCAAACTCTCTCACTTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147972778_1147972780 -10 Left 1147972778 17:44228597-44228619 CCCAGGCTTCTGACTCAAACTCT No data
Right 1147972780 17:44228610-44228632 CTCAAACTCTCTCACTTAGCTGG No data
1147972776_1147972780 -8 Left 1147972776 17:44228595-44228617 CCCCCAGGCTTCTGACTCAAACT No data
Right 1147972780 17:44228610-44228632 CTCAAACTCTCTCACTTAGCTGG No data
1147972777_1147972780 -9 Left 1147972777 17:44228596-44228618 CCCCAGGCTTCTGACTCAAACTC No data
Right 1147972780 17:44228610-44228632 CTCAAACTCTCTCACTTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147972780 Original CRISPR CTCAAACTCTCTCACTTAGC TGG Intergenic
No off target data available for this crispr