ID: 1147987224

View in Genome Browser
Species Human (GRCh38)
Location 17:44313581-44313603
Sequence CAGGAACTGAAGGATGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 326}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147987224_1147987232 30 Left 1147987224 17:44313581-44313603 CCTGCAGCATCCTTCAGTTCCTG 0: 1
1: 0
2: 2
3: 34
4: 326
Right 1147987232 17:44313634-44313656 CTGATTTCCCTCTTCCAGCCTGG 0: 1
1: 0
2: 1
3: 25
4: 274
1147987224_1147987228 7 Left 1147987224 17:44313581-44313603 CCTGCAGCATCCTTCAGTTCCTG 0: 1
1: 0
2: 2
3: 34
4: 326
Right 1147987228 17:44313611-44313633 AGTCCCAGCACCAGCACACATGG 0: 1
1: 0
2: 5
3: 50
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147987224 Original CRISPR CAGGAACTGAAGGATGCTGC AGG (reversed) Intronic
900697105 1:4019282-4019304 CAGGAGCTCAAGGAGGCAGCTGG - Intergenic
901049065 1:6417227-6417249 CAGGATATGAAGGAAGCTGTAGG - Exonic
902136094 1:14306793-14306815 CAGGAACTTTGAGATGCTGCTGG - Intergenic
902491165 1:16781718-16781740 CAGGAATTGAGGGATACGGCTGG - Intronic
902735034 1:18394844-18394866 CAGAGACTGTAGGATGCTGGTGG + Intergenic
902929329 1:19719600-19719622 CAGGAGCTCAAGGTTGCAGCAGG - Intronic
903976320 1:27152811-27152833 CAGGAGCTGAGCGGTGCTGCCGG - Intronic
904496864 1:30892038-30892060 CAGGACCTGCAGGAGGCTGGAGG - Intronic
904967137 1:34383913-34383935 CAGGAACAGAAGCCTGCTGCTGG + Intergenic
905029265 1:34870572-34870594 CAGGCCCAGAAGGATGCTGCAGG + Intronic
905300767 1:36985022-36985044 CAGGAACAGAAAGATGATTCTGG + Intronic
906551783 1:46671567-46671589 CAGGTACTTACGGATGTTGCTGG - Intronic
906747177 1:48230285-48230307 GAGGAAGTGAAGGAAGGTGCTGG - Intronic
908474601 1:64475039-64475061 CAGGAACTGAAGGACTCAGCTGG + Intronic
908801842 1:67888712-67888734 AAGGAGCTGAAAGAAGCTGCAGG + Intergenic
909347374 1:74606804-74606826 GAGGAACTGAAGAAGGCTGAGGG - Exonic
909355382 1:74702847-74702869 AAGGAGCTGAAGGATACTGTGGG + Intergenic
909865609 1:80665690-80665712 CAGGCACTGAAACATGCTGATGG - Intergenic
911677051 1:100670670-100670692 CAGGAACTTAAGCATCTTGCAGG + Intergenic
913031115 1:114903525-114903547 GATGAAGTGAAAGATGCTGCTGG + Intronic
913189604 1:116402512-116402534 CAGGAAGTGAATGAGGCTGATGG - Intronic
914414951 1:147471113-147471135 CATGAACTGCAGGAAGCTGGGGG + Intergenic
918166322 1:181951997-181952019 TAGAAACTAAAGTATGCTGCTGG - Intergenic
918667700 1:187172287-187172309 CAGGAAGTGACAGCTGCTGCAGG - Intergenic
919059223 1:192609294-192609316 GAGGAACTGCAGAATGCTGCCGG - Intergenic
919469951 1:197965804-197965826 AAGGAATTGAGGGATGTTGCTGG + Intergenic
919802278 1:201361151-201361173 CAGGAGCTGAAGGGGGCTGTTGG + Intronic
922894579 1:229090174-229090196 CAGGAACAGAATGATGCCTCTGG - Intergenic
922913822 1:229239495-229239517 GATGAACTGAAGGATGGTGAAGG + Intergenic
923529278 1:234800816-234800838 CAGGAATTGAGGGATACGGCTGG + Intergenic
1063090158 10:2858129-2858151 TAGGAACAGAAAGATCCTGCTGG - Intergenic
1063379237 10:5574115-5574137 CAGGCACTGCAGGAAGTTGCTGG - Intergenic
1064105498 10:12497777-12497799 CAGTAGATGAAGGATGTTGCAGG + Intronic
1067800030 10:49352547-49352569 CAGGAACTGAGGGAGGCCTCAGG - Intergenic
1068030453 10:51698838-51698860 GAGGAGCTGGAGGATTCTGCTGG + Exonic
1069615770 10:69805267-69805289 CAAAAACAGAAGGCTGCTGCAGG + Intronic
1069905100 10:71727544-71727566 CAGGAACTGGAGGATGTGGATGG - Intronic
1071829859 10:89360910-89360932 GAGGCAAGGAAGGATGCTGCGGG - Intronic
1074696162 10:116051705-116051727 CTGTCACTGAAGGATGCTTCAGG - Intergenic
1074772697 10:116743594-116743616 CTGGAAGTGAGGGATGCTGGTGG - Intergenic
1075630488 10:123997905-123997927 CACTAACTGAAGGATGTGGCAGG - Intergenic
1075668268 10:124245831-124245853 CAGGGACTGCAGGAGGATGCTGG + Intergenic
1075679531 10:124322494-124322516 AAGGAACAGCAGGATGCTGAGGG - Intergenic
1076704801 10:132295338-132295360 CGGGCACTGCACGATGCTGCAGG - Intronic
1076833954 10:133010567-133010589 CAGGTTCTGAGGGCTGCTGCTGG + Intergenic
1077425047 11:2471490-2471512 CAGGACTTGGAGGATGCTGATGG + Intronic
1077578383 11:3401664-3401686 CAGGAAAAGAAGGATGCTTGGGG - Intergenic
1077601623 11:3578735-3578757 CATGACCTGAAGGATGATGGAGG - Intergenic
1080624678 11:34017568-34017590 CAGTAACTCAAGCATGCTGCAGG + Intergenic
1082205604 11:49430322-49430344 AAGGAACAGAAGTATGCTTCTGG + Intergenic
1082963977 11:58947140-58947162 CAGGGACTCAGGGATGCTCCTGG - Intronic
1084257529 11:67953292-67953314 CATGACCTGAAGGATGATGGAGG - Intergenic
1084671269 11:70607917-70607939 CAGGAACGCAAGGATGGAGCTGG - Intronic
1084815243 11:71641949-71641971 CATGACCTGAAGGATGATGCAGG + Intergenic
1085328640 11:75628256-75628278 GAGGGACTGCAGGATGCTGGGGG + Intronic
1087562783 11:99812817-99812839 CAGGAACTGAGCGATGATGGCGG + Intronic
1088360363 11:108982938-108982960 CAGGAACTCATGGATGCTGAAGG - Intergenic
1088793731 11:113249442-113249464 CAGGGACTGTGGGCTGCTGCTGG + Intronic
1089384621 11:118059655-118059677 CTGAAACTGAAGGATCCTGACGG - Intergenic
1089868555 11:121652549-121652571 CTGGACTTGAAGGATGCTGTTGG - Intergenic
1090273592 11:125404520-125404542 CCAGAACGGAGGGATGCTGCCGG + Intronic
1091337063 11:134779983-134780005 CAGTAACTGAATGATGCTTTTGG + Intergenic
1091859350 12:3765448-3765470 GAGGAAAGCAAGGATGCTGCAGG + Intergenic
1092427049 12:8383125-8383147 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
1092427758 12:8388088-8388110 CATGACCTGAAGGATGATGGAGG - Intergenic
1092429028 12:8395069-8395091 CATGACCTGAAGGATGATGGAGG - Intergenic
1092834013 12:12471088-12471110 CAGGAAATGCAGGATGTGGCCGG - Intergenic
1092999111 12:13979270-13979292 CTGGAATTGAAGGATGCTGCAGG - Intronic
1093351259 12:18105544-18105566 CAGGAGCTGAACCAGGCTGCGGG - Intronic
1093958761 12:25250787-25250809 CAGGCACTGAAGGCGGCGGCGGG - Exonic
1096795016 12:54071344-54071366 CAAAAACTGAAGGATGCTGGGGG + Intergenic
1097700719 12:62817672-62817694 CATGAAATGAAGGTTGCTTCTGG - Intronic
1097913075 12:64991450-64991472 TAGCAACTGAAGCATGCAGCAGG + Intergenic
1098097830 12:66978990-66979012 CAGAGACTGAGGCATGCTGCTGG - Intergenic
1099644109 12:85328366-85328388 CAGGCACTGCAAGATGCTCCAGG + Intergenic
1100064230 12:90621849-90621871 CAGGTTATGATGGATGCTGCTGG + Intergenic
1101652972 12:106694430-106694452 AGGGGCCTGAAGGATGCTGCAGG + Intronic
1101711219 12:107268564-107268586 CAGGATCTCAATGATCCTGCAGG + Intergenic
1102233273 12:111278089-111278111 CAGGGACTGAAGGTTGCAGATGG - Intronic
1102451067 12:113042528-113042550 AAGGGACTGGAGGGTGCTGCTGG + Intergenic
1103862737 12:124027377-124027399 AGGGAAATGAAGGAGGCTGCTGG - Intronic
1104776337 12:131392213-131392235 CATGAAGGGATGGATGCTGCTGG + Intergenic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1106281270 13:28274179-28274201 GAAGAACAGAATGATGCTGCTGG - Intronic
1106585343 13:31052265-31052287 CAGGATCTGTGGGATCCTGCAGG - Intergenic
1111589043 13:90320264-90320286 CTGGCACTCCAGGATGCTGCAGG - Intergenic
1113862515 13:113497860-113497882 GAAGAACTGATGGATGATGCTGG - Intronic
1113957593 13:114107565-114107587 CCGGAACTCCAGGCTGCTGCGGG + Intronic
1114176880 14:20330143-20330165 CTGGAGCTGCTGGATGCTGCTGG + Intronic
1116869919 14:50061065-50061087 CAGATACCCAAGGATGCTGCAGG + Intergenic
1116997400 14:51337867-51337889 CAGAATCTGGAGGATGCTGGAGG + Intergenic
1118354946 14:65005711-65005733 CAGGAATTCAAGGCTGCTGTGGG - Intronic
1118990365 14:70791986-70792008 CAAGAACTGAAAGATGCAACAGG + Intronic
1119047481 14:71332253-71332275 CAGGGACTGGTGGCTGCTGCTGG + Intronic
1119774068 14:77237710-77237732 CAGTATTTGAAGCATGCTGCAGG + Intronic
1121513620 14:94534287-94534309 CAGGATCTGAGGTATGCTGATGG - Intergenic
1121906515 14:97751007-97751029 CAGGAACTGGAGAAGGCTGAGGG + Exonic
1121938639 14:98045205-98045227 CAGCAACTGATGGCTGCTGCAGG - Intergenic
1122180919 14:99953979-99954001 CAGGAGCTGAGAGATGGTGCTGG - Intergenic
1124105046 15:26729722-26729744 GAGGAAGTGAAGGAGCCTGCTGG - Intronic
1124195023 15:27617684-27617706 CTGGAACTGCATGATACTGCAGG - Intergenic
1125726293 15:41869995-41870017 CAGGAACTGCTGGAGACTGCAGG - Exonic
1126728085 15:51653411-51653433 CAGGCACTACAAGATGCTGCAGG + Intergenic
1128157762 15:65402451-65402473 CAGGATCTGAAGGACGCCGTTGG + Exonic
1129193446 15:73951111-73951133 CAGGAAACAAAGGAGGCTGCTGG + Intronic
1129457795 15:75684945-75684967 CAGGGCATGAAGGGTGCTGCTGG - Intronic
1129932778 15:79426158-79426180 CAGGAACTGAAGGAAACTGGGGG + Intronic
1130433637 15:83874400-83874422 CAGGAACTGAAGGAGACTCCGGG - Intronic
1130466412 15:84194804-84194826 CAGAACATGAAGGGTGCTGCTGG + Intergenic
1130497852 15:84478732-84478754 CAGAACATGAAGGGTGCTGCTGG - Intergenic
1130747752 15:86674355-86674377 CAGGAGCTGATGGCTGCAGCTGG - Exonic
1131394824 15:92077880-92077902 GAGGAAGTGCAGGATCCTGCAGG + Intronic
1131836025 15:96392084-96392106 CAGGCAATGAAGGATGGTGATGG + Intergenic
1132051535 15:98611634-98611656 CAGGAAATCAAGGATGCAGTTGG - Intergenic
1132101788 15:99028871-99028893 CAGAAGCTAAAGGATGGTGCAGG + Intergenic
1132946389 16:2533702-2533724 CAGGAACTGGAGGCTGAGGCAGG - Intergenic
1133370480 16:5242280-5242302 CATGACCTGAAGGATGATGCAGG + Intergenic
1133371207 16:5247240-5247262 AAGGAAGTGCAGGATGCTCCTGG + Intergenic
1133970162 16:10561642-10561664 CAGGCCCTGAGAGATGCTGCAGG - Intronic
1134478839 16:14599938-14599960 GAGGAGCTGAATGATGCTGTGGG - Exonic
1135111516 16:19693854-19693876 CGGGAATTGAAGGCTGCGGCGGG + Intronic
1136143284 16:28300961-28300983 AAGGAGGTGAAGGATGCAGCTGG + Intronic
1136359143 16:29766606-29766628 CAGGAACTGGTAGATTCTGCAGG + Intergenic
1136399518 16:30010082-30010104 CAGGACCTGAAGGGGGCGGCGGG - Exonic
1136406595 16:30051734-30051756 CAGTATCTGTAGGATGCTGTGGG + Intronic
1137521869 16:49201718-49201740 CAGGAAGTGTATGATCCTGCTGG + Intergenic
1137668901 16:50267847-50267869 CAGGAAGTGCAGGAGGCTGAGGG + Intronic
1138502368 16:57455313-57455335 CAGGAACTGGAGGAAACAGCTGG + Intronic
1139275884 16:65727299-65727321 GAGGAAGTGACGGATGGTGCAGG - Intergenic
1139499219 16:67347307-67347329 CAGGAACTCAGGGAGACTGCAGG - Intronic
1140836225 16:78796724-78796746 TGGGAACTGAAGAATGCTTCTGG - Intronic
1141047222 16:80726726-80726748 CTGGCACTGCAGGATGCTCCAGG - Intronic
1141096276 16:81165313-81165335 CAGGAGCTGGACAATGCTGCTGG - Intergenic
1141117868 16:81326056-81326078 CATGAACTAAAGGAGTCTGCTGG - Intronic
1141610110 16:85176506-85176528 CAGCAACAGAAGGAAGGTGCCGG - Intronic
1142004327 16:87682142-87682164 CAGGAAATGAAGCAAGCTGCTGG - Intronic
1142124751 16:88404667-88404689 CAGGCACAGAGGGATGCTGCAGG + Intergenic
1143119242 17:4596919-4596941 CAGGATCTGCTTGATGCTGCTGG - Exonic
1143567683 17:7734401-7734423 CGGGGAGTGAAGGATGCTGTTGG + Intronic
1143788357 17:9273550-9273572 CAGGAGCTGAATCATTCTGCAGG - Intronic
1144572141 17:16407084-16407106 AAGGAACTGGAGGATGCAGGCGG - Intergenic
1144672585 17:17141326-17141348 CAGGAAGCTAAGGAAGCTGCTGG - Intronic
1145366271 17:22269092-22269114 AAGGATCTGAAGGATGCCTCAGG + Intergenic
1145972975 17:28967770-28967792 CTGGAACTGTAGGAGGCTGGGGG + Intronic
1147987224 17:44313581-44313603 CAGGAACTGAAGGATGCTGCAGG - Intronic
1148273654 17:46283742-46283764 CAGCATATGGAGGATGCTGCCGG + Intronic
1149356585 17:55845697-55845719 CAGGTGCTGAAGGAGGCCGCAGG - Intergenic
1149550091 17:57533507-57533529 CAGGACCTGAAGTATGTTTCTGG + Intronic
1150409406 17:64930839-64930861 CAGCATATGGAGGATGCTGCCGG - Intergenic
1151121195 17:71795349-71795371 CAGGAAGGGAAAGATGATGCAGG + Intergenic
1151177083 17:72297608-72297630 CAGCAACTGAATGAGGCTGAAGG + Intergenic
1152742517 17:82024564-82024586 CAGGAGCTGAGGAAGGCTGCAGG + Intronic
1153078619 18:1194274-1194296 CAGGAAGTCGAGGATGCTGGTGG - Intergenic
1154379834 18:13838978-13839000 AAGGATGTGAAGGACGCTGCCGG + Intergenic
1157131656 18:45013170-45013192 CAGGAATGGCAGGAGGCTGCAGG - Intronic
1157183963 18:45522442-45522464 CAGGGACTGAGGGATGGTGCCGG - Intronic
1157190682 18:45578859-45578881 TAGGAACTGAAGGTTTCTGGGGG + Intronic
1160243118 18:77136974-77136996 CCGGAGCTGAGGGATGCTGGGGG + Intergenic
1161494263 19:4579081-4579103 TGGGGACTGAAGGATGTTGCTGG - Intergenic
1162839488 19:13345523-13345545 AAGGCACTGAAGGATTTTGCTGG - Intronic
1163446493 19:17349717-17349739 CAGGAGCTGAAGGCTGCAGTGGG - Intergenic
1165403989 19:35618957-35618979 CAGGAGCTGCAGGATGCAGCTGG + Exonic
1166395958 19:42441314-42441336 GAGGAACTGAAGGAAGCTGTGGG + Intronic
1166761060 19:45224700-45224722 AAGGAACTGGAGGATGGTGGGGG + Intronic
1167014269 19:46830073-46830095 CAGTAACTGAAGGAAACTGCTGG - Intergenic
1167857970 19:52257948-52257970 GAGGAACTGAGGGATGCAGTGGG - Intergenic
925491094 2:4394193-4394215 CAGGAAGAGAAGAATTCTGCTGG - Intergenic
925761887 2:7192634-7192656 CAGGAGTTCAAGGCTGCTGCAGG + Intergenic
927419604 2:22916404-22916426 CAGGAACTTAGGGATGCTAAAGG - Intergenic
928112479 2:28521933-28521955 CAGGGAGTGCAGGCTGCTGCAGG - Intronic
928363242 2:30682230-30682252 CCAGACCTGAAGGATCCTGCAGG - Intergenic
929090621 2:38213791-38213813 CAGGAAATGCATGATGCTACAGG - Intergenic
930169070 2:48232523-48232545 AAGGAACTGAAGGAGGCCTCTGG + Intergenic
937253954 2:120541583-120541605 CAGCAGCTGAAGGAGGCTGCTGG + Intergenic
939940193 2:148340040-148340062 CAGGAAATAAAGGATTCTGAAGG - Intronic
940076219 2:149744968-149744990 TTGGAACTGATGTATGCTGCAGG + Intergenic
941361064 2:164551914-164551936 CTGGAAAAGAAGGATGGTGCTGG + Intronic
941716975 2:168774282-168774304 CAGGAACTCCAGGAGGCTGAAGG - Exonic
942548638 2:177091548-177091570 GAGGGATTGTAGGATGCTGCAGG - Intergenic
944306745 2:198187959-198187981 CAGTCACTCATGGATGCTGCAGG + Intronic
945532777 2:210976791-210976813 CAGGTTCTGTAGGGTGCTGCAGG + Intergenic
947235717 2:227938690-227938712 TAGGACCTGGAGGCTGCTGCTGG + Intergenic
948638148 2:239353562-239353584 CATGACCTGGAAGATGCTGCTGG - Intronic
1169091081 20:2861864-2861886 CAGGAACTCGTGGGTGCTGCGGG - Exonic
1170094340 20:12629398-12629420 CAGGAGGTCAAGGATGCTGGTGG + Intergenic
1170237323 20:14121241-14121263 AAGGAACTGAAGGATAATCCAGG + Intronic
1172698668 20:36839307-36839329 CCGGTACTGCAGGATGCGGCAGG + Exonic
1173291289 20:41717409-41717431 CAGGAACAGAAGGCTGGTGGGGG + Intergenic
1173424970 20:42934646-42934668 AAGGGACTGAAGGATGCCTCTGG - Intronic
1173706831 20:45116077-45116099 CAGGAACTGAATGAGGGTGATGG - Intergenic
1173972566 20:47164047-47164069 CACGAACTGCAGGGTGCTTCTGG - Intronic
1175053684 20:56178422-56178444 CAGGGAGTGAAGGAAGCTGCAGG + Intergenic
1175162786 20:57021364-57021386 GAGGAATTGAGAGATGCTGCGGG + Intergenic
1175474391 20:59260592-59260614 CAGAAACTGAAGGAAACTGAAGG - Intergenic
1177646112 21:23901545-23901567 CAGGAACTGAAGGAAGCATCTGG + Intergenic
1178279264 21:31266769-31266791 CAGGGACTGGGGGATGCTGGGGG + Exonic
1178430059 21:32510964-32510986 CAGGAATTCAAGGCTGCAGCAGG + Intronic
1178875105 21:36408252-36408274 CAGGTTCTGAAGGAGGCTGGAGG + Intronic
1178904256 21:36623592-36623614 AAGTAAGTGGAGGATGCTGCAGG - Intergenic
1180719988 22:17900841-17900863 CAGGAACTGAGGGAAGCCACAGG - Exonic
1180784114 22:18537359-18537381 CAGGAACAGCAGGAGGCTGTAGG + Intergenic
1181127681 22:20711408-20711430 CAGGAACAGCAGGAGGCTGTAGG + Exonic
1181241015 22:21476711-21476733 CAGGAACAGCAGGAGGCTGTAGG + Intergenic
1182459053 22:30471552-30471574 TAGGAGCTGAAAGATGCTGCTGG - Intronic
1182528939 22:30940619-30940641 AAGGAACTGAACTATGCTTCAGG + Intronic
1184077932 22:42195324-42195346 CAAGAAATTAAGAATGCTGCTGG + Intronic
1185118534 22:48951966-48951988 CAGCAACTGAAGGCTCCTGCTGG + Intergenic
1185161307 22:49231540-49231562 CAGAGAGTGAAGCATGCTGCTGG - Intergenic
949438970 3:4059959-4059981 AAGGAACTGAAAGAAGGTGCAGG + Intronic
950989588 3:17418532-17418554 CAGGAAGTGAAGGTTGCAGTGGG + Intronic
953375197 3:42422486-42422508 CAGGAAGTCAGGGATTCTGCTGG + Intergenic
953642860 3:44726048-44726070 CAGGAACTGAAGAGTAATGCTGG + Intergenic
954865053 3:53721570-53721592 CAGGAACTGAAGGTAGGTGGAGG + Intronic
956304561 3:67809660-67809682 CAAGAGCTCCAGGATGCTGCAGG + Intergenic
957072464 3:75577787-75577809 CATGACCTGAAGGATGATGCAGG - Intergenic
957319930 3:78617634-78617656 CGGCAAATGCAGGATGCTGCTGG - Exonic
958544168 3:95519441-95519463 CAGGAATTGAAGGCTGCAGTAGG - Intergenic
959121841 3:102242015-102242037 GAGGAATTGGAGGATGCTGAGGG + Intronic
959528623 3:107406978-107407000 AATGAACTGACAGATGCTGCTGG + Intergenic
961282390 3:125774265-125774287 AAGGAAGTGTAGGATGCTCCTGG + Intergenic
961347695 3:126274756-126274778 GAGGAACAGACGGAGGCTGCTGG - Intergenic
961872746 3:130000604-130000626 CATGACCTGAAGGATGATGCAGG - Intergenic
962528675 3:136258453-136258475 CAGGCCCTGAAGGATACTGAGGG + Intronic
962985953 3:140536177-140536199 CAGGAAGTTAAGGATACTGCTGG - Intronic
969015346 4:4100131-4100153 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
969016056 4:4105097-4105119 CATGACCTGAAGGATGATGGAGG - Intergenic
969116548 4:4873900-4873922 CAGGAACTGTTGGTTTCTGCGGG + Intergenic
969475898 4:7422336-7422358 CAGGACCTAGAGGAGGCTGCAGG - Intronic
969542967 4:7805175-7805197 CAGGCACTGTAGCATGCAGCTGG - Intronic
969551222 4:7868775-7868797 CAGGAACTGATAGATGCTAGTGG - Intronic
969737894 4:9003247-9003269 CATGACCTGAAGGATGATGTAGG + Intergenic
969797092 4:9534801-9534823 CATGACCTGAAGGATGATGCAGG + Intergenic
980516221 4:133866329-133866351 CAAAAGCTGAAAGATGCTGCAGG + Intergenic
982584872 4:157222927-157222949 CAGGAAATGATGGCAGCTGCTGG - Intronic
982616548 4:157644431-157644453 CAGGAGATGAAGGAAGCGGCTGG - Intergenic
985756260 5:1720407-1720429 CAGGAGCTGACGGAAGCTACTGG - Intergenic
985991408 5:3565125-3565147 CTGGCACTGAGGGAGGCTGCAGG - Intergenic
986173962 5:5336239-5336261 CAGGAACTGAAGGAGATTCCTGG - Intergenic
986683966 5:10259695-10259717 CAGGGATTGAAGCATGCTGGCGG + Intronic
987182738 5:15384862-15384884 CAGGAGCTGGAGGAAGCAGCGGG + Intergenic
987730351 5:21763027-21763049 CAGAAACTAAAGAAAGCTGCAGG + Intronic
990179815 5:53148159-53148181 CAAGAACTGCTGGGTGCTGCTGG + Intergenic
990327702 5:54694459-54694481 CAAACACTGAAGGATGCTGGGGG + Intergenic
990544815 5:56812954-56812976 CAGGAACTGAAGTGTGATGTAGG + Intergenic
993201728 5:84825344-84825366 TAGGATTTGAAGAATGCTGCTGG - Intergenic
996321587 5:122222796-122222818 CAGGAATGGCAAGATGCTGCCGG - Intergenic
997025310 5:130053522-130053544 TAGGAACTGAAGGATAGTTCTGG - Intronic
997238262 5:132288100-132288122 CAGGAACTGGAGCATGATGTCGG + Intronic
997422306 5:133779217-133779239 CAGGAGTGGAAGGAGGCTGCGGG - Intergenic
997426427 5:133805812-133805834 AAGGAACTGAGGGCTGGTGCAGG - Intergenic
997579036 5:135005784-135005806 CAGCATCTGAAGGTTGCTTCCGG - Intronic
998636486 5:143960519-143960541 CAGAAACTGAAGAATTCTACAGG - Intergenic
998810350 5:145960124-145960146 CAGGAGCTGGAGGCTGCAGCGGG - Intronic
999227610 5:150040028-150040050 CATGAGCTAAAGGATGCTCCTGG + Intronic
999242844 5:150137548-150137570 CAGGAAATGGAGGAGGCTGTGGG + Intronic
999438699 5:151584369-151584391 CAAGAACAGAAAAATGCTGCAGG - Intergenic
1001041376 5:168337965-168337987 CAGGACCTGGAGGAGGCTGGAGG + Intronic
1001421419 5:171590056-171590078 CAGGCACAGAAGGATGGTCCTGG + Intergenic
1002285938 5:178162756-178162778 CAGGATCTGAACGCTGCTCCCGG + Intergenic
1002616947 5:180461825-180461847 GTGGAAATGAAGGATGCTCCAGG + Intergenic
1002904148 6:1435328-1435350 CAGGAACTGTAAGAAGCTGCTGG + Intergenic
1005383023 6:25256605-25256627 CAGGAAGTGAAGGTTGCAGTGGG + Intergenic
1005768907 6:29044930-29044952 CAGCATCTGAGGGATGATGCTGG + Exonic
1006385966 6:33731135-33731157 CAGGAACTGCACGAGGCTGCTGG - Intronic
1006786670 6:36672366-36672388 CGGGAACTGATGGAGGCTGGAGG - Intergenic
1007212412 6:40206072-40206094 CAGGAATGGCAAGATGCTGCGGG + Intergenic
1007738130 6:43994509-43994531 CAGGAAGGGAGGGAAGCTGCAGG + Intergenic
1008147901 6:47913763-47913785 CCGAAACTGAAGAATGCTGGAGG + Intronic
1008355676 6:50549810-50549832 CAGTAATTAAAGGGTGCTGCTGG + Intergenic
1008410034 6:51166809-51166831 TAAGAACTGCAGGATGCAGCTGG + Intergenic
1008753892 6:54770526-54770548 CAGGCACTGAAGGCGGCGGCAGG + Intergenic
1011904556 6:92348262-92348284 CAAGAACTAAGGGATGCTACTGG - Intergenic
1013313184 6:108916786-108916808 CAGGAGCTGAAGGAAACTCCTGG + Intronic
1014904065 6:127004879-127004901 CAGGACCTGAAGGGGCCTGCAGG + Intergenic
1015189523 6:130457672-130457694 CAGGAAGGGGAGTATGCTGCAGG + Intergenic
1015553397 6:134435540-134435562 CTGGAACTACAAGATGCTGCAGG - Intergenic
1015994078 6:138980087-138980109 AAAGAACTCAAGGATGTTGCTGG - Intronic
1016870588 6:148812610-148812632 CAGAAACTGAAGTCTCCTGCTGG - Intronic
1017594962 6:156018436-156018458 CAGGAACTGAAGGAGGCATGAGG - Intergenic
1018193912 6:161337927-161337949 CAGGAAGTGAGGGATGCAGCAGG - Intergenic
1018706144 6:166464523-166464545 CAGGCAGTGAATGATGATGCTGG - Intronic
1019677544 7:2323580-2323602 AAGGATCTGGAGGATGCTGCAGG + Intronic
1020277189 7:6631885-6631907 CTGGCACAGAAGGATGCTGATGG - Intergenic
1020964738 7:14850872-14850894 CAGAAACTGAATGAGGATGCAGG - Intronic
1022456728 7:30564380-30564402 CAGGCACTGAAGGCTTCTGGAGG + Intergenic
1022507685 7:30916701-30916723 CAGGCACTGAAAGGAGCTGCTGG - Intronic
1023193009 7:37603199-37603221 CAGAAAGTGAAGGCTGCTGGCGG - Intergenic
1023581639 7:41690238-41690260 CAGCAACCGCTGGATGCTGCTGG + Exonic
1023680229 7:42678179-42678201 CAGGAAATGAATGATTCAGCAGG - Intergenic
1023940389 7:44765533-44765555 CAGGGACTGAGGGGGGCTGCAGG - Exonic
1025972200 7:66337124-66337146 CAGAAAGTGAAGGATGCTAATGG + Intronic
1027381866 7:77619431-77619453 CAGTTACTGAGGGAAGCTGCAGG - Intronic
1029074011 7:97921791-97921813 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
1029074725 7:97926740-97926762 CATGACCTGAAGGATGATGGAGG - Intergenic
1029091593 7:98052486-98052508 CAGGTACTCAAGGAGGCTGAGGG - Intergenic
1032455320 7:132068804-132068826 AAAGAACTGAAGGATGCTGAAGG - Intergenic
1032473298 7:132193931-132193953 CATGAACTGAGGGAGGTTGCAGG + Intronic
1032834774 7:135662572-135662594 CAGGAACTGGAGCATGATGTCGG - Exonic
1033242055 7:139688511-139688533 CAGGAGCTGATGGCTGCTGCCGG + Intronic
1034082510 7:148292711-148292733 CGTGAACCCAAGGATGCTGCAGG + Intronic
1034423076 7:150999278-150999300 CAGCCACTGAAGGGGGCTGCGGG - Exonic
1035086499 7:156263747-156263769 GAGGAAGTGAGGGGTGCTGCGGG + Intergenic
1035239922 7:157523003-157523025 CAGGAGCTGCCGGAGGCTGCGGG - Intergenic
1035488925 7:159255064-159255086 CAGGGCCCGAAGAATGCTGCAGG + Intergenic
1035703368 8:1654271-1654293 CAAGAACTGGAGGATGCTGGTGG - Intronic
1036243692 8:7099504-7099526 AAGGAAGTGCAGGATGCTCCTGG + Intergenic
1036257109 8:7214553-7214575 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
1036307561 8:7612995-7613017 CATGACCTGAAGGATGATGGAGG + Intergenic
1036309159 8:7673152-7673174 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
1036358412 8:8060996-8061018 CATGACCTGAAGGATGATGGAGG + Intergenic
1036359672 8:8068004-8068026 CATGACCTGAAGGATGATGGAGG + Intergenic
1036360376 8:8072967-8072989 AAGGAAGTGCAGGATGCTCCTGG + Intergenic
1036829746 8:12012636-12012658 CATGACCTGAAGGATGATGGAGG - Intergenic
1036890593 8:12594000-12594022 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
1036891285 8:12598966-12598988 CATGACCTGAAGGATGATGGAGG - Intergenic
1036892542 8:12605956-12605978 CATGACCTGAAGGATGATGGAGG - Intergenic
1036898147 8:12651920-12651942 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
1036898835 8:12656903-12656925 CATGACCTGAAGGATGATGGAGG - Intergenic
1036943368 8:13071829-13071851 CAGGTGCTGAAGGATGGTGGAGG - Intergenic
1038778737 8:30553140-30553162 CAGGTAGTGAAGAATGCTGATGG + Intronic
1039897945 8:41729732-41729754 CGGGAACAGATGGAGGCTGCTGG - Intronic
1043030960 8:75132656-75132678 CAGGAACTGATTCATGCTGTTGG - Intergenic
1043406540 8:79940398-79940420 CAGGAAATGAAGTATGGTGAGGG + Intronic
1043426468 8:80153249-80153271 CAGGAACTGAAGGAAGTTAATGG + Intronic
1043723488 8:83578422-83578444 CACAAACTCAGGGATGCTGCAGG + Intergenic
1044061193 8:87638038-87638060 CAGGATATGAAGGAGGCTACTGG - Intergenic
1044707685 8:95024708-95024730 CAAGAAGTGATGGGTGCTGCTGG - Intronic
1044804334 8:95989533-95989555 CAGGAACTGATGGGTCCTGAAGG - Intergenic
1046066542 8:109203618-109203640 CAGGTACTGTAAGATGCTCCAGG + Intergenic
1047623147 8:126629100-126629122 TGTGAACTGAAGAATGCTGCTGG + Intergenic
1048452662 8:134547792-134547814 CAGGCCCTGGAGGATGCTGAAGG - Intronic
1048657455 8:136556769-136556791 CAGGAATTGAACAATGCTGGAGG + Intergenic
1048695013 8:137017793-137017815 GAGGAACAGGAGGAGGCTGCAGG - Intergenic
1049487041 8:142871154-142871176 CAGGCCCTGAAGGATGCTGCTGG + Intronic
1052904052 9:33817987-33818009 CAGGAACTGCAGAAAGCGGCGGG - Intronic
1053263165 9:36689225-36689247 AAGGAACTGAAAGAAGCTGTGGG + Intergenic
1055562134 9:77531475-77531497 CAGGGACTCCAAGATGCTGCAGG - Intronic
1056396543 9:86186658-86186680 AAGGAACTGATGACTGCTGCAGG + Intergenic
1057141012 9:92726825-92726847 CAGCAAGTTAAAGATGCTGCAGG - Intronic
1057754055 9:97817016-97817038 CAGGACTTAAAGGATGATGCAGG + Intergenic
1060679242 9:125546724-125546746 CAGGAAAGGAAGGGTGCTCCTGG + Intronic
1060782818 9:126425688-126425710 CAGGACATAAAGGATGGTGCTGG - Intronic
1061285447 9:129620110-129620132 CAGGAACTCACGGAACCTGCTGG + Exonic
1062026578 9:134343414-134343436 CAGGGGCTGCAGGATGCTGACGG - Intronic
1187242254 X:17523875-17523897 CTGGCACTCCAGGATGCTGCAGG - Intronic
1187536772 X:20148078-20148100 AAGGAAGTGCAGGATGCTGTAGG - Intergenic
1190553841 X:51614069-51614091 CAGGTACTGAAGTAGGCTCCTGG - Intergenic
1190731868 X:53231986-53232008 CAGTAACTGAATGCTGCTTCTGG + Intergenic
1190870279 X:54419164-54419186 CAGGAAATAAAGGGAGCTGCAGG - Intergenic
1190892806 X:54586134-54586156 AAGGAAATGAAGCATCCTGCTGG + Intergenic
1194434737 X:93856165-93856187 CAGGAACAGATGCATGGTGCAGG - Intergenic
1195241696 X:102959346-102959368 CAGCAACTGCAGCATGCTGGAGG + Intergenic
1196892274 X:120302700-120302722 CTGGAGCTGAAGGCTGCTGGGGG - Intronic
1197948509 X:131867993-131868015 CAGTAACTGACAGATGCAGCAGG - Intergenic
1198095841 X:133378853-133378875 CAACAACAGAAGCATGCTGCAGG - Intronic
1199336012 X:146619901-146619923 CAGCACCTGCACGATGCTGCTGG - Intergenic
1199711520 X:150473084-150473106 CAGGGCCTGATGGATGCTGAAGG - Intronic
1199736179 X:150688853-150688875 CAGGAACTGCAGAGTGCAGCTGG + Intergenic
1200123529 X:153802546-153802568 CAGGAACGGAGGGGTCCTGCAGG - Exonic
1201280909 Y:12341095-12341117 CTGGGACTGATGGATGCTGGAGG + Intergenic
1201298914 Y:12489492-12489514 CAGGAAGTAGAGGATGCAGCTGG + Intergenic
1202181943 Y:22147304-22147326 AAGGATCTGCAGGATGCTTCAGG - Intergenic
1202209417 Y:22439098-22439120 AAGGATCTGCAGGATGCTTCAGG + Intergenic