ID: 1147997109

View in Genome Browser
Species Human (GRCh38)
Location 17:44366250-44366272
Sequence ATGCTGTTACTGTTGGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147997106_1147997109 2 Left 1147997106 17:44366225-44366247 CCTCACAGGAGCAGGGGCGTAAT No data
Right 1147997109 17:44366250-44366272 ATGCTGTTACTGTTGGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147997109 Original CRISPR ATGCTGTTACTGTTGGCCCA GGG Intergenic
No off target data available for this crispr