ID: 1147976278

View in Genome Browser
Species Human (GRCh38)
Location 17:44249994-44250016
Sequence CAGTAACCATCCTGTAATGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 99}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147976275_1147976278 3 Left 1147976275 17:44249968-44249990 CCTATTTTACATGTATCTTTGGT 0: 1
1: 0
2: 1
3: 31
4: 364
Right 1147976278 17:44249994-44250016 CAGTAACCATCCTGTAATGTGGG 0: 1
1: 0
2: 1
3: 9
4: 99
1147976271_1147976278 23 Left 1147976271 17:44249948-44249970 CCCTGTGGAGTTTACAAAGCCCT 0: 1
1: 0
2: 0
3: 24
4: 180
Right 1147976278 17:44249994-44250016 CAGTAACCATCCTGTAATGTGGG 0: 1
1: 0
2: 1
3: 9
4: 99
1147976272_1147976278 22 Left 1147976272 17:44249949-44249971 CCTGTGGAGTTTACAAAGCCCTA 0: 1
1: 0
2: 1
3: 9
4: 104
Right 1147976278 17:44249994-44250016 CAGTAACCATCCTGTAATGTGGG 0: 1
1: 0
2: 1
3: 9
4: 99
1147976273_1147976278 4 Left 1147976273 17:44249967-44249989 CCCTATTTTACATGTATCTTTGG 0: 1
1: 0
2: 0
3: 29
4: 365
Right 1147976278 17:44249994-44250016 CAGTAACCATCCTGTAATGTGGG 0: 1
1: 0
2: 1
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147976278 Original CRISPR CAGTAACCATCCTGTAATGT GGG Exonic
901931603 1:12599457-12599479 CCGTCACCTTCCAGTAATGTGGG + Intronic
909335705 1:74470930-74470952 CAGTAGCCCTCCTGGAATGTTGG + Exonic
910859698 1:91731584-91731606 CATTTTCCATCCTGTGATGTGGG - Intronic
916409288 1:164529593-164529615 CTGTAACTATCCTATGATGTAGG + Intergenic
921133770 1:212242199-212242221 GGGTAACAATCCTGTAATTTTGG + Intergenic
923406887 1:233670235-233670257 CAGTAACAAACTGGTAATGTTGG + Intronic
924239686 1:242029348-242029370 CCCAAACCATCCTGTAATGTGGG + Intergenic
924258370 1:242204644-242204666 CAGTAACCATGCTGCAGTGATGG + Intronic
1063988493 10:11534125-11534147 CAGCAAGAATCCTGTTATGTTGG + Intronic
1072741527 10:97912793-97912815 CAGTTTCCTTCCTGTAAAGTGGG + Intronic
1075075798 10:119349477-119349499 CAGTTACCCGCCTGTACTGTGGG + Intronic
1078433427 11:11305010-11305032 CAGTACCCCTCCTCTAGTGTCGG - Intronic
1079406893 11:20155831-20155853 CAGTAACCACCCTATATGGTAGG - Intergenic
1085572502 11:77571707-77571729 CAGGACCCATCCTGTAAGGACGG + Intronic
1087317462 11:96619923-96619945 CAGGTACTATCCTGTAAAGTTGG - Intergenic
1087697606 11:101398087-101398109 CAGGAACAATCTTGTACTGTTGG + Intergenic
1090434497 11:126675584-126675606 CAATCACCAGCATGTAATGTGGG + Intronic
1104738214 12:131153070-131153092 CAGGAACCATCATGTGATGCAGG + Intergenic
1106103048 13:26710596-26710618 CAGTTTCCATGCTGTAAAGTGGG + Intergenic
1107802795 13:44126129-44126151 CAATAAACATCCTATAAAGTTGG - Intergenic
1110967102 13:81713525-81713547 CAGTAACCATCCCGAAGTGCAGG - Intergenic
1112616274 13:101009055-101009077 CTGCAACTATCGTGTAATGTTGG - Intergenic
1113165560 13:107437268-107437290 CACTGACTATCCTGTATTGTTGG + Intronic
1113177834 13:107586279-107586301 TACTAACCATCCTGTGAAGTTGG - Intronic
1116682295 14:47987831-47987853 CAGTTACTATCCTATATTGTAGG + Intergenic
1118466703 14:66037912-66037934 CAGCTGCCATCCTGTATTGTCGG + Intergenic
1120922876 14:89771134-89771156 CTGTAAACATCCTGTGCTGTTGG - Intergenic
1127255228 15:57285206-57285228 AATTTGCCATCCTGTAATGTAGG + Intronic
1134432203 16:14220807-14220829 CTGTTAACATCCTGTAAAGTGGG - Intronic
1134891282 16:17843733-17843755 CAGGTTCCATCCTGTAAGGTGGG + Intergenic
1135647247 16:24173870-24173892 TAATAACAATCCTGTAAGGTAGG - Intronic
1138244683 16:55458708-55458730 CAGTAACCATCCTGAAAGGGTGG + Intronic
1140132803 16:72178871-72178893 CCATAACCACCCTGTAAGGTAGG - Intergenic
1140827772 16:78723664-78723686 CTGAGAGCATCCTGTAATGTTGG + Intronic
1140907639 16:79422749-79422771 CAGTTACCATTCTATTATGTTGG + Intergenic
1141832860 16:86519464-86519486 CAGCAAACATCCTGCACTGTGGG - Intergenic
1142362454 16:89633888-89633910 CAGTCTCCTTCCTGTAATGTGGG - Intronic
1143369632 17:6430481-6430503 CAGTTACCAGCCTGTGATATGGG + Intronic
1145261534 17:21357631-21357653 CAGAAACCAGCCTAGAATGTGGG - Intergenic
1147370171 17:39987073-39987095 CGCTAACCATCTTGTAAGGTAGG - Intronic
1147976278 17:44249994-44250016 CAGTAACCATCCTGTAATGTGGG + Exonic
1152284918 17:79406799-79406821 CAGTAAGCATCCAGCATTGTAGG - Intronic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1154113571 18:11591424-11591446 AGGTAACCATCCTGGAATCTTGG + Intergenic
1164616960 19:29673050-29673072 CAGTTCCCCTCCTGTAAAGTGGG + Intronic
1164835381 19:31352101-31352123 CAGCAACCATACTGCCATGTCGG + Intergenic
926928066 2:18008367-18008389 AAGAAACCAGCCTGAAATGTTGG + Intronic
931688838 2:64818006-64818028 CAGTGACCATCCTGCAATAGAGG - Intergenic
941920048 2:170841266-170841288 CAGTACCCAACCTGGAATCTAGG + Intronic
942645985 2:178111922-178111944 CAGCAACTATCCTGTCAAGTTGG + Intergenic
942895690 2:181051065-181051087 CAATAACTATCCTGTATTTTTGG + Intronic
947047700 2:226006658-226006680 CAGGACCCACCCAGTAATGTAGG - Intergenic
948918279 2:241049277-241049299 CAATAGCCTTCCTGTAATATGGG + Intronic
1182925592 22:34121075-34121097 CACAAACCATCCTGTAATGTTGG - Intergenic
1184697501 22:46148194-46148216 CAGTCTCCATCTTGCAATGTGGG + Intergenic
949621448 3:5817112-5817134 CAGTAAGAATCCTGTTAAGTTGG - Intergenic
952321673 3:32283613-32283635 CAGTAAACATCCTGCTATGTAGG - Intronic
956539934 3:70325234-70325256 CATTAACCATTCTGTTATGCAGG + Intergenic
959200694 3:103242890-103242912 AACTAACCATCCTGTCAAGTTGG + Intergenic
959626406 3:108457047-108457069 CAGTAATCATCCTATTATGTAGG + Intronic
959957310 3:112253069-112253091 AAGTAACCAGACTGTTATGTGGG + Intronic
963390451 3:144657100-144657122 CAATAACAATTCTGTAATCTAGG - Intergenic
964738986 3:159945722-159945744 CAGTGACCATCCTGTACTTGTGG + Intergenic
966276291 3:178174437-178174459 CAGAAAACATCCTGTAAAGTTGG + Intergenic
967040809 3:185690164-185690186 GAGAAACCAGGCTGTAATGTTGG - Intronic
967959989 3:194912756-194912778 CTGTAACAATCCTGTAATAATGG - Intergenic
969267395 4:6073464-6073486 CAGTAATCATCCTTTAAGGGAGG - Intronic
971034998 4:22683387-22683409 CAGCAACCATCCTGTGAATTAGG + Intergenic
972168272 4:36313549-36313571 CAGAAACCATTATGTAATTTTGG - Intronic
978168165 4:105633673-105633695 CAATAAACATACTGTAATTTTGG - Intronic
979048442 4:115899038-115899060 AAGTAACCATGCTGTACTTTAGG - Intergenic
980634826 4:135488239-135488261 CAGTGGCCAGCCTGGAATGTTGG - Intergenic
982851344 4:160319587-160319609 CAGTAGACATCCTGTGAAGTGGG + Intergenic
987012350 5:13780429-13780451 CAATAACTATTCTGAAATGTTGG + Intronic
994728958 5:103469775-103469797 CCTTGACCATCCAGTAATGTGGG - Intergenic
997027526 5:130082821-130082843 CAGTAGTCCTCCTGAAATGTTGG + Intronic
998014600 5:138722265-138722287 CAGTAACCCTCCTTGAATGATGG - Intronic
999334063 5:150700256-150700278 CGGTAACACTCCTGTAATGTAGG - Intronic
999689745 5:154136424-154136446 CAGTAAGAATCCTGTTAGGTTGG + Intronic
1002284079 5:178150690-178150712 CAGTTCCCATCTTGTAAAGTGGG - Intronic
1007797121 6:44358155-44358177 TACTAACAATCCTGTGATGTAGG - Intronic
1015138197 6:129898232-129898254 CAGTTGCCATGCTGTATTGTAGG + Intergenic
1015197255 6:130537206-130537228 AAGTAACCAGACTGTTATGTGGG + Intergenic
1016575869 6:145569267-145569289 CAGTTACTATCATGTAATGATGG - Intronic
1017661192 6:156675495-156675517 GAGTAACCATCATGCACTGTAGG + Intergenic
1018999459 6:168736724-168736746 CAGTAAGAATCCTGTTAGGTCGG - Intergenic
1023298228 7:38739194-38739216 CAAGAACCATTCAGTAATGTAGG - Intronic
1025213138 7:57032755-57032777 CAGTAAAAATACTGTCATGTTGG + Intergenic
1025658814 7:63544069-63544091 CAGTAAAAATACTGTCATGTTGG - Intergenic
1032958775 7:137005125-137005147 TAGTAGCCATCCTAGAATGTAGG - Intronic
1034259016 7:149742581-149742603 CAGTCACCATGCTGGAAGGTGGG + Intergenic
1036680345 8:10867887-10867909 CAGGAAGCATCCTCTAATGATGG + Intergenic
1038496363 8:28006333-28006355 GAGTGACCATCCTGTGCTGTAGG + Intergenic
1039682106 8:39751779-39751801 CAGAAACCTTCTTGTTATGTAGG + Intronic
1039733937 8:40309692-40309714 CAGCAAGAATCCTGTTATGTTGG + Intergenic
1041397414 8:57405720-57405742 CAGTAATCACCCTGAAATGTAGG + Intergenic
1042097175 8:65229463-65229485 CAGCAACCACCCTGTTATTTTGG - Intergenic
1042376731 8:68060866-68060888 CAACAAGCATCCTATAATGTGGG - Intronic
1045175010 8:99713503-99713525 TAGAAACCACCCTGTGATGTTGG + Intronic
1047858962 8:128943634-128943656 AACTAAATATCCTGTAATGTTGG + Intergenic
1048167752 8:132078459-132078481 TAATAACAATCCTGTGATGTTGG - Intronic
1049846206 8:144803046-144803068 CAGACTCCATCCTGTGATGTGGG - Intronic
1051079294 9:13277949-13277971 CAATGAACATCTTGTAATGTTGG - Intronic
1057523691 9:95781251-95781273 TTGCAACCATCCTGAAATGTGGG - Intergenic
1186830693 X:13387158-13387180 CTGCAACAATCCTGTGATGTAGG - Intergenic
1186843952 X:13512572-13512594 CAGTAAGCAACCTGTGATGATGG - Intergenic
1189008998 X:37027134-37027156 AAGTAACCATACTGTTATTTGGG - Intergenic
1193028722 X:76874880-76874902 AAGTAACCAGACTGTTATGTGGG + Intergenic
1198973291 X:142305283-142305305 CAGTTACCATCTTGGAAAGTAGG - Intergenic
1199551822 X:149069244-149069266 CAGACACCTTGCTGTAATGTGGG + Intergenic