ID: 1147978387

View in Genome Browser
Species Human (GRCh38)
Location 17:44260597-44260619
Sequence TCATCTGCAGGGGGTCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147978378_1147978387 -1 Left 1147978378 17:44260575-44260597 CCACAGCACCCCACAACAATCCT 0: 1
1: 0
2: 2
3: 40
4: 530
Right 1147978387 17:44260597-44260619 TCATCTGCAGGGGGTCCAGAAGG 0: 1
1: 0
2: 1
3: 14
4: 174
1147978380_1147978387 -10 Left 1147978380 17:44260584-44260606 CCCACAACAATCCTCATCTGCAG 0: 1
1: 0
2: 0
3: 9
4: 166
Right 1147978387 17:44260597-44260619 TCATCTGCAGGGGGTCCAGAAGG 0: 1
1: 0
2: 1
3: 14
4: 174
1147978379_1147978387 -9 Left 1147978379 17:44260583-44260605 CCCCACAACAATCCTCATCTGCA 0: 1
1: 0
2: 1
3: 13
4: 192
Right 1147978387 17:44260597-44260619 TCATCTGCAGGGGGTCCAGAAGG 0: 1
1: 0
2: 1
3: 14
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147978387 Original CRISPR TCATCTGCAGGGGGTCCAGA AGG Intronic