ID: 1147991015

View in Genome Browser
Species Human (GRCh38)
Location 17:44333538-44333560
Sequence GTGTGGCAACAGTGCATGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147991001_1147991015 30 Left 1147991001 17:44333485-44333507 CCTGGCCCCACTTCCTTCCTAGG No data
Right 1147991015 17:44333538-44333560 GTGTGGCAACAGTGCATGACAGG No data
1147991005_1147991015 24 Left 1147991005 17:44333491-44333513 CCCACTTCCTTCCTAGGGCTGCC No data
Right 1147991015 17:44333538-44333560 GTGTGGCAACAGTGCATGACAGG No data
1147991006_1147991015 23 Left 1147991006 17:44333492-44333514 CCACTTCCTTCCTAGGGCTGCCA No data
Right 1147991015 17:44333538-44333560 GTGTGGCAACAGTGCATGACAGG No data
1147991004_1147991015 25 Left 1147991004 17:44333490-44333512 CCCCACTTCCTTCCTAGGGCTGC No data
Right 1147991015 17:44333538-44333560 GTGTGGCAACAGTGCATGACAGG No data
1147991008_1147991015 17 Left 1147991008 17:44333498-44333520 CCTTCCTAGGGCTGCCAAGGTCT No data
Right 1147991015 17:44333538-44333560 GTGTGGCAACAGTGCATGACAGG No data
1147991010_1147991015 3 Left 1147991010 17:44333512-44333534 CCAAGGTCTAAGCTGAGAGATGA No data
Right 1147991015 17:44333538-44333560 GTGTGGCAACAGTGCATGACAGG No data
1147991009_1147991015 13 Left 1147991009 17:44333502-44333524 CCTAGGGCTGCCAAGGTCTAAGC No data
Right 1147991015 17:44333538-44333560 GTGTGGCAACAGTGCATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147991015 Original CRISPR GTGTGGCAACAGTGCATGAC AGG Intergenic
No off target data available for this crispr