ID: 1147992545

View in Genome Browser
Species Human (GRCh38)
Location 17:44343936-44343958
Sequence CCTCGAAGGCAGGGCCGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147992536_1147992545 -2 Left 1147992536 17:44343915-44343937 CCTCACCCTCCCATATCAATTCC No data
Right 1147992545 17:44343936-44343958 CCTCGAAGGCAGGGCCGATCTGG No data
1147992537_1147992545 -7 Left 1147992537 17:44343920-44343942 CCCTCCCATATCAATTCCTCGAA No data
Right 1147992545 17:44343936-44343958 CCTCGAAGGCAGGGCCGATCTGG No data
1147992538_1147992545 -8 Left 1147992538 17:44343921-44343943 CCTCCCATATCAATTCCTCGAAG No data
Right 1147992545 17:44343936-44343958 CCTCGAAGGCAGGGCCGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147992545 Original CRISPR CCTCGAAGGCAGGGCCGATC TGG Intergenic
No off target data available for this crispr