ID: 1147985335

View in Genome Browser
Species Human (GRCh38)
Location 17:44303772-44303794
Sequence AGAGAGAAACGGGCTGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147985335_1147985341 2 Left 1147985335 17:44303772-44303794 CCGTCCCCAGCCCGTTTCTCTCT No data
Right 1147985341 17:44303797-44303819 CTTTTTTTTTTTTTTGAAACAGG 0: 62
1: 1673
2: 17649
3: 25425
4: 65057
1147985335_1147985342 22 Left 1147985335 17:44303772-44303794 CCGTCCCCAGCCCGTTTCTCTCT No data
Right 1147985342 17:44303817-44303839 AGGCTTTCGCTTTGTCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147985335 Original CRISPR AGAGAGAAACGGGCTGGGGA CGG (reversed) Intergenic
No off target data available for this crispr