ID: 1147983444

View in Genome Browser
Species Human (GRCh38)
Location 17:44289557-44289579
Sequence ACACCATGCCTGGCTAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147983437_1147983444 10 Left 1147983437 17:44289524-44289546 CCCATCCCCAGTAGCTGGGATTA 0: 2
1: 24
2: 124
3: 412
4: 887
Right 1147983444 17:44289557-44289579 ACACCATGCCTGGCTAAGACAGG No data
1147983442_1147983444 3 Left 1147983442 17:44289531-44289553 CCAGTAGCTGGGATTACAGGCAC 0: 1182
1: 4318
2: 7389
3: 7496
4: 7376
Right 1147983444 17:44289557-44289579 ACACCATGCCTGGCTAAGACAGG No data
1147983436_1147983444 11 Left 1147983436 17:44289523-44289545 CCCCATCCCCAGTAGCTGGGATT 0: 4
1: 35
2: 900
3: 2114
4: 3008
Right 1147983444 17:44289557-44289579 ACACCATGCCTGGCTAAGACAGG No data
1147983435_1147983444 12 Left 1147983435 17:44289522-44289544 CCCCCATCCCCAGTAGCTGGGAT 0: 2
1: 8
2: 198
3: 2246
4: 5067
Right 1147983444 17:44289557-44289579 ACACCATGCCTGGCTAAGACAGG No data
1147983431_1147983444 26 Left 1147983431 17:44289508-44289530 CCTCCTGCTTCAGTCCCCCATCC No data
Right 1147983444 17:44289557-44289579 ACACCATGCCTGGCTAAGACAGG No data
1147983441_1147983444 4 Left 1147983441 17:44289530-44289552 CCCAGTAGCTGGGATTACAGGCA 0: 52453
1: 101789
2: 153905
3: 227834
4: 315316
Right 1147983444 17:44289557-44289579 ACACCATGCCTGGCTAAGACAGG No data
1147983432_1147983444 23 Left 1147983432 17:44289511-44289533 CCTGCTTCAGTCCCCCATCCCCA No data
Right 1147983444 17:44289557-44289579 ACACCATGCCTGGCTAAGACAGG No data
1147983438_1147983444 9 Left 1147983438 17:44289525-44289547 CCATCCCCAGTAGCTGGGATTAC 0: 56
1: 1399
2: 3461
3: 4306
4: 7212
Right 1147983444 17:44289557-44289579 ACACCATGCCTGGCTAAGACAGG No data
1147983440_1147983444 5 Left 1147983440 17:44289529-44289551 CCCCAGTAGCTGGGATTACAGGC 0: 3506
1: 119699
2: 256853
3: 227930
4: 381675
Right 1147983444 17:44289557-44289579 ACACCATGCCTGGCTAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147983444 Original CRISPR ACACCATGCCTGGCTAAGAC AGG Intergenic
No off target data available for this crispr