ID: 1147996299

View in Genome Browser
Species Human (GRCh38)
Location 17:44362174-44362196
Sequence GCCAGGATTGGGGGTTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 209}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147996299_1147996306 -1 Left 1147996299 17:44362174-44362196 CCCAGAGAACCCCCAATCCTGGC 0: 1
1: 0
2: 1
3: 25
4: 209
Right 1147996306 17:44362196-44362218 CTCTATTCCAGCCAATTCCCTGG 0: 1
1: 0
2: 2
3: 16
4: 154
1147996299_1147996314 22 Left 1147996299 17:44362174-44362196 CCCAGAGAACCCCCAATCCTGGC 0: 1
1: 0
2: 1
3: 25
4: 209
Right 1147996314 17:44362219-44362241 GCCCCTTCCCCTGAGGTGCAGGG 0: 1
1: 0
2: 1
3: 25
4: 228
1147996299_1147996310 15 Left 1147996299 17:44362174-44362196 CCCAGAGAACCCCCAATCCTGGC 0: 1
1: 0
2: 1
3: 25
4: 209
Right 1147996310 17:44362212-44362234 TCCCTGGGCCCCTTCCCCTGAGG 0: 1
1: 0
2: 5
3: 61
4: 577
1147996299_1147996307 0 Left 1147996299 17:44362174-44362196 CCCAGAGAACCCCCAATCCTGGC 0: 1
1: 0
2: 1
3: 25
4: 209
Right 1147996307 17:44362197-44362219 TCTATTCCAGCCAATTCCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 184
1147996299_1147996320 30 Left 1147996299 17:44362174-44362196 CCCAGAGAACCCCCAATCCTGGC 0: 1
1: 0
2: 1
3: 25
4: 209
Right 1147996320 17:44362227-44362249 CCCTGAGGTGCAGGGACTTGAGG 0: 1
1: 0
2: 1
3: 23
4: 426
1147996299_1147996313 21 Left 1147996299 17:44362174-44362196 CCCAGAGAACCCCCAATCCTGGC 0: 1
1: 0
2: 1
3: 25
4: 209
Right 1147996313 17:44362218-44362240 GGCCCCTTCCCCTGAGGTGCAGG 0: 1
1: 0
2: 2
3: 34
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147996299 Original CRISPR GCCAGGATTGGGGGTTCTCT GGG (reversed) Intronic