ID: 1147992546

View in Genome Browser
Species Human (GRCh38)
Location 17:44343944-44343966
Sequence GCAGGGCCGATCTGGAGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147992541_1147992546 -4 Left 1147992541 17:44343925-44343947 CCATATCAATTCCTCGAAGGCAG No data
Right 1147992546 17:44343944-44343966 GCAGGGCCGATCTGGAGACTAGG No data
1147992537_1147992546 1 Left 1147992537 17:44343920-44343942 CCCTCCCATATCAATTCCTCGAA No data
Right 1147992546 17:44343944-44343966 GCAGGGCCGATCTGGAGACTAGG No data
1147992536_1147992546 6 Left 1147992536 17:44343915-44343937 CCTCACCCTCCCATATCAATTCC No data
Right 1147992546 17:44343944-44343966 GCAGGGCCGATCTGGAGACTAGG No data
1147992540_1147992546 -3 Left 1147992540 17:44343924-44343946 CCCATATCAATTCCTCGAAGGCA No data
Right 1147992546 17:44343944-44343966 GCAGGGCCGATCTGGAGACTAGG No data
1147992538_1147992546 0 Left 1147992538 17:44343921-44343943 CCTCCCATATCAATTCCTCGAAG No data
Right 1147992546 17:44343944-44343966 GCAGGGCCGATCTGGAGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147992546 Original CRISPR GCAGGGCCGATCTGGAGACT AGG Intergenic
No off target data available for this crispr