ID: 1147979671

View in Genome Browser
Species Human (GRCh38)
Location 17:44266735-44266757
Sequence CAAAACTTGGGGCAGCGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 62}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147979671_1147979678 13 Left 1147979671 17:44266735-44266757 CCAGATCGCTGCCCCAAGTTTTG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1147979678 17:44266771-44266793 CACCTGGCCAGCTAGCCAGCTGG 0: 1
1: 0
2: 3
3: 17
4: 191
1147979671_1147979681 19 Left 1147979671 17:44266735-44266757 CCAGATCGCTGCCCCAAGTTTTG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1147979681 17:44266777-44266799 GCCAGCTAGCCAGCTGGCCAGGG 0: 1
1: 0
2: 4
3: 26
4: 297
1147979671_1147979676 -3 Left 1147979671 17:44266735-44266757 CCAGATCGCTGCCCCAAGTTTTG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1147979676 17:44266755-44266777 TTGGAAGTGCACCAAACACCTGG 0: 1
1: 0
2: 0
3: 9
4: 104
1147979671_1147979683 24 Left 1147979671 17:44266735-44266757 CCAGATCGCTGCCCCAAGTTTTG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1147979683 17:44266782-44266804 CTAGCCAGCTGGCCAGGGCCAGG 0: 1
1: 0
2: 3
3: 41
4: 288
1147979671_1147979680 18 Left 1147979671 17:44266735-44266757 CCAGATCGCTGCCCCAAGTTTTG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1147979680 17:44266776-44266798 GGCCAGCTAGCCAGCTGGCCAGG 0: 1
1: 0
2: 6
3: 38
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147979671 Original CRISPR CAAAACTTGGGGCAGCGATC TGG (reversed) Intronic
903884474 1:26532807-26532829 CAGAACTGGGGGCAGTGGTCTGG + Intronic
903930319 1:26858197-26858219 CAGAGCTCGGGGCAGAGATCAGG - Intergenic
911357236 1:96837555-96837577 CAGAACTTGAGGCAAAGATCTGG - Intergenic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
919749302 1:201026517-201026539 AGCAACTTGGGGCAGCCATCTGG + Intergenic
1064307524 10:14181367-14181389 GCAAACACGGGGCAGCGATCTGG - Intronic
1067063438 10:43089900-43089922 CAGGACTTGGGGCAGAGATCGGG + Intronic
1068679216 10:59801152-59801174 TAAAACTTGGGGCAGTGAGAAGG - Intronic
1069875253 10:71559005-71559027 CAAGAGTTGGGGAAGGGATCTGG + Intronic
1082205634 11:49430612-49430634 AAAAACTTGGAGCATCTATCTGG + Intergenic
1085607384 11:77914203-77914225 CCAAACTTAGGACAGTGATCTGG + Intronic
1086599554 11:88616172-88616194 CAAAACTTGGGTCAGGGACCAGG - Intronic
1090627629 11:128619981-128620003 CCAACCCTGGGGCAGAGATCAGG + Intergenic
1101731311 12:107428696-107428718 CAAACCCTGGGGCAGGGATTTGG - Intronic
1104927985 12:132323531-132323553 CGAATCTGGGGGCAGCGATGGGG + Intronic
1109124935 13:58505698-58505720 CCACACTTGGGGCAGCCAGCCGG - Intergenic
1116303658 14:43218773-43218795 TAAATCTTGGGGCAGAGATATGG - Intergenic
1119726547 14:76924967-76924989 CACATCTGGGGGCAGTGATCTGG - Intergenic
1119882998 14:78116377-78116399 GAAAACTTGGGAAAGCCATCAGG + Intergenic
1120693924 14:87622829-87622851 CCAAAGTTGGGGGAGGGATCTGG - Intergenic
1131432921 15:92401032-92401054 CAAGACTTGGGGCAGCTGTGTGG + Intronic
1136850157 16:33606196-33606218 CAACACTGGGGGCGTCGATCAGG - Intergenic
1203111770 16_KI270728v1_random:1454649-1454671 CAACACTGGGGGCGTCGATCAGG - Intergenic
1143017563 17:3899020-3899042 CAAACCTTGGGGAAGGGATGAGG + Exonic
1147603267 17:41758875-41758897 CAAAAAAAGGGGCAGTGATCAGG + Intronic
1147979671 17:44266735-44266757 CAAAACTTGGGGCAGCGATCTGG - Intronic
1155553359 18:26990983-26991005 AGAAACTTGGGGCTGAGATCTGG + Intronic
1157194107 18:45606378-45606400 CAAAATTTGGGGCAGGGTTGCGG + Intronic
1158525983 18:58214161-58214183 CTAACCCTGGGGCAGCGATCAGG - Intronic
1165030686 19:32996029-32996051 CAACACTGGGGGCGTCGATCAGG + Exonic
927517559 2:23681030-23681052 CAAAACATGGGGCAGGGAGGAGG + Intronic
936540218 2:113343789-113343811 CAGAACTTGAGGAAGAGATCAGG - Intergenic
937804774 2:126126487-126126509 CAAAACTTGGGTTTGAGATCTGG + Intergenic
938644975 2:133321085-133321107 CAAGACATGGGTCAGTGATCAGG - Intronic
939998568 2:148943667-148943689 CAGCACTTGGGGCAGCTATAAGG - Intronic
941650889 2:168091465-168091487 CAGGACTTGGGGCAGCTTTCTGG - Intronic
948210435 2:236189163-236189185 CAAAACTTCAGGCAGCTATGGGG + Intergenic
1170985151 20:21251222-21251244 CACACCTTGGGGCAGGGATTGGG + Intergenic
1171291261 20:23984332-23984354 CAACACCTGGGGCAGGGTTCTGG - Intergenic
1172949475 20:38713498-38713520 CAAAACTTGGGGAATCGAAGAGG + Intergenic
1177131025 21:17255695-17255717 CAAAACTTGGGGGAGGAATGGGG + Intergenic
1181400699 22:22648603-22648625 CAACACCTGGGGCAGGGTTCTGG + Intergenic
1181702679 22:24629701-24629723 CAACACCTGGGGCAGGGTTCTGG + Intergenic
1182997120 22:34824259-34824281 CAAAACTAGAGGCAGGGAACTGG + Intergenic
954132216 3:48566623-48566645 CAAGGCTTGGGTCAGAGATCGGG - Intronic
968526719 4:1061872-1061894 CATAATTTGGGGCTGCAATCTGG - Intronic
968971125 4:3795397-3795419 CAAACATTGGGGAAGCCATCTGG - Intergenic
969047463 4:4346791-4346813 CAAAAGCTGGGGCAGGGATCGGG + Intergenic
971755621 4:30704338-30704360 CAAGAATTTGGGCAGGGATCAGG + Intergenic
986692090 5:10321390-10321412 CAAAACTTGGTGCATCTACCAGG + Intergenic
998897791 5:146818470-146818492 TAAATCTTGGGGCAGGGATGGGG - Intronic
998932771 5:147199708-147199730 CAAATGTCGGGGCAGCTATCAGG - Intergenic
999081727 5:148850632-148850654 CAAAACTGGGGCCAGCAACCAGG + Intergenic
1003419635 6:5945442-5945464 CAAAACTTGGGACAGTTGTCAGG + Intergenic
1008063891 6:47026977-47026999 CAGAACTAGGGGCAGGGACCAGG - Intronic
1011662369 6:89605514-89605536 AAAAAGTTGGGGAATCGATCAGG + Intronic
1016698429 6:147025773-147025795 CACAACCTGGGGCAGAGATGAGG - Intergenic
1021274112 7:18627752-18627774 CAAAAGGTGGGGCAGAGATCAGG - Intronic
1025262114 7:57426408-57426430 CACAACGTGGGGCAGCGTCCTGG - Intergenic
1026146824 7:67753831-67753853 CAAAACCTGGGACAGGGATTGGG - Intergenic
1030398989 7:109025122-109025144 CTAAACTTGGGGGAACAATCAGG + Intergenic
1034531575 7:151699149-151699171 CACAACTTGGGGCAGGGATGGGG - Intronic
1044474121 8:92606208-92606230 AAAAGCTTGGTGCAGTGATCTGG + Intergenic
1051760983 9:20464083-20464105 CAAACCTTGGGACAGCCCTCTGG + Intronic
1059233516 9:112742766-112742788 CAGAACCTGGGGCAAGGATCTGG + Intergenic
1061458138 9:130713505-130713527 CCAAAGTTGGGGCCGGGATCCGG - Intergenic
1061895669 9:133646048-133646070 CAAAACTTGGAGCCGGGAGCTGG - Intronic
1061976543 9:134070752-134070774 CAAAGGTTGGGGCTGTGATCAGG + Intergenic
1062116746 9:134813712-134813734 CAACCCTTGGAGCAGCGCTCCGG + Intronic