ID: 1147992536

View in Genome Browser
Species Human (GRCh38)
Location 17:44343915-44343937
Sequence GGAATTGATATGGGAGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147992536_1147992546 6 Left 1147992536 17:44343915-44343937 CCTCACCCTCCCATATCAATTCC No data
Right 1147992546 17:44343944-44343966 GCAGGGCCGATCTGGAGACTAGG No data
1147992536_1147992545 -2 Left 1147992536 17:44343915-44343937 CCTCACCCTCCCATATCAATTCC No data
Right 1147992545 17:44343936-44343958 CCTCGAAGGCAGGGCCGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147992536 Original CRISPR GGAATTGATATGGGAGGGTG AGG (reversed) Intergenic
No off target data available for this crispr