ID: 1147979271

View in Genome Browser
Species Human (GRCh38)
Location 17:44264830-44264852
Sequence CACCTAAGGTGGCCCCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 3, 3: 4, 4: 115}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147979258_1147979271 18 Left 1147979258 17:44264789-44264811 CCCCAGGAATGTGAGGGCAGGTC 0: 1
1: 1
2: 0
3: 13
4: 182
Right 1147979271 17:44264830-44264852 CACCTAAGGTGGCCCCAGACTGG 0: 1
1: 0
2: 3
3: 4
4: 115
1147979259_1147979271 17 Left 1147979259 17:44264790-44264812 CCCAGGAATGTGAGGGCAGGTCC 0: 1
1: 0
2: 1
3: 9
4: 197
Right 1147979271 17:44264830-44264852 CACCTAAGGTGGCCCCAGACTGG 0: 1
1: 0
2: 3
3: 4
4: 115
1147979256_1147979271 22 Left 1147979256 17:44264785-44264807 CCTTCCCCAGGAATGTGAGGGCA 0: 2
1: 0
2: 2
3: 27
4: 280
Right 1147979271 17:44264830-44264852 CACCTAAGGTGGCCCCAGACTGG 0: 1
1: 0
2: 3
3: 4
4: 115
1147979260_1147979271 16 Left 1147979260 17:44264791-44264813 CCAGGAATGTGAGGGCAGGTCCA 0: 1
1: 0
2: 1
3: 9
4: 192
Right 1147979271 17:44264830-44264852 CACCTAAGGTGGCCCCAGACTGG 0: 1
1: 0
2: 3
3: 4
4: 115
1147979268_1147979271 -4 Left 1147979268 17:44264811-44264833 CCAAGGGGAGGACAGGGGTCACC 0: 1
1: 0
2: 1
3: 22
4: 208
Right 1147979271 17:44264830-44264852 CACCTAAGGTGGCCCCAGACTGG 0: 1
1: 0
2: 3
3: 4
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147979271 Original CRISPR CACCTAAGGTGGCCCCAGAC TGG Intronic
900525109 1:3124743-3124765 CACCTAAGGTGGGCCCCAGCAGG + Intronic
901021252 1:6257092-6257114 CATCCAAGGTGGGCCCAGATGGG + Intronic
901196936 1:7445517-7445539 CACCCAAGGTGACCCTGGACGGG + Intronic
907727838 1:57036423-57036445 CTCCAAAGGTTGCCCCAAACAGG - Intronic
907879009 1:58526189-58526211 CACATAAGGGGGCCACAGATTGG - Intronic
908559650 1:65292871-65292893 CAGCTGAGGTTGGCCCAGACTGG - Intronic
909607115 1:77518763-77518785 CCCCAAAGGTCTCCCCAGACAGG - Intronic
912073075 1:105838762-105838784 CAGCTGAGGTGGCCTCAGATGGG + Intergenic
920951088 1:210572467-210572489 CATCTAAGGTGGCCACAGGTGGG - Intronic
921180927 1:212630613-212630635 CACCTACGATGGGCCAAGACGGG + Intergenic
921366392 1:214378728-214378750 CATCTTAGGTGACCCCAGCCAGG - Intronic
922492863 1:226032463-226032485 CAAATATGATGGCCCCAGACTGG - Intergenic
924739717 1:246787978-246788000 GACCCAAGGTGGCTCCAGACTGG + Intergenic
1063685696 10:8235635-8235657 CACCTAAGGTGAACCTTGACAGG + Intergenic
1064327792 10:14366826-14366848 CACATCAGCTGGCCCCAGCCAGG + Intronic
1066653180 10:37678860-37678882 CTTCTAAGGTGCCCCCAGACTGG + Intergenic
1067037536 10:42931401-42931423 CTTCTAAGGAGCCCCCAGACTGG + Intergenic
1067225564 10:44373795-44373817 CACCGTAGGTGGCCCCAGGTGGG + Intronic
1068237584 10:54259296-54259318 GACCTAAGGTGACCCCAGACAGG - Intronic
1069810384 10:71155119-71155141 GGACTAAGGTGGCCCCCGACAGG + Intergenic
1071813365 10:89207207-89207229 CTCCTCAGGTGGTCCCAGAGGGG + Exonic
1073638045 10:105219550-105219572 CATGTAAGTTGGCCCCAGGCTGG - Intronic
1076942350 10:133618245-133618267 CACCTGAGCTGGCCCCAGTGAGG - Intergenic
1077224250 11:1433209-1433231 CACAAAAGATGGCCCCAAACAGG - Intronic
1077364875 11:2157589-2157611 CACCCAAGGTGGTGCCTGACAGG + Intronic
1078271768 11:9801851-9801873 CAGCTAAGCTGCCCCCACACAGG - Intronic
1079345013 11:19644405-19644427 TTCCTATGGTGGCCCCAGGCCGG + Intronic
1084689235 11:70715457-70715479 CTCCTACGGTGTCCCCAGCCTGG - Intronic
1084711296 11:70845509-70845531 CACCTAAGATGGCCCCGTGCTGG - Intronic
1084760912 11:71270320-71270342 CCCCTTAGGTGCCCCCAGTCCGG + Intergenic
1089295040 11:117462258-117462280 CACCTAAGCTGGTCTCAGAGAGG - Intronic
1091443161 12:527341-527363 CCCCTAAGGGGGCCCAAGAGAGG - Intronic
1105222429 13:18344340-18344362 CACCTACGGAGGCCCAATACTGG - Intergenic
1121114025 14:91331133-91331155 CACGGCAGGTGGCTCCAGACTGG + Intronic
1124579987 15:30945110-30945132 CACCTAAGGTGGCCTCAGAATGG + Intronic
1125038182 15:35151497-35151519 CACAGATGGTGGCCCCAGCCTGG - Intergenic
1132329355 15:101000931-101000953 CATCTAAGGTGGCCCATGGCAGG - Intronic
1136746303 16:32594945-32594967 CACCTCAGCTGGCCCCAGTGAGG - Intergenic
1141433188 16:83981403-83981425 CCCTTAAGGGGTCCCCAGACAGG + Intronic
1203048432 16_KI270728v1_random:854149-854171 CACCTCAGCTGGCCCCAGTGAGG - Intergenic
1143775810 17:9198082-9198104 AACCTCAGGGGGCCCGAGACAGG + Intronic
1146578463 17:34014599-34014621 CACCAAACGTGGCCACAGGCAGG + Intronic
1147967021 17:44199283-44199305 CGCCCAAGGGGGACCCAGACGGG + Intronic
1147979271 17:44264830-44264852 CACCTAAGGTGGCCCCAGACTGG + Intronic
1149589953 17:57821697-57821719 GGCTTAAGGTGGTCCCAGACTGG - Intergenic
1151477198 17:74350832-74350854 CACCCGAGGTGGCCGCAGCCCGG + Exonic
1152814130 17:82397533-82397555 CACCTGAGGAGGCCCCTAACAGG + Intronic
1153389883 18:4544558-4544580 CACAGATGGTGGCCCCAGCCAGG - Intergenic
1159579172 18:70216149-70216171 CACCTCATGTGGCCCAGGACAGG + Intergenic
1164418108 19:28062970-28062992 CACCTAAGCTGGGCCCAGTAAGG + Intergenic
1164581235 19:29436525-29436547 TGCCCAAGATGGCCCCAGACTGG + Intergenic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
925140561 2:1547230-1547252 CACACAGGGTGGCCCCACACAGG + Intergenic
925265488 2:2563691-2563713 CCCCAAAGGTGGCACCAGCCTGG + Intergenic
928963880 2:36957599-36957621 AAAATAAAGTGGCCCCAGACTGG + Intronic
934181503 2:89626454-89626476 CACCTACGGAGGCCCAATACTGG + Intergenic
940142536 2:150509068-150509090 AACCAAAGGTGTCCCCAGAAGGG + Intronic
942088122 2:172462306-172462328 CACCTCAGGTGGTCCCACAGGGG - Intronic
944929021 2:204497120-204497142 CACCTAAGGGGGCACCATTCAGG + Intergenic
948295351 2:236856451-236856473 CACCTGAGCAGGACCCAGACTGG + Intergenic
948427388 2:237896405-237896427 CTGCTATGGTGGCCCCAGGCCGG - Intronic
948595549 2:239077112-239077134 CACCTAAGCTGCCACAAGACGGG + Intronic
948709222 2:239815110-239815132 CACCTGAGCTGACCCCTGACAGG - Intergenic
1173747380 20:45448278-45448300 CATCTGAGGATGCCCCAGACAGG + Intergenic
1175714312 20:61245501-61245523 AACCCAAGGTGGCCCCTTACTGG + Intergenic
1176086482 20:63297610-63297632 CACCCAGGGAGGCCCCAGCCTGG - Intronic
1176730977 21:10496763-10496785 CACCTACGGAGGCCCAATACTGG - Intergenic
1181039994 22:20187588-20187610 CACCCAGAGTGGCCTCAGACAGG - Intergenic
1181925868 22:26358058-26358080 CTCCTACGGTGGCCACAGTCTGG - Intronic
1184757575 22:46525728-46525750 CAGCTAAGGTGGCCGCTGCCAGG + Intronic
949548140 3:5090189-5090211 CACGTAAGGTGGCCTCATTCTGG + Intergenic
950003492 3:9676059-9676081 TCCCTGAGGTGGCCTCAGACAGG + Intronic
956668084 3:71660830-71660852 CACCTGTGATGGCCCCAGACTGG - Intergenic
961360724 3:126365489-126365511 CAAGGAAGGTTGCCCCAGACAGG - Intergenic
962534659 3:136317047-136317069 AACCTAAGGTGGCCTCAGGTAGG + Exonic
962707900 3:138062760-138062782 GACCTGAGCTGGCCCCAGCCAGG + Exonic
966887719 3:184386123-184386145 CACCAAGGGTAGCCCCAGAGGGG + Exonic
975023626 4:69521323-69521345 GACCTAAGGTCTCCCCAGCCAGG + Intronic
977958853 4:103061701-103061723 CACTCAAGGTGGCCCCACCCTGG - Intronic
983080474 4:163379589-163379611 CACCTAAGGTGGCTACACACAGG + Intergenic
983350287 4:166577940-166577962 CACCTAAGCTGTCCCCAAAATGG - Intergenic
984705560 4:182844927-182844949 CACATAAGGTGGCCTCTGAATGG - Intergenic
985519120 5:363003-363025 CCACTAATGTGGCCCCACACAGG + Intronic
985913876 5:2903226-2903248 GAGTTATGGTGGCCCCAGACGGG - Intergenic
997688170 5:135804144-135804166 CACAGAAGGTGTCCACAGACAGG + Intergenic
998805324 5:145912735-145912757 GGCCTAAGGTGGCACCAGCCTGG + Intergenic
998855931 5:146395192-146395214 CATCTAAGATGGCTCCATACTGG - Intergenic
999431822 5:151531396-151531418 CACATAAGCTGGCCCCAGGGTGG + Intronic
1001199932 5:169706911-169706933 CACCAAAGCTGGCCACATACAGG - Intronic
1001985729 5:176073329-176073351 CACCTCAGCTGGCCCCAGTGAGG - Intronic
1002231142 5:177764795-177764817 CACCTCAGCTGGCCCCAGTGAGG + Intronic
1002264195 5:178018953-178018975 CACCTCAGCTGGCCCCAGCGAGG - Intronic
1002456297 5:179346797-179346819 CACCTAAGGGTGCCCGAGGCTGG + Intergenic
1002861690 6:1085113-1085135 CACCTTAAGTGGCTCCAGAAGGG + Intergenic
1007959136 6:45942764-45942786 CACCTAACATGGCCCCAAAAGGG - Intronic
1009856666 6:69273885-69273907 CACCTCAGGTGGCTGCTGACTGG - Intronic
1012132132 6:95509743-95509765 CACTTAAGGTGACCCCAGCTGGG - Intergenic
1015092041 6:129369902-129369924 CACCTCAGCGGGCCCCAGAGAGG + Exonic
1020435321 7:8156087-8156109 CACCTGACCTGGCTCCAGACAGG - Intronic
1023710602 7:42988354-42988376 CACCTAAGATTGCCCAAGATGGG + Intergenic
1024807703 7:53165128-53165150 AACATAAGGTGGTCCCAGAATGG + Intergenic
1028417281 7:90594775-90594797 CACCAAGGGTGGCCTCATACCGG - Intronic
1034598604 7:152224745-152224767 CACCTACGGAGGCCCAATACTGG + Intronic
1034692209 7:153022993-153023015 AACCCAGGGTGGCCCCACACGGG - Intergenic
1035016071 7:155767305-155767327 CACCACAGGTGGCACCTGACGGG - Intronic
1036532672 8:9609313-9609335 GATTTAAGGTGGCCCCAGATTGG - Intronic
1037766191 8:21773839-21773861 CAACAAAGATGTCCCCAGACAGG - Intronic
1039229464 8:35427348-35427370 CACCCAAGGTAGCCCCAGGTGGG - Intronic
1040676617 8:49757866-49757888 AACTTAAGGTCTCCCCAGACTGG + Intergenic
1042168806 8:65972982-65973004 AACTTAAGGTGGCCCTAGGCAGG - Intergenic
1046108335 8:109692075-109692097 CTCCTTAGCTGTCCCCAGACAGG - Intergenic
1055785104 9:79863349-79863371 CACCTAAGCAGGTCCCAGCCAGG + Intergenic
1057885999 9:98830254-98830276 TCCCTAAGGTGGCCCCAGACAGG + Intronic
1060494892 9:124111440-124111462 CACCTAAGATGGAGCCAGAGAGG + Intergenic
1060542416 9:124439868-124439890 CACCTATGGGGGCACCTGACAGG - Intergenic
1061398523 9:130356080-130356102 CACCTTAGGTGGCTGCAGAATGG + Intronic
1062575149 9:137203073-137203095 CACCGCATCTGGCCCCAGACAGG + Intronic
1192235954 X:69296183-69296205 CAGCTAAGGTGGCGGCAGAGGGG + Intergenic
1201569317 Y:15397698-15397720 GGCCTAAGGTGGGCCCTGACTGG + Intergenic
1201789686 Y:17825768-17825790 CACATACAGTGGCCCTAGACTGG + Intergenic
1201811868 Y:18080221-18080243 CACATACAGTGGCCCTAGACTGG - Intergenic
1202351337 Y:23995517-23995539 CACATACAGTGGCCCTAGACTGG + Intergenic
1202519442 Y:25674602-25674624 CACATACAGTGGCCCTAGACTGG - Intergenic