ID: 1147992811

View in Genome Browser
Species Human (GRCh38)
Location 17:44345440-44345462
Sequence AACCGCTTACTGAAACTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147992807_1147992811 8 Left 1147992807 17:44345409-44345431 CCCCTGGAGTCTCAGCCGGAGAC 0: 1
1: 0
2: 1
3: 6
4: 129
Right 1147992811 17:44345440-44345462 AACCGCTTACTGAAACTCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 96
1147992810_1147992811 -7 Left 1147992810 17:44345424-44345446 CCGGAGACAACAGAAGAACCGCT 0: 1
1: 0
2: 0
3: 14
4: 141
Right 1147992811 17:44345440-44345462 AACCGCTTACTGAAACTCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 96
1147992804_1147992811 26 Left 1147992804 17:44345391-44345413 CCATGTGAGCTTGAGGTTCCCCT 0: 1
1: 0
2: 1
3: 10
4: 150
Right 1147992811 17:44345440-44345462 AACCGCTTACTGAAACTCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 96
1147992809_1147992811 6 Left 1147992809 17:44345411-44345433 CCTGGAGTCTCAGCCGGAGACAA 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1147992811 17:44345440-44345462 AACCGCTTACTGAAACTCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 96
1147992808_1147992811 7 Left 1147992808 17:44345410-44345432 CCCTGGAGTCTCAGCCGGAGACA 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1147992811 17:44345440-44345462 AACCGCTTACTGAAACTCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147992811 Original CRISPR AACCGCTTACTGAAACTCCT TGG Intronic
901737409 1:11321137-11321159 CACCGCAAACTTAAACTCCTGGG - Intergenic
902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG + Intronic
909646253 1:77920543-77920565 CACTGCATCCTGAAACTCCTGGG - Intronic
915904996 1:159871181-159871203 AACAGCTTACTGACTCTCCCTGG + Intronic
1063324207 10:5080929-5080951 AACCCCATTCTAAAACTCCTTGG - Intronic
1065810190 10:29435760-29435782 GACAGATTACTGGAACTCCTAGG - Intergenic
1066116333 10:32243534-32243556 ATCAGCTTCCTGAAACTCCAGGG - Intergenic
1073434626 10:103508691-103508713 AACCGCTTCCTCCAACCCCTGGG - Intronic
1074339218 10:112610258-112610280 AAGCTCTTACAGACACTCCTGGG - Intronic
1078296548 11:10076815-10076837 AACTGCTTTCTGATCCTCCTTGG + Intronic
1080517703 11:33039466-33039488 CACCGCTTACTGAACCCCTTCGG + Exonic
1082358979 11:51622780-51622802 CACAGCTCACTGAAGCTCCTGGG + Intergenic
1084514678 11:69630179-69630201 AACTGCTGATTGAAACTCCTGGG - Intergenic
1084749644 11:71196105-71196127 AGCCGCAGACTCAAACTCCTGGG - Intronic
1086348350 11:85920886-85920908 CACAGCATCCTGAAACTCCTGGG + Intergenic
1093977818 12:25441902-25441924 AACCGCTTACTCAATCTCAATGG - Intronic
1096879462 12:54655758-54655780 AACCTCAAACTCAAACTCCTGGG + Intergenic
1098455582 12:70669638-70669660 TACCGCATCCTCAAACTCCTGGG + Intronic
1099926833 12:89028648-89028670 AACAACTTCCTAAAACTCCTAGG - Intergenic
1103793102 12:123485453-123485475 AACCCCTTTCTGAAACTCTTGGG - Intronic
1114961781 14:27900915-27900937 TACCTCTTACTGAAAAGCCTAGG + Intergenic
1116149545 14:41122069-41122091 AACGGCTCACTGAAATTCATTGG + Intergenic
1118337431 14:64865934-64865956 AACCGCTTTCTGGAACTGTTGGG - Intronic
1120317736 14:82917528-82917550 AACTGCTTTCTGCTACTCCTTGG + Intergenic
1127308705 15:57732212-57732234 CACTGCATCCTGAAACTCCTGGG + Intronic
1127884008 15:63183134-63183156 AATGTCTTCCTGAAACTCCTAGG - Intergenic
1132347122 15:101115018-101115040 CACCGCATCCTCAAACTCCTGGG + Intergenic
1135945251 16:26859418-26859440 GACTGCATCCTGAAACTCCTGGG - Intergenic
1142721967 17:1782401-1782423 CACTGCTTCCTGCAACTCCTGGG - Intronic
1143467675 17:7148760-7148782 CACAGCTTTCTGAAACTCCATGG - Intergenic
1144959886 17:19039051-19039073 AAGCACTTCCTGAAACTCCAGGG + Intronic
1144975274 17:19135473-19135495 AAGCACTTCCTGAAACTCCAGGG - Intronic
1147992811 17:44345440-44345462 AACCGCTTACTGAAACTCCTTGG + Intronic
1150360016 17:64523822-64523844 CACAGCTCACTGAAGCTCCTGGG - Intronic
1150864754 17:68837941-68837963 AACCACTTACTGAACCTTCTAGG + Intergenic
1152553635 17:81042216-81042238 AACTGCAGCCTGAAACTCCTAGG + Intronic
1155017698 18:21861975-21861997 CACTGCATACTGAAACTCCTGGG + Intronic
1159458348 18:68692490-68692512 ACCCCCTTACTGCATCTCCTGGG + Intronic
1160135003 18:76264402-76264424 AAATGCTTTCTGAATCTCCTTGG - Intergenic
1164273089 19:23691082-23691104 AACCTTTTAGTGAAATTCCTAGG + Intergenic
924987285 2:283675-283697 AAGCGCTGGCTGATACTCCTTGG + Intronic
925089897 2:1146176-1146198 AACACCATACTGAAAGTCCTTGG + Intronic
925984395 2:9204360-9204382 AATCTCTTACTGAAACCCCAAGG + Intergenic
929155455 2:38784813-38784835 AACAGGTGAGTGAAACTCCTGGG - Exonic
933425095 2:82100610-82100632 CACCACAGACTGAAACTCCTGGG - Intergenic
937762277 2:125619809-125619831 AACGGTTTACAGAAAGTCCTAGG - Intergenic
938605418 2:132887720-132887742 CACTGCATACTCAAACTCCTGGG + Intronic
946970321 2:225083671-225083693 AAACGCTTACTGAAAACCTTGGG + Intergenic
947008131 2:225536027-225536049 GATCTCTTACTGAAACTCATTGG - Intronic
947640058 2:231702173-231702195 AACCACAGTCTGAAACTCCTGGG + Intergenic
1172322101 20:34003574-34003596 AACCTCATACTGTAAGTCCTAGG + Intronic
949240138 3:1861460-1861482 AACCACATACTGAAACCTCTGGG - Intergenic
951252228 3:20407269-20407291 AAACTTTTCCTGAAACTCCTGGG + Intergenic
953258370 3:41312047-41312069 CACCGCAGACTCAAACTCCTGGG + Intronic
956148042 3:66212185-66212207 AACCGCAGCCTGAAACTCCTGGG + Intronic
959647121 3:108716187-108716209 AACAAGTTACTGAAACTCCCTGG + Intergenic
963944403 3:151129842-151129864 CACTGCTTCCTCAAACTCCTGGG + Intronic
969564026 4:7967068-7967090 AAACACTTCCTGGAACTCCTCGG + Exonic
970249671 4:14101067-14101089 AACCCCTTCTTTAAACTCCTGGG + Intergenic
970350467 4:15196889-15196911 AACCTATAACTGAAGCTCCTTGG + Intergenic
971824362 4:31602143-31602165 AACTCACTACTGAAACTCCTGGG - Intergenic
972795356 4:42412365-42412387 AAACACTTACTGAACCTCTTTGG + Exonic
975355279 4:73395469-73395491 CACCGCAGACTTAAACTCCTGGG + Intergenic
977782892 4:100999035-100999057 CACAGCATCCTGAAACTCCTGGG + Intergenic
979691575 4:123564272-123564294 AACAGCTTAAAGAAACTCATAGG - Intergenic
982498941 4:156130297-156130319 AACCTTTAACTGAAACACCTAGG + Intergenic
982992035 4:162288670-162288692 AACAACCTACTGAAACCCCTGGG + Intergenic
985932265 5:3067817-3067839 ACCAGCTTCCTGATACTCCTGGG - Intergenic
986442596 5:7794969-7794991 TACCCCTTACTGAAACTGCATGG + Intronic
987366149 5:17151037-17151059 CTCGGCTTACTGCAACTCCTGGG + Intronic
987677652 5:21095709-21095731 CACCGCCTCCTCAAACTCCTGGG + Intergenic
988259513 5:28866567-28866589 AAAGGCTGACTCAAACTCCTGGG - Intergenic
988429159 5:31099702-31099724 AGCCTCATACTGGAACTCCTAGG - Intergenic
998912403 5:146974377-146974399 AACTGGTTACTCATACTCCTTGG - Intronic
999670927 5:153958718-153958740 AACCTCTTTCTGATACTCGTTGG - Intergenic
1003283865 6:4717220-4717242 AACCTCTTTCTCAAACTCCTTGG - Intronic
1004124453 6:12858718-12858740 CACTGCATACTGAAACTCTTGGG - Intronic
1013523097 6:110950602-110950624 CACAGCTCACTGGAACTCCTGGG - Intergenic
1014085618 6:117339476-117339498 AACTGCATACTGAAACTCTGAGG - Intronic
1014466999 6:121768144-121768166 AACTGATTACTAAAACACCTAGG - Intergenic
1016058261 6:139601822-139601844 AAACACTTGCTGACACTCCTAGG - Intergenic
1017757059 6:157538749-157538771 TACCGCTTCCTGAAAAGCCTTGG - Intronic
1018485104 6:164232997-164233019 AACTGCTGCCTTAAACTCCTGGG - Intergenic
1023809433 7:43900660-43900682 CACCGCTGCCTCAAACTCCTGGG + Intronic
1025860768 7:65325526-65325548 AACATATTACTGAAAATCCTAGG - Intergenic
1026044647 7:66898612-66898634 CACTGCAGACTGAAACTCCTGGG + Intergenic
1026199784 7:68204727-68204749 TACTGCATCCTGAAACTCCTGGG - Intergenic
1026631724 7:72043693-72043715 AACTGCAGCCTGAAACTCCTGGG - Intronic
1030624902 7:111833466-111833488 CACTGCATCCTGAAACTCCTAGG - Intronic
1034157143 7:148965121-148965143 AACCGCTGACTGAAAATATTAGG + Intergenic
1036394235 8:8353729-8353751 TACCGCAGACTCAAACTCCTAGG - Intronic
1049858380 8:144879492-144879514 CACCGCTGCCTCAAACTCCTGGG - Exonic
1052874332 9:33542456-33542478 CACTGCAAACTGAAACTCCTGGG + Intronic
1053501703 9:38601905-38601927 CACTGCAAACTGAAACTCCTGGG - Intergenic
1053599552 9:39596481-39596503 ACCCGCTTACTGCATTTCCTTGG + Intergenic
1053857255 9:42350666-42350688 ACCCGCTTACTGCATTTCCTTGG + Intergenic
1054253975 9:62745905-62745927 ACCCGCTTACTGCATTTCCTTGG - Intergenic
1054568034 9:66780069-66780091 ACCCGCTTACTGCATTTCCTTGG - Intergenic
1057681093 9:97186222-97186244 CACTGCAAACTGAAACTCCTGGG - Intergenic
1058673827 9:107383541-107383563 ACCAGCTCCCTGAAACTCCTGGG + Intergenic
1060483656 9:124033284-124033306 AACCACTTATTGAAACTACTTGG + Exonic
1203406227 Un_KI270538v1:16649-16671 AACCTCTTACTGAGAATGCTTGG - Intergenic
1198609315 X:138380162-138380184 CACAGCATACTCAAACTCCTGGG + Intergenic
1201404045 Y:13632498-13632520 GACGGCTTACTCAAACTCGTGGG + Intergenic