ID: 1147998560

View in Genome Browser
Species Human (GRCh38)
Location 17:44374922-44374944
Sequence GCTCTGGGAGGGGCGGGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 647
Summary {0: 1, 1: 1, 2: 5, 3: 54, 4: 586}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147998560_1147998570 -1 Left 1147998560 17:44374922-44374944 CCAAACCCCGCCCCTCCCAGAGC 0: 1
1: 1
2: 5
3: 54
4: 586
Right 1147998570 17:44374944-44374966 CAAAGTGGTCCCCGCCCAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 82
1147998560_1147998577 20 Left 1147998560 17:44374922-44374944 CCAAACCCCGCCCCTCCCAGAGC 0: 1
1: 1
2: 5
3: 54
4: 586
Right 1147998577 17:44374965-44374987 GGCCCGGCCCCGCCCCACCACGG 0: 1
1: 0
2: 8
3: 62
4: 504
1147998560_1147998571 4 Left 1147998560 17:44374922-44374944 CCAAACCCCGCCCCTCCCAGAGC 0: 1
1: 1
2: 5
3: 54
4: 586
Right 1147998571 17:44374949-44374971 TGGTCCCCGCCCAGAAGGCCCGG 0: 1
1: 0
2: 1
3: 15
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147998560 Original CRISPR GCTCTGGGAGGGGCGGGGTT TGG (reversed) Intronic