ID: 1147998560

View in Genome Browser
Species Human (GRCh38)
Location 17:44374922-44374944
Sequence GCTCTGGGAGGGGCGGGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 647
Summary {0: 1, 1: 1, 2: 5, 3: 54, 4: 586}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147998560_1147998571 4 Left 1147998560 17:44374922-44374944 CCAAACCCCGCCCCTCCCAGAGC 0: 1
1: 1
2: 5
3: 54
4: 586
Right 1147998571 17:44374949-44374971 TGGTCCCCGCCCAGAAGGCCCGG 0: 1
1: 0
2: 1
3: 15
4: 133
1147998560_1147998577 20 Left 1147998560 17:44374922-44374944 CCAAACCCCGCCCCTCCCAGAGC 0: 1
1: 1
2: 5
3: 54
4: 586
Right 1147998577 17:44374965-44374987 GGCCCGGCCCCGCCCCACCACGG 0: 1
1: 0
2: 8
3: 62
4: 504
1147998560_1147998570 -1 Left 1147998560 17:44374922-44374944 CCAAACCCCGCCCCTCCCAGAGC 0: 1
1: 1
2: 5
3: 54
4: 586
Right 1147998570 17:44374944-44374966 CAAAGTGGTCCCCGCCCAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147998560 Original CRISPR GCTCTGGGAGGGGCGGGGTT TGG (reversed) Intronic
900129077 1:1080059-1080081 GCACGGGGCGGGGCGGGGTGGGG - Intergenic
900151993 1:1182813-1182835 GCCCTAGGAGGGGCGTGGCTGGG + Intronic
900163205 1:1234303-1234325 GCTCGGGGCAGGGCTGGGTTAGG + Exonic
900178211 1:1299945-1299967 CCTTTGGGAGGGGTGGGGCTGGG - Intronic
900324111 1:2099502-2099524 GCAGTGGGCGGGGCGGGGTGGGG + Intronic
900334388 1:2154298-2154320 GCTCAGGGAGAGGCCGGGCTGGG + Intronic
900344723 1:2205230-2205252 GCACTGGGAGGGGCGGGGCAAGG - Intronic
900411451 1:2514541-2514563 GCTCGGGGAAGGGTGGGGGTCGG + Intronic
900660168 1:3778156-3778178 GCTCTGGGAGGGTTGGGGAGAGG + Intergenic
901050880 1:6425324-6425346 GCTCAAGGATGGGTGGGGTTTGG + Intronic
901066004 1:6495011-6495033 GCTCAGGCAGGGGCAGGGGTGGG - Intronic
901526064 1:9824020-9824042 GCGGCGGGAGGGGCGGGGATGGG + Exonic
901573375 1:10180067-10180089 GCTCTGGGTGGGCCTGGGGTTGG - Exonic
901757896 1:11452357-11452379 GCTCAGGGAGGAGCTGGCTTCGG + Intergenic
901790153 1:11649732-11649754 GGGCTGGGAGGAGCGGGGTAAGG - Intronic
901853349 1:12029611-12029633 GTTCTGGGAGGAAAGGGGTTAGG + Intronic
902816261 1:18918313-18918335 GCTCTGGGAGAGTGGGGGGTTGG + Intronic
903067836 1:20710710-20710732 GCTGTGGGAGAGGCGTGGGTGGG + Intronic
903420937 1:23217463-23217485 GCTCTGGGAGAGGCGGAGGCAGG - Intergenic
903466393 1:23554973-23554995 GCGCCGGGAGGGGCGGGGCGGGG + Intergenic
903617664 1:24673567-24673589 CCTCTGTCAGGGGCGGGGTGGGG + Intergenic
904211059 1:28887244-28887266 TCCCCGGGAGGGACGGGGTTAGG + Intronic
904252031 1:29231799-29231821 GCTCTGGGATGGGGTGGGATGGG + Intergenic
904338127 1:29810997-29811019 GCTGTGGGTGGGGCTGGCTTTGG + Intergenic
904445541 1:30570640-30570662 GCTCTGGGGGTGACGGGGTAGGG + Intergenic
904699811 1:32351581-32351603 GCGCCGGGAGGGGCGGGGCGAGG - Intronic
905569224 1:38991056-38991078 ACCCTGGGAGGGGCGGGGGTGGG + Intergenic
905690169 1:39937084-39937106 GCTCTGGGCTGGGCTGGGCTGGG - Intergenic
905913576 1:41670236-41670258 GCTCTGTGAGGGGCAGGGCAGGG + Intronic
906102828 1:43274041-43274063 GCTTTGGATGGGGCGGGGCTTGG - Intergenic
906206884 1:43991769-43991791 GCCCATAGAGGGGCGGGGTTTGG + Intronic
910221708 1:84894598-84894620 CGTCTCGGAGGGGCGGGGGTCGG + Intergenic
911009248 1:93262208-93262230 GATCTGGGAGGGGCCAGGGTTGG - Intronic
911644395 1:100322726-100322748 GCTTGGGGAGGGGAGGGTTTGGG - Intergenic
912506690 1:110161519-110161541 GCACGGGGAGGGGCGGGGCAGGG + Intronic
912812139 1:112802573-112802595 GCCCAGGGAGGGGCGGGGGGGGG + Intergenic
915111205 1:153565678-153565700 TCTCTGGGAGGGAGGGGGCTGGG - Exonic
915743995 1:158142151-158142173 GCTATGGCAGGGGCGGGGGCAGG + Intergenic
915854787 1:159371507-159371529 GGTTTGGTAGGGGCAGGGTTGGG - Intergenic
915918597 1:159957196-159957218 GCTGTGGGAGGGGTGGGGATTGG + Intergenic
916090624 1:161305651-161305673 GCTCTGGCAGGGCCTGGGGTGGG + Exonic
916358706 1:163943130-163943152 GCTCTGTGAGGGTCGGGCTAGGG - Intergenic
917291583 1:173477196-173477218 GCGCGGGGCGGGGCGGGGCTGGG - Intergenic
919794255 1:201311698-201311720 TCTCAGGGAGGGGCAGGGGTGGG + Intronic
920008548 1:202851164-202851186 TTTCTGGCAGGGGCTGGGTTAGG + Intergenic
920915095 1:210252664-210252686 ACTCTGGAGGAGGCGGGGTTAGG + Intergenic
921096278 1:211889633-211889655 GCACTGGGAGCGGCAGGGCTCGG + Intergenic
921599178 1:217089127-217089149 GCGCTGGGAGGGGAGGGGTTAGG - Intronic
921896756 1:220409895-220409917 CTTCAGGGAGGGGAGGGGTTGGG + Intergenic
922555178 1:226527393-226527415 GCTCAGGGTGGGGCAGGGCTGGG + Intergenic
922563948 1:226589163-226589185 GCTTTGGGAGGTGCTGGGTCTGG - Intronic
922568778 1:226619390-226619412 GCTCAGGGAGGGGTGGGCTCTGG - Intergenic
922714336 1:227859068-227859090 GCTCTGGAAGGGGATGGGTCAGG + Intergenic
924299271 1:242620737-242620759 GCACTGGGAGGGGCTGACTTTGG + Intergenic
924593941 1:245428970-245428992 GCTGTGGTGGGGGCGGGGGTGGG + Intronic
1065883316 10:30056881-30056903 GCCCAGGGAGGGGAGGTGTTGGG - Intronic
1065916613 10:30358593-30358615 GCTGTGGGAGGGCCGGGGAAGGG - Intronic
1066049293 10:31619752-31619774 GATCTGGTGGGGGTGGGGTTCGG + Intergenic
1066978953 10:42393345-42393367 TCTCTGGTTGGGGAGGGGTTTGG + Intergenic
1067037866 10:42932890-42932912 GCTGTGGGCGGGGCGGGGCGGGG + Intergenic
1067060725 10:43076839-43076861 GCTTGGGGAGGAGCGGGGTGCGG - Intergenic
1067480954 10:46597419-46597441 GCTCCTGGTGGGGGGGGGTTGGG - Intergenic
1068080624 10:52314164-52314186 GCGCTGGGAGGGGCTGGGAGGGG - Intergenic
1068259254 10:54556864-54556886 GCCCTGGGAGTGGCAGGGTTGGG + Intronic
1069641969 10:69962080-69962102 GCACTGGGTGGGGCGGAGATGGG - Intronic
1070112075 10:73495912-73495934 GCTCTGGGCCGGGCGGGGTTGGG + Exonic
1070179150 10:73997947-73997969 AATGGGGGAGGGGCGGGGTTTGG + Intergenic
1070258056 10:74827042-74827064 GATCGGGTGGGGGCGGGGTTCGG + Intronic
1070770155 10:79077483-79077505 GGTCTGGGTGGGGAGGGGTGGGG + Intronic
1070954231 10:80454123-80454145 GCTGGGGGAGGGGCGGGGCCAGG + Intergenic
1071602786 10:86967001-86967023 GCTCTGGGAGAGGAGGGGCGGGG + Intronic
1071611772 10:87038458-87038480 GCACTGGCAGGGGAGGGGTTGGG + Intergenic
1073252301 10:102128432-102128454 GCTTTTAGAGGGGCGGGGTGCGG - Intergenic
1074618252 10:115092660-115092682 GGGCTGGGAGGGGCGGGGATTGG - Intergenic
1074720902 10:116264291-116264313 GCTCAGAGAGGGGAGGGGATTGG - Intronic
1076552645 10:131293471-131293493 TCTCTGGTCGGGGAGGGGTTTGG - Intronic
1076898631 10:133326120-133326142 GCTGCGGGAGGGGCCGGGTCAGG + Exonic
1076902713 10:133347742-133347764 GCTGGGGGAGGGGAGGGGCTGGG + Intronic
1076909197 10:133379054-133379076 GCGCGGGGAGGGGCGGGGAGGGG - Intergenic
1076909251 10:133379164-133379186 GCGCGGGGAGGGGCGGGGAGGGG - Intergenic
1076909271 10:133379204-133379226 GCGCTGGGAGGGGCGGGGAGGGG - Intergenic
1077105122 11:838905-838927 ACACTGGGCGGGGCGGGGGTGGG - Intronic
1077155890 11:1090648-1090670 CCTCTGGGAAGGCCGGGGATTGG - Intergenic
1077282508 11:1752120-1752142 CCGCTGGGAGGGGAGGGGTTGGG - Intronic
1077290024 11:1784816-1784838 GGTCTGGGAGAAGCGGGGTTGGG - Intergenic
1077437420 11:2549610-2549632 GCTCTGCGAGGCCCGGGGTAGGG + Intronic
1077556900 11:3230300-3230322 GTCCTGGGAGGGCTGGGGTTTGG + Intronic
1078057546 11:8019687-8019709 GCGCCGGGAGGGGCGGGGCAGGG + Intronic
1078656651 11:13246932-13246954 GCCCTTGGAGGGGTGGGGCTGGG - Intergenic
1079354429 11:19718050-19718072 GCACTGGGAAGGGTGGGGGTGGG - Intronic
1080230999 11:30017414-30017436 GCTTTGGGAGGGGATGGGGTGGG - Intergenic
1080898768 11:36467766-36467788 TACCTGGGAGGGGCGGGGTGGGG - Intergenic
1081535028 11:43990035-43990057 GCTCTGGGAAGGGAGGAGTAAGG - Intergenic
1081576663 11:44322919-44322941 GCTCAGGGTGGGGAGGGGTGGGG + Intergenic
1081760697 11:45574795-45574817 CCTCTGGGAGGGACAGAGTTCGG - Intergenic
1083460196 11:62806046-62806068 ACTCAGGGCGGGGCGGGGTGGGG - Intronic
1083466090 11:62847203-62847225 TCTCTGGTCGGGGAGGGGTTTGG + Intergenic
1083595038 11:63915141-63915163 GCCCTGGGAGGTGGGGGCTTGGG - Intronic
1083782581 11:64925850-64925872 GCTGTGGGAGCGGCGGGGCCGGG - Exonic
1084112333 11:67022426-67022448 GCACTGGGAGGGGCTGGGTGCGG - Intronic
1084809472 11:71603551-71603573 GCACTGGGGGGGGCGGGGCAGGG + Intergenic
1085992377 11:81864631-81864653 CCTGTCGGAGGGGTGGGGTTGGG + Intergenic
1087731228 11:101780266-101780288 GATTTGGGAGGGGCCAGGTTTGG + Intronic
1088604470 11:111514712-111514734 GTTCTCGGAGGGGCGGGGCAGGG + Intergenic
1088764321 11:112961824-112961846 GCCCTGGAGGGAGCGGGGTTCGG - Intronic
1089197316 11:116701802-116701824 GCTCTGCTGGGGGCCGGGTTGGG - Intergenic
1089560198 11:119339928-119339950 GCTCAGGCAGGGGCGGGGAGGGG - Intronic
1089701175 11:120244943-120244965 GCACTAGGAGGGGAGGGGGTGGG + Intronic
1090029432 11:123194883-123194905 CCTCTGGGAGGGCGGGAGTTTGG - Intronic
1090387047 11:126363403-126363425 ACTCTGGGGGTGGCTGGGTTGGG + Intronic
1090472969 11:126996462-126996484 CCCTTGGGAGGGGCAGGGTTGGG - Intronic
1090640113 11:128722824-128722846 GCTCTGGGAACCGCGGGGTGGGG + Intronic
1090652150 11:128816220-128816242 GCACTGGGAGGGCCGTGGATGGG - Intergenic
1091215244 11:133897243-133897265 GCTCTGGGAGTGGGGCGGTGTGG - Intergenic
1091358702 11:134957759-134957781 GCTGTGGGAGGGGCGGCCTCTGG - Intergenic
1091755092 12:3046187-3046209 TCTCTGGGTGGGGGGGGGGTTGG - Intergenic
1092209294 12:6635955-6635977 GCTCTGGGCTGGGCTGGGCTGGG + Exonic
1092228962 12:6766507-6766529 GCGCGGGGTGGGGCGGGGGTGGG - Exonic
1092256380 12:6928455-6928477 GAACTGGGAGGGGTGGGGGTGGG - Intronic
1092270382 12:7018686-7018708 GCTCAGGGCTGGGCGGGGCTTGG + Intronic
1092699993 12:11217667-11217689 CCTCTGGTAGGGGAGAGGTTTGG + Intergenic
1093703422 12:22248404-22248426 GCTGTGGGAGCTGCGGGGGTGGG - Intronic
1094465948 12:30754510-30754532 GCTGTGGGAAGGGTGGGGGTCGG - Exonic
1095794186 12:46199116-46199138 GCTCAGGGAGGGGGTGGGGTGGG + Intronic
1095983141 12:47984023-47984045 GGGCTGGGAGGGGTGGGGGTGGG - Intronic
1096101476 12:48972705-48972727 GGTCTGGCAGGGGCGGGGGGCGG - Intergenic
1096103914 12:48985775-48985797 CCCCTGGGAGGGGCAGGGTGGGG + Intergenic
1096796414 12:54080735-54080757 GCTCTTGGCGGGGCTGGGGTTGG - Intergenic
1096815210 12:54197536-54197558 GCTCTAGCAGGGGAGGGGTGGGG + Intergenic
1097053669 12:56237993-56238015 GCCCAGGGAGGGGAGGGGTGGGG + Exonic
1097068599 12:56338635-56338657 GCTATAGAAGGGGCGGGGATGGG - Intronic
1097160634 12:57044207-57044229 CCTCTGGGAGGGCCAGTGTTGGG + Exonic
1100445535 12:94656437-94656459 GCACTGGGGGGGGGGGGGTAGGG + Intergenic
1102197093 12:111033847-111033869 GGGGTGGGAGGGGAGGGGTTGGG - Intergenic
1103039695 12:117684996-117685018 AATCTGGGAGGGGAGGGGTAGGG + Intronic
1103339341 12:120213086-120213108 GCTCTGAGAGGGGCCGGGTGAGG + Intronic
1103562508 12:121800058-121800080 GCTGGGGGAGGGGCGGCGTCTGG - Intronic
1103623621 12:122203648-122203670 GTTCTGGCGGGGGCGGGTTTGGG - Exonic
1103883288 12:124182920-124182942 GCCGGGGGAGGGGCGGGGGTGGG - Intronic
1103941859 12:124505589-124505611 GCTGTGGAAGTGGCGGAGTTGGG - Intronic
1104623893 12:130337766-130337788 GGTCTTGGAGGGGCGGGGCCGGG + Intergenic
1104659466 12:130600338-130600360 TCTCTGGTCGGGGAGGGGTTTGG - Intronic
1105071415 12:133236141-133236163 GCTCTGCGGGGCGCGGGGTGCGG + Intergenic
1105601939 13:21895295-21895317 GCGGGGGGAGGGGCGGGGTAGGG + Intergenic
1105611033 13:21969881-21969903 GCTTGGGGAGGGATGGGGTTTGG + Intergenic
1105821277 13:24083317-24083339 CCTGTGGGCGGGGCAGGGTTTGG - Intronic
1105943544 13:25171189-25171211 GCTCTGGGGGGCCCCGGGTTCGG + Exonic
1106230052 13:27814703-27814725 GCTCTAGGAGGGCAGGGCTTTGG - Intergenic
1106512356 13:30422304-30422326 GGGCTGGGAGGGGCGGGGCGGGG - Intergenic
1106512375 13:30422344-30422366 GCGCTGGGCGGGGCTGGGCTGGG - Intergenic
1107371632 13:39756733-39756755 GCTCTGGGCGGGGCGGGGGGCGG + Intronic
1107502350 13:40993389-40993411 GGTCTGGGGGGAGCGGGGCTGGG + Intronic
1107628759 13:42320312-42320334 TATCTGGGTGGGGCGGGGTGGGG - Exonic
1108105640 13:47005683-47005705 TCCCTGCGAGGGGTGGGGTTGGG + Intergenic
1113104414 13:106757758-106757780 GCTCCGGGAGGGGTGGGGTGTGG + Intergenic
1113651428 13:112036597-112036619 GCGCTGAGTGGGGTGGGGTTGGG - Intergenic
1113981636 13:114281554-114281576 GCTCGAGGAGGGGCGGGGCTGGG + Intergenic
1114270573 14:21098114-21098136 GCTCCTGGGGGGGCGGGGTGGGG - Intronic
1114549611 14:23525345-23525367 GCTCTGCAAGGGGCGGGTATAGG + Exonic
1114622793 14:24107453-24107475 GGTCGGGGCGGGGCGGGGCTGGG - Intronic
1115855188 14:37622779-37622801 GCGCGGGAAGCGGCGGGGTTAGG + Intronic
1117850889 14:59968264-59968286 GCTCTGGGAGAGGAGGAGGTAGG + Intronic
1118316910 14:64731188-64731210 GCTGGGGGAGGGGCAGGGCTGGG + Intronic
1118339207 14:64880201-64880223 GCTCGGGGTGGCGCGGGGTTAGG - Intergenic
1119539460 14:75428667-75428689 GGCCAGGGAGGTGCGGGGTTGGG + Intronic
1121315546 14:92959117-92959139 GATCTGGTAGGGGCTGGGGTAGG + Intronic
1121478860 14:94243338-94243360 GCTTTCGGAGGAGCGGGGATAGG + Intronic
1121482821 14:94291635-94291657 GCCCTGGGAGGGTCTGGGTGGGG + Intronic
1122767375 14:104081695-104081717 GCTCTGGGTGGGGCTGGGGCCGG + Intergenic
1122870338 14:104635435-104635457 GCCCTGGGAGGGTTGGGGTGTGG + Intergenic
1122891238 14:104733211-104733233 GCTCTGGGCGGGGCGGTGCTGGG - Intronic
1122959188 14:105086901-105086923 GCTCCGGGACCGGCGGGGCTGGG - Intergenic
1122976416 14:105172702-105172724 GAGCTGGGAGGGGTGGGGTCCGG - Intergenic
1123006265 14:105325215-105325237 GCTCGGGGTGGGGTGGGGCTGGG + Intronic
1123437312 15:20264176-20264198 GCACTTGTAGGGGCGGGGGTGGG - Intergenic
1123474848 15:20582320-20582342 GCTCTGGCAGAGGCGGGGGCAGG - Intergenic
1123643163 15:22418037-22418059 GCTCTGGCAGAGGCGGGGGCAGG + Intergenic
1123696022 15:22879879-22879901 GGGCGGGGAGGGGCGGCGTTGGG + Intronic
1123794905 15:23761614-23761636 GCTGGGGGAGGGGAGTGGTTGGG + Intergenic
1124641104 15:31397213-31397235 GTTCAGGGTGGGGCGGGGTGGGG + Intronic
1125051198 15:35299560-35299582 GCGCTGGGCGGCGCGGGGTCAGG + Intronic
1126102838 15:45129973-45129995 GCGCCGGGACGGGCGGGGCTGGG - Exonic
1126106310 15:45149165-45149187 ATTCTGGGAGGGGCTGGGTTTGG - Intronic
1127487982 15:59437256-59437278 GCTCAGGCTGGGGCGGGGTGGGG + Intronic
1128579345 15:68797923-68797945 GCTAGGGGAGGGGTGGGGTGTGG + Intronic
1128635115 15:69298199-69298221 TCTCTGGCAGGGTCGGGGTGGGG + Intergenic
1128688020 15:69701345-69701367 GCCCTGGGAGGGGCAGAGCTTGG + Intergenic
1128707993 15:69851444-69851466 GCAGTTGGAGGGGCTGGGTTTGG - Intergenic
1129210453 15:74065052-74065074 GCTGTGGGAGGGCCGGGGAGGGG - Intergenic
1129245804 15:74277996-74278018 ACTCTGGGAGGGACATGGTTTGG + Intronic
1129273230 15:74430337-74430359 TCTCTGGGATGGGAGGGGCTGGG - Intronic
1129274087 15:74434015-74434037 GCGGGGGGAGGGGCGGGGTGGGG - Exonic
1129334124 15:74842508-74842530 ACCCGGGGAGGGGCGGGGTGGGG - Intronic
1129403560 15:75300321-75300343 GCTGTGGGAGGGCCGGGGAGGGG + Intergenic
1129723433 15:77890040-77890062 GCTTTGGGTGGGGCTGGGCTTGG + Intergenic
1129727650 15:77909684-77909706 GCTGTGGGAGGGCCAGGGTGGGG - Intergenic
1129840239 15:78739286-78739308 GCTGTGGGAGGGCCGGGGAGGGG + Intergenic
1129986569 15:79923872-79923894 GGTGTGTGAGGGGCGGGGATTGG + Intergenic
1130007175 15:80110926-80110948 GCCCTGGGATGGGAGGGGTCAGG + Intronic
1130010844 15:80152487-80152509 GCCAGGGGAGGGGCGGGGCTCGG + Intronic
1130273733 15:82465686-82465708 CCTCTAGGAGGGGTGGGGTGGGG + Intergenic
1130466081 15:84193057-84193079 CCTCTAGGAGGGGTGGGGTGGGG + Intergenic
1130498182 15:84480479-84480501 CCTCTAGGAGGGGTGGGGTGGGG - Intergenic
1130588373 15:85197653-85197675 CCTCTAGGAGGGGTGGGGTGGGG + Intergenic
1130721318 15:86387950-86387972 GTTCTGGGAGGGACAGGGTCTGG + Intronic
1131091033 15:89625184-89625206 GCTGTGGGAGAGGCGGGGGCAGG - Exonic
1131527855 15:93166853-93166875 GGTCTGGGAGGGGCGGGGTGAGG + Intergenic
1132079399 15:98851859-98851881 TCACTGGGAGGGGCTGAGTTTGG - Intronic
1132431672 15:101766258-101766280 GCTGTGGGAGGGCAGGGGTGGGG - Intergenic
1132692723 16:1188815-1188837 GGGCTGGGAGGGCCGGGGTTAGG - Intronic
1132752294 16:1464348-1464370 GCTTTGGGAGGGGCAGGAGTTGG - Intronic
1132981677 16:2741392-2741414 GCTCTGGGAGGGTTGGGGTCAGG + Intergenic
1133719141 16:8478193-8478215 GCTGTGGGAGGAGCAGGTTTTGG - Intergenic
1134523172 16:14927750-14927772 GCTAGGGGAGGGGAGGGGCTGGG - Intronic
1134710839 16:16326401-16326423 GCTAGGGGAGGGGAGGGGCTGGG - Intergenic
1134948762 16:18342244-18342266 GCTAGGGGAGGGGAGGGGCTGGG + Intergenic
1134955747 16:18381469-18381491 GCTAGGGGAGGGGAGGGGCTAGG + Intergenic
1135901593 16:26464933-26464955 CCTCTGGCAGGGGCAGGGCTAGG - Intergenic
1136623111 16:31443063-31443085 GGTCAGGGAGTGGAGGGGTTGGG - Intronic
1137256268 16:46777990-46778012 GCTCTTGTGGGGGCGGGGTGTGG + Intronic
1137612388 16:49827397-49827419 GCTCCAGGAGGGCAGGGGTTTGG + Intronic
1137979185 16:53055293-53055315 GCTCTGGGAGGCGAGGGCTGGGG - Intronic
1138629800 16:58284476-58284498 GCTCTGTGAGGGCAGGGCTTGGG - Intronic
1139403019 16:66696877-66696899 CCTCGGGGAGGGGCGGGGCGAGG + Intergenic
1139558654 16:67728306-67728328 CCCCTGGGAGGGGCTGGGGTAGG - Intronic
1141294712 16:82756902-82756924 GCTCTGTGAGGGCCAGGATTTGG + Intronic
1141575967 16:84963769-84963791 GCTTTGGGAGGGGTGGGTGTGGG + Intergenic
1141638769 16:85329344-85329366 GCTCTGCTAGGGGCGGCGTGGGG + Intergenic
1141656568 16:85419874-85419896 GCTCTGGGAGGGTCAGAGTCGGG + Intergenic
1141829465 16:86501699-86501721 GGTCTGGCAGGGGTGGGGGTGGG - Intergenic
1141879789 16:86850264-86850286 GCTTTGAGAGGGGAGGGGTTGGG - Intergenic
1142177291 16:88651073-88651095 GGCCTGGGCGGGGCGGGGTTCGG - Exonic
1142200558 16:88759320-88759342 GCTCTGAAAGGGGCCGGGTGAGG + Intronic
1142374903 16:89701734-89701756 GCTGGGGGCGGGGCGGGGCTTGG + Intergenic
1142694731 17:1627649-1627671 GCTTTGGGAGGGGGCGGGATGGG - Intronic
1142715173 17:1743220-1743242 GCTCTGGGAAGGGCAGGTGTTGG - Intronic
1142848804 17:2694613-2694635 GAGCTGGGTGGGGCGGTGTTGGG - Intronic
1142990870 17:3730038-3730060 CCTGTGGGAGGGGCAGGGTTGGG - Intronic
1143482191 17:7234227-7234249 GCACTGGGGGCGGTGGGGTTGGG - Exonic
1143803880 17:9409081-9409103 GCTCTGGTGGGGGCGGGGGCAGG - Intronic
1144782180 17:17813809-17813831 GCTCTGGGAGGGGCAGGATGGGG + Intronic
1144849541 17:18237060-18237082 GCTCTGGGTGGGGCTGGCTGGGG + Intronic
1145041263 17:19579826-19579848 GGACGGGGAGGGGCGGGGCTGGG + Intergenic
1145904543 17:28509018-28509040 GATCTGGGGTGGGTGGGGTTGGG + Intronic
1146110361 17:30084038-30084060 ACTCTGGGAGGTGCTTGGTTGGG + Intronic
1146316622 17:31812371-31812393 GTTTTGGGAGGGGTGGGTTTTGG + Intergenic
1147159796 17:38563194-38563216 GCTCTGGGAGGGGAGGGGAAAGG + Intronic
1147161529 17:38571970-38571992 GCCCTGGGAGGGGAGGGGCTAGG + Intronic
1147218576 17:38914981-38915003 GCTCTGGGAGGGGCTGGGTTTGG + Intronic
1147426106 17:40346633-40346655 GCTGCTGGGGGGGCGGGGTTGGG - Intronic
1147998560 17:44374922-44374944 GCTCTGGGAGGGGCGGGGTTTGG - Intronic
1148051551 17:44772290-44772312 GATCTGGGAGGAGAGGGGTCCGG - Exonic
1148183058 17:45620547-45620569 GCCCTGGAAGCGGCGGGGCTGGG + Intergenic
1148265795 17:46225144-46225166 GCCCTGGAAGCGGCGGGGCTGGG - Intronic
1148461181 17:47839896-47839918 GCTCTGGGTGGAGAGAGGTTAGG - Intronic
1148677888 17:49455602-49455624 GCTCTGGGAAGGGCTGGGCAGGG + Intronic
1148836882 17:50470077-50470099 GCTCTGGCACGGCTGGGGTTTGG - Intronic
1149581337 17:57752425-57752447 ACTCTGGGTGGGGCTGGGGTGGG - Intergenic
1149849916 17:60028237-60028259 GCCCAGGGAGGGGCAGGGCTGGG + Intergenic
1149860252 17:60118287-60118309 GCCCAGGGAGGGGCAGGGCTGGG - Intergenic
1149994571 17:61399965-61399987 GCTCTGCGCGGGGCCGGGCTGGG - Exonic
1150003443 17:61455811-61455833 GCTGTGTGAGGGGCTGTGTTTGG + Intronic
1150643528 17:66964816-66964838 GCTCCGGGGGCGCCGGGGTTGGG - Intergenic
1150676010 17:67245992-67246014 GCTCCGGGCGGGGCGGGGCGCGG + Intergenic
1151184470 17:72353107-72353129 GATCTGGGAAGGGCTGTGTTTGG - Intergenic
1151565268 17:74893943-74893965 CCTCGGGGCGGGGCGGGGGTGGG - Intergenic
1151970390 17:77454649-77454671 ACTCTGGGAGGGGCTGAGGTGGG - Intronic
1152262266 17:79273564-79273586 GCTCTGGGGGGGGCGGGGGCGGG + Intronic
1152308477 17:79535102-79535124 GCTGTGGCAGCTGCGGGGTTGGG + Intergenic
1152393811 17:80019440-80019462 AATCTGGGAGGGGCGGGGGGGGG - Intronic
1152596400 17:81239708-81239730 GCTCTTGGAGGGGAAGGGCTGGG - Intronic
1152742689 17:82025231-82025253 GCTCTGGGAAGTGAGGGGCTAGG + Intronic
1152789734 17:82272875-82272897 GCCGTGGGAGGGGAGGGGGTAGG - Intronic
1152970752 18:158804-158826 GGACTGGGAGGGGCCGGGGTGGG + Intronic
1153229011 18:2919508-2919530 GTTGGGGGCGGGGCGGGGTTTGG + Exonic
1153859669 18:9188861-9188883 GCCCAAGGAGGGGCGGAGTTGGG - Intronic
1154161082 18:11981348-11981370 GCTCTGCGAGGGGCGAGGTGGGG + Intronic
1154297516 18:13163297-13163319 GCCCTGGGAGGGGAGGCGTGGGG - Intergenic
1155365970 18:25049374-25049396 GCTCTGAGGGGGGCTGAGTTGGG - Intergenic
1155885836 18:31207102-31207124 GATGTGGGAGGGGCAGGATTGGG - Intergenic
1156135492 18:34032406-34032428 GCTCTGGGATGGGAGAAGTTGGG - Intronic
1157212975 18:45759724-45759746 GTTCTGGAAAGGGCGTGGTTGGG - Intergenic
1157496095 18:48158507-48158529 GGTCTTGGAGGGGTGGGGTGGGG + Intronic
1157741904 18:50100901-50100923 GCTTTGGGAGGGACAGGGCTTGG + Intronic
1158142498 18:54269915-54269937 CCTCTGTGAGGGGCGAGGTGGGG + Intronic
1158960422 18:62583680-62583702 CCTCTTGGTGGGGTGGGGTTGGG - Intronic
1160427500 18:78788158-78788180 GCTTTGTGGGGGGCGGGGGTCGG - Intergenic
1160668153 19:343228-343250 GCTCTGGGGGAGGCTGGCTTGGG + Intronic
1160723786 19:608733-608755 GCTCAGGATGGGGCTGGGTTAGG + Intronic
1160779110 19:870030-870052 TCTCTGGAATGTGCGGGGTTTGG - Intronic
1160871836 19:1281293-1281315 CCTCTGGGTGGGGGGGGGTGGGG + Intergenic
1160980101 19:1812701-1812723 GTTATGGTAGGGGCGGGGCTGGG + Intergenic
1160990451 19:1858206-1858228 GAGCTGGGAGGGGCAGGGTGGGG - Intronic
1161120803 19:2525204-2525226 GCTGTGGGAGGGGCGGGAGCAGG + Intronic
1161133773 19:2607736-2607758 CCACTGGGAGGGGCGGGGGGCGG - Intronic
1161452858 19:4356198-4356220 GCTCTGAGAGGGGAGGGGGCTGG - Intronic
1161619574 19:5291043-5291065 GCTCAGGGAGGGGCTGGGTGGGG + Intronic
1161793429 19:6373801-6373823 GCTGTGGGAGGGGCGGGACCTGG + Intronic
1162550509 19:11355672-11355694 GCGCGGGGAGGGGCGGGGGAGGG + Intronic
1162689136 19:12414276-12414298 GCTCTGTGAGGGTCTGGGTCTGG - Intronic
1162757115 19:12867015-12867037 GGTGTGGGTGGGGCGGGGTCAGG + Intronic
1162903484 19:13809204-13809226 GCTCTGGGATGAGCTGGGTGAGG + Exonic
1163329939 19:16629593-16629615 ATTCTGGGAGGGGCGAGGTTGGG - Intronic
1163417115 19:17193468-17193490 GGTCGGGGAGGGGCTGGGCTCGG - Intronic
1163721289 19:18899367-18899389 GCTGTGTGAGGGGCGGGGTGGGG + Intergenic
1163730041 19:18943649-18943671 TCTCTGGGAGGGGCTGGGACAGG + Intergenic
1164995642 19:32719250-32719272 GCTTTGGGAGGCGAGGGGTGCGG - Intergenic
1165033297 19:33014083-33014105 GCACTTGTAGGGGCGGGGGTGGG - Intronic
1165746016 19:38229753-38229775 GCGCTGGGAGGCGCGGGGATTGG - Intergenic
1165808513 19:38596496-38596518 GCACAGGGAGGGGCGGGCTAGGG + Intronic
1166046293 19:40232932-40232954 GGTCAGGGAGGGGTGGGGGTGGG - Exonic
1166077979 19:40425207-40425229 GTTCTTGGAGTGGCGGGGGTAGG + Intronic
1166167754 19:41004179-41004201 GCACTGGGAGGGGGCGGGTGGGG + Intronic
1166295853 19:41888886-41888908 GCACAGGGAGGGGTGGGGCTGGG + Intronic
1166303290 19:41923894-41923916 GCGCTGGGAGGGGCTGTGCTGGG + Intronic
1166356474 19:42230345-42230367 GCTGTAGGAGGGGCGGGGCCAGG + Exonic
1166532739 19:43552544-43552566 GGTCTGAGAGAGGAGGGGTTGGG - Intronic
1166546362 19:43636599-43636621 TCTCTGGGAGGGGTGGGGGGTGG - Intronic
1166834807 19:45660803-45660825 TGTCTGGGAGGGGCTGAGTTGGG + Intergenic
1167104036 19:47419974-47419996 GCGCTGGGGGCGGCGGGGGTGGG + Intergenic
1167348544 19:48961686-48961708 TTTCTGGGAGGGGTGGGGATTGG + Exonic
1167590451 19:50401934-50401956 GCTCAGGGAGGGGCTGGGTAGGG - Intronic
1167596677 19:50432002-50432024 GCCTGGGGAGGGGCGGGGCTTGG - Intergenic
925381577 2:3431018-3431040 GCTCTGGGAGATGCGGTGTTGGG + Intronic
925611034 2:5703377-5703399 TATCTGGGAGAGGCGGGCTTTGG + Intergenic
925927125 2:8678676-8678698 GCTCGGGGGGGGGGGGGGGTGGG - Intergenic
925971564 2:9110136-9110158 GCTCTGGGAGGGCAGGGGCAAGG - Intergenic
926127953 2:10283453-10283475 GGTTGGGGTGGGGCGGGGTTCGG - Intergenic
926165746 2:10521539-10521561 GCTCCCTGAGGGGCGGGGTCAGG + Intergenic
927701918 2:25274538-25274560 GCTCTGTGAGGAGTGGGGTCAGG - Intronic
927871928 2:26629324-26629346 GTGCTGGGAGGGGTGGGGTGAGG - Intronic
927873273 2:26637994-26638016 GCGCTGGGGGTGGTGGGGTTGGG - Intronic
928167649 2:28982347-28982369 GCGCTGGGAGGGGAGGGACTGGG + Intronic
929484749 2:42343215-42343237 TCTCTGTGACTGGCGGGGTTTGG - Intronic
929560720 2:42954762-42954784 ACGCTGGGAGGGGCCGGGCTTGG - Intergenic
930583920 2:53247569-53247591 GCTGTGTGAGGTGGGGGGTTGGG + Intergenic
931557309 2:63519297-63519319 GCACTGGCAGGTGTGGGGTTGGG - Intronic
931587151 2:63841249-63841271 GCTTGAGGAGGGGCGGGGTTGGG + Intronic
931695109 2:64865393-64865415 GCTCTCGGGGCGGCCGGGTTCGG + Intergenic
932209591 2:69915623-69915645 GCTGGGGAAGGGGCGGCGTTCGG - Intronic
932714632 2:74092427-74092449 GCTCTGGGCTGGGCTGGGCTGGG + Intronic
933699533 2:85244582-85244604 ACTGTGGGAGGGGCAGGTTTGGG + Intronic
933753231 2:85616557-85616579 GTTGGGGGAGGGGTGGGGTTGGG + Intronic
934579208 2:95425095-95425117 GCTCTGTGAGTGGTGGGATTCGG - Intergenic
934600238 2:95651629-95651651 GCTCTGTGAGTGGTGGGATTTGG + Intergenic
934919875 2:98334197-98334219 GCTGTGGCAGGGGTGGGGGTGGG + Intronic
935019094 2:99213390-99213412 GCTCTGGTGGGGGTGGGGGTTGG - Intronic
935111228 2:100096089-100096111 TCTTTGGGAGGGCTGGGGTTGGG - Intronic
935396902 2:102619339-102619361 GCTCTGGGGGTGGCGGGTCTTGG + Intergenic
936123743 2:109769075-109769097 TCTTTGGGAGGGCTGGGGTTGGG + Intergenic
936220943 2:110602391-110602413 TCTTTGGGAGGGCTGGGGTTGGG - Intergenic
936984502 2:118296392-118296414 GATTTGGGAAGGGCAGGGTTTGG - Intergenic
937309305 2:120892288-120892310 GCTCTGGGAGGACTGAGGTTTGG + Intronic
937439323 2:121903243-121903265 GCTCCAGGAGGGGAGGGGCTAGG - Intergenic
938393838 2:130927020-130927042 TCTCTGGTTGGGGAGGGGTTTGG + Intronic
938580935 2:132645973-132645995 ACTCAGGGAGGTGGGGGGTTGGG + Exonic
939527912 2:143320405-143320427 TCTCTGGGGGGGGGGGGGGTGGG - Intronic
939602926 2:144216080-144216102 GCTCTGGGAGTGTGGGTGTTTGG - Intronic
940360420 2:152790774-152790796 GCTCTGGGAAGGGAAGGGCTTGG + Intergenic
942041013 2:172062804-172062826 GCTCTGGAAGGGCTGAGGTTAGG - Intronic
944603231 2:201324836-201324858 CCTCTGGGATAGGTGGGGTTCGG + Intronic
944903509 2:204239796-204239818 GATCTGGGAGGGGAAGGGGTAGG - Intergenic
945017961 2:205539739-205539761 CCTGGGGGAGGGGTGGGGTTCGG - Intronic
945833129 2:214809713-214809735 GCGCGGGGAGGGGCGGGGCACGG + Intergenic
946153781 2:217793835-217793857 GCTGAGGGAGGGCCGGGGTGGGG + Intergenic
946407317 2:219498565-219498587 GCCCTGGAAGGGGCGGGGCCAGG - Intergenic
946855275 2:223944775-223944797 GGGCTGGGAGGGGCGCGGTAGGG + Intronic
948611164 2:239167946-239167968 GCTCTGGGTGGGGCGGGGCGGGG + Intronic
948890067 2:240903266-240903288 GCTCTCGGGAGGGCGGGGCTCGG - Intergenic
949025131 2:241764176-241764198 ACTGTGGGAGGGGCGGGGACTGG + Intronic
1168927885 20:1598048-1598070 GTCCTGGGAGGGGAGGTGTTTGG + Intronic
1170209167 20:13830666-13830688 GCTCCAGGAGGGCAGGGGTTTGG + Intergenic
1170477488 20:16730191-16730213 GATCTCGGAGGGGCAGGCTTGGG + Intronic
1171248883 20:23634130-23634152 GCTCTGGGATCAGCGGGGGTGGG - Intronic
1171297529 20:24031749-24031771 GCTCTGGGTGGTGGGGAGTTTGG + Intergenic
1171847882 20:30288770-30288792 GCTCTTGGTGGGGCTGGGGTTGG - Intergenic
1171873257 20:30547388-30547410 GATTTGGGAGGGGCCGGGGTGGG - Intergenic
1172027758 20:31960650-31960672 GCTATGGGTGGTGGGGGGTTGGG + Intergenic
1172468103 20:35172043-35172065 CGTCTGGGAGGGGCGGAGTCTGG - Intergenic
1172482608 20:35279815-35279837 GGTCAGGGAGGAGCAGGGTTTGG - Intronic
1172639010 20:36429908-36429930 GCTCTCAGAGGGGCTGGGTCAGG - Intronic
1172766267 20:37352693-37352715 GCTCAGAGAGAGGCGGGGATGGG + Intronic
1173455242 20:43196430-43196452 GCTGTGTGTGGGGAGGGGTTGGG - Intergenic
1174043796 20:47718752-47718774 ACACTGGGAGGGGCAGAGTTGGG + Intronic
1174254333 20:49243131-49243153 GCTCTGAGAGGGGTGGGGGGTGG - Intronic
1174424728 20:50423812-50423834 GCCCTGGGAGGGGAGGGGAGAGG + Intergenic
1174845911 20:53943076-53943098 GCCCTGGGAGGTGGGGGGATGGG - Intronic
1174870733 20:54178898-54178920 GTTCCGGGTGGGGCGGGGTGGGG + Intergenic
1175337664 20:58206732-58206754 GCTGGGGGAGGGGAGGGGTGTGG - Intergenic
1175894098 20:62328481-62328503 CCTCTGAGAGGGGCGGGACTGGG - Intronic
1175926987 20:62475870-62475892 GCGCTGGGAGGGGCCGGGTGGGG + Intronic
1175939446 20:62531312-62531334 GCTCAGGGAGGGGCAGGCTCAGG - Intergenic
1175939452 20:62531328-62531350 GCTCAGGGAGGGGCAGGCTCAGG - Intergenic
1175968170 20:62670239-62670261 GCTCAGGGAGTGGTGGTGTTTGG + Intronic
1176237936 20:64062960-64062982 GCTCTGGGAGGGGCGTGCCCGGG + Intronic
1176551771 21:8226184-8226206 GCTCTGGGCGGGGCGAGGCGAGG + Intergenic
1176570680 21:8409183-8409205 GCTCTGGGCGGGGCGAGGCGAGG + Intergenic
1176578589 21:8453330-8453352 GCTCTGGGCGGGGCGAGGCGAGG + Intergenic
1179185120 21:39079707-39079729 GCTCTTGCAGGGGTGGGGTTGGG - Intergenic
1180004108 21:45012075-45012097 GCCCTGGGCGGGGCGGTGTGTGG - Intergenic
1180005905 21:45020453-45020475 GCTGCGGGAGGGGTGGGGGTGGG - Intergenic
1180091664 21:45536684-45536706 GGTCTGGGAGGGTTGGGGTCCGG + Intronic
1180181341 21:46119917-46119939 TCTCTGGGAGGAATGGGGTTGGG - Intronic
1180830338 22:18902503-18902525 GTTCTGGGAGGAGCAGGCTTAGG + Intergenic
1181069374 22:20323030-20323052 GTTCTGGGAGGAGCAGGCTTAGG - Intergenic
1181107324 22:20582881-20582903 GCTCTGGGAGGGCTGCGGTGAGG - Exonic
1181116300 22:20634374-20634396 GCTCTGGTAGAGACAGGGTTTGG + Intergenic
1181171537 22:21012807-21012829 GCTCTGGGAGAGGTGGGGGTGGG - Intronic
1181459674 22:23078664-23078686 GCTCTGGGTGGGCCAGGGTTTGG + Intronic
1181633344 22:24162890-24162912 GCCCTGGGAGGTGCAGGGATGGG + Intronic
1181748736 22:24974140-24974162 GGTCTGGGTGGGGCAGGTTTGGG + Intronic
1182137974 22:27923528-27923550 ACTCTGGGACGGACAGGGTTAGG + Intergenic
1182490812 22:30670556-30670578 GATCTGGGAGGCGGGGGCTTGGG - Intergenic
1182715552 22:32354128-32354150 GTTTTGGGAGGGGGCGGGTTGGG - Intergenic
1183386848 22:37519646-37519668 CCTCTGGGCGGGGCGGGGGCGGG + Intergenic
1183601108 22:38841171-38841193 CCTCTGGGAGGGGCTGGGGCTGG - Intronic
1184155414 22:42663572-42663594 GCTCTGGGAGCTGCTGGGTGAGG + Intergenic
1184274966 22:43404932-43404954 GCTCTGGGTGGTGCTGGTTTGGG + Intergenic
1184474441 22:44712906-44712928 GCACTGGGAAGGGAGGGGTTGGG + Intronic
1184506412 22:44906459-44906481 GCTCAGAGAGGTGCGGGGCTGGG + Intronic
1184742714 22:46438361-46438383 CCGCTGTGAGGGGCCGGGTTGGG - Intronic
1184743710 22:46444023-46444045 GCTGTGGGAAGGGCAGGGCTGGG - Intronic
1184942762 22:47781166-47781188 GCTCTGAGTGGCGCGGGCTTTGG + Intergenic
1185101978 22:48845449-48845471 GCCCTGCGAGGGGCCGGGGTCGG + Intronic
1185253908 22:49821198-49821220 GCTCTGGGAGAGGCCGGGCCTGG - Intronic
1185344302 22:50304707-50304729 GCTGTGGGTGGGGTGGGGCTGGG - Intronic
1203256792 22_KI270733v1_random:143101-143123 GCTCTGGGCGGGGCGGGGCGAGG + Intergenic
1203280427 22_KI270734v1_random:127774-127796 GTTCTGGGAGGAGCAGGCTTAGG + Intergenic
949785373 3:7734234-7734256 GCTTTGGCAGGGGCGGGGGGGGG + Intronic
950100969 3:10356622-10356644 GCTCTGGGAGGGCCCGGGAAGGG + Intronic
952152266 3:30606435-30606457 GCTCTCGGAGGGGCTGGTCTAGG + Intergenic
952533838 3:34289886-34289908 GCTGTGGGAAGGGTGGGGTGTGG + Intergenic
952970741 3:38649169-38649191 GCTCGGGGAGGGTCTGGGATTGG - Intronic
953154398 3:40355886-40355908 ACTTTGGGAGGAGGGGGGTTGGG - Intergenic
953664356 3:44915489-44915511 GTTCTGGGAGGTGCTGGGCTGGG - Intronic
953670572 3:44958849-44958871 GCTCTGGGAGGGGTTTGGTCTGG - Intronic
953671382 3:44965086-44965108 GCTCTGTGAGGGGCAGTGTGTGG + Intronic
953696474 3:45163972-45163994 GCTCTGAGAGAGGTGGGGATGGG + Intergenic
954108185 3:48420196-48420218 GCTGTGGGTGGGGAGGGGCTGGG + Exonic
954410277 3:50367598-50367620 TCCCTGGCAGGGGCAGGGTTTGG + Intronic
954615662 3:51967668-51967690 GCTCTGGGAGTGGCAGGGGAAGG - Intronic
955329430 3:58034843-58034865 CCTCTGGGAGGTGTGGGGTGTGG - Intronic
955924008 3:63988203-63988225 GTTCTAGGAGGGGCGGGATGCGG - Exonic
955981716 3:64533876-64533898 ACCCTCGGAGGGGAGGGGTTTGG - Intronic
956928817 3:74019339-74019361 GCTTTGGGAGGAGGAGGGTTGGG + Intergenic
958881009 3:99669848-99669870 GCTCTTTGAGGGGTGGGCTTGGG + Intronic
959398367 3:105869044-105869066 GCTCGGGGCGGGGCGGGGCGGGG + Intronic
959592303 3:108093524-108093546 GCTCAGGGAGGGACGGTGGTTGG + Intergenic
961536819 3:127575708-127575730 GCTCTGGGACAGGCGGGGATGGG - Intronic
961821414 3:129577484-129577506 GCTCTGGGAGGGCTAGGGTGGGG - Intronic
962740916 3:138362069-138362091 GCACTGTGAGGGGCTGGGGTAGG + Intronic
963038663 3:141052730-141052752 GCTCGGGAAGGGAGGGGGTTGGG + Intronic
963786122 3:149536152-149536174 GCTCTGTGAGGGAAGGGGCTGGG + Intronic
965881735 3:173395904-173395926 GCTCTGAGGGGGGCAGGATTGGG + Intergenic
967028203 3:185582693-185582715 GCTGTGGCAGTGGTGGGGTTGGG + Intronic
968526579 4:1061107-1061129 GCTTTGGGAGGAGCGGGACTTGG + Intronic
968881461 4:3302373-3302395 GGTCTGGGGTGGGTGGGGTTGGG + Intronic
968984983 4:3870139-3870161 GCTCTGGGAGAGCTGGGGTCTGG - Intergenic
969178249 4:5416480-5416502 GCTATGGCTGGGGCGGGGGTAGG - Intronic
969244492 4:5923664-5923686 TTTGTGGGAGGGGCTGGGTTAGG - Intronic
969506491 4:7591345-7591367 GGGCTGGGAGGGGCTGGATTAGG + Intronic
969545709 4:7826308-7826330 CCTCTGGGGGCGGCGGGGTGGGG - Intronic
969597649 4:8158220-8158242 GCTCTGGCAGCGCCTGGGTTGGG - Intronic
971375496 4:26052745-26052767 GCTCAGGGTGGGGCAGGGGTGGG - Intergenic
972267905 4:37480769-37480791 TCTCTGGGAAGGGAGGAGTTTGG + Intronic
972817174 4:42657126-42657148 GCTCGGCGAGGGGCGGAGCTCGG + Intergenic
974432670 4:61817980-61818002 GATTTGGGAGGGGCTGGGATGGG - Intronic
976068284 4:81214868-81214890 GCGCGGGGAGGGACGGGGTCGGG - Intronic
976874500 4:89837051-89837073 GCTCTCGGAGGGGCCGGGCCGGG + Intronic
978904168 4:113986183-113986205 GATTTGGGAGGGGCCAGGTTTGG + Intergenic
980075227 4:128287550-128287572 GCGCTGGGGGCGGCGGGGTCTGG - Exonic
982436352 4:155385687-155385709 GCACTGGGAGGGGCTGGGCATGG - Intergenic
983249520 4:165328137-165328159 GCTTTGGGAGTAGTGGGGTTGGG + Intronic
983944051 4:173566735-173566757 GCTGCGGGAGGGCTGGGGTTGGG - Intergenic
985579551 5:689653-689675 GCTCTGGGAGGGGGTGGCTCTGG + Intronic
985594397 5:781712-781734 GCTCTGGGAGGGGGTGGCTCTGG + Intergenic
989170895 5:38469613-38469635 GCTGTGGGAGGAGAGGGGTATGG + Intergenic
989599916 5:43191983-43192005 GCTCGGGGAGGGGGGTGATTGGG - Intronic
992071807 5:73155536-73155558 GCTCTGGGAGGGATGCGGCTGGG - Intergenic
994156680 5:96511554-96511576 TGTCTGGGAGAGGAGGGGTTAGG - Intergenic
994727556 5:103454299-103454321 GGTGTGGGAGGGGCAGAGTTTGG - Intergenic
995022376 5:107381038-107381060 GCTGGGGGTGGGGCGGGGTGGGG + Exonic
995393050 5:111660473-111660495 GATCTGCGAGGGGCGGGGGGTGG - Intergenic
996088805 5:119330505-119330527 GTTCTGGGAGGGTAGGGGTTAGG + Intronic
998402729 5:141856301-141856323 GCGCATGGAGGGGCGGGGTGGGG + Intronic
999080874 5:148842493-148842515 ACTCTGGAAGGGGCAAGGTTAGG - Intergenic
999309134 5:150540255-150540277 GCTCTGGCAGGTGGGGGGCTGGG + Exonic
999382911 5:151134362-151134384 GCCTTGGGAGGGGAGAGGTTGGG - Intronic
1000040072 5:157478940-157478962 GCTCTGTGAGGCATGGGGTTGGG + Exonic
1000063223 5:157674307-157674329 GATCTGGGAGGTGGGGGGTTGGG - Intronic
1000990259 5:167904578-167904600 TCTCTGTGTGGGGCGGGGCTGGG - Intronic
1001462076 5:171924832-171924854 GCTCTGGGAGTGGCGAGGTCTGG - Intronic
1002134004 5:177097201-177097223 TCTCTGGGTGGGGAGGAGTTTGG - Intronic
1002561117 5:180083046-180083068 GCTGTGGGAGGGGGGCGGGTGGG - Intergenic
1002923999 6:1594584-1594606 GTGCTGGGAGGGGCGTGGTGGGG - Intergenic
1003512400 6:6792366-6792388 GATCTGGGAGGGGAGGGATTTGG - Intergenic
1004250927 6:14022632-14022654 GTTCTGGGAGAGGTGGGGTTTGG + Intergenic
1004263216 6:14126470-14126492 GCCGTGGGAGGGCTGGGGTTTGG + Intronic
1005301887 6:24479097-24479119 TCTCTGGTTGGGGAGGGGTTTGG - Intronic
1006043125 6:31271380-31271402 GGTCGGGGCGGGGCGGGGCTCGG - Intronic
1006052715 6:31356474-31356496 GGTCGGGGCGGGGCGGGGCTCGG - Intronic
1006154447 6:32006743-32006765 GCTCAGGGAGGGGCTGGGGGTGG - Intergenic
1006160760 6:32039479-32039501 GCTCAGGGAGGGGCTGGGGGTGG - Intronic
1006429802 6:33988623-33988645 ACTCTGGGAGGGGCGTGGGGTGG - Intergenic
1006668722 6:35716427-35716449 GCTCTGGGAGGGGTGGGCAGAGG + Intronic
1006860638 6:37169938-37169960 GCGCTGGCAGGGGCGGGGCCGGG + Intergenic
1006932226 6:37695356-37695378 GGACTGGGAGAGGCTGGGTTTGG - Intronic
1007070880 6:39037438-39037460 GCTCTGGAGGGAGCAGGGTTGGG - Intergenic
1007237430 6:40400991-40401013 CCTCTGGGGGAGGTGGGGTTAGG - Intronic
1007342458 6:41200285-41200307 CCTCTGGGAGGTGCAGAGTTGGG + Intronic
1007398336 6:41589867-41589889 GCTCTGGGAGGGGCGGGGAGGGG - Intronic
1007759966 6:44127839-44127861 GCTCGGGATGGTGCGGGGTTGGG - Intronic
1012447748 6:99323922-99323944 GCACTGGGAGGGGAGGGGAGAGG - Intronic
1013130016 6:107223761-107223783 GCTCTTGGTGGGTCGGGGTCGGG - Intronic
1013196512 6:107849092-107849114 GCTGGGGGACGGGCGGGGTGGGG - Intergenic
1015773625 6:136792589-136792611 GCTCTGGGAGGGGCCAGGAAGGG + Intergenic
1016924529 6:149329661-149329683 GAGCTGGGGGGGGCGGGGTTGGG + Intronic
1018246550 6:161829732-161829754 GCTCTGGGAGTGGAGGAGCTGGG - Intronic
1019125729 6:169839182-169839204 GCACGGTGTGGGGCGGGGTTTGG - Intergenic
1019182086 6:170193776-170193798 GCTCTGGCAGGGGTGGGATGGGG - Intergenic
1019303725 7:322459-322481 GCCCTGGACGGAGCGGGGTTGGG + Intergenic
1019353875 7:568954-568976 TCTCTGGGAGGGGAGGGTTGAGG + Intronic
1019428627 7:988570-988592 GCTCCTGGAGGGGAGGGGTGGGG - Intronic
1019494661 7:1332151-1332173 GGGCTGGGAGGAGCGGGGGTGGG + Intergenic
1019560655 7:1654944-1654966 GCGCTGGGCGGGGCGAGGCTGGG - Intergenic
1019585979 7:1803744-1803766 TCTCTGGTTGGGGAGGGGTTTGG + Intergenic
1020028987 7:4920036-4920058 GAGCTGGGAGGGGCTGGGCTGGG - Intronic
1020106149 7:5423251-5423273 GCCCCGGGAGGGGTGGGGGTGGG - Intronic
1020234994 7:6348531-6348553 GCTCGGGGAGGGCCGGGGGCCGG + Intronic
1020511330 7:9060993-9061015 GCTCTGGGAGTGACAGGGGTTGG - Intergenic
1020607776 7:10360087-10360109 GCTCTGGTAGGGGAGGGGAGAGG + Intergenic
1022480749 7:30741565-30741587 GGTCTGGGAGGGGAGGGGACTGG - Intronic
1024876879 7:54036393-54036415 TCTCTGGTTGGGGAGGGGTTTGG - Intergenic
1026772244 7:73209917-73209939 GGCCTGGGAGGGACGGGGGTGGG - Intergenic
1026891709 7:73986261-73986283 GCTCAGGGAGGGTGGGGCTTAGG + Intergenic
1027013113 7:74763310-74763332 GGCCTGGGAGGGACGGGGGTGGG - Intergenic
1027074928 7:75182724-75182746 GGCCTGGGAGGGACGGGGGTGGG + Intergenic
1027218289 7:76198212-76198234 GCCCTGGGAGTGGGGGGGGTTGG - Intergenic
1029168535 7:98614890-98614912 GATAAGGGAGGGGCGGGGGTTGG - Intergenic
1029370639 7:100148658-100148680 GATCTGGGAGGGGCGGGAGTAGG - Intergenic
1029383886 7:100231040-100231062 GCTCAGGGAGGGGCAGGGCAAGG + Intronic
1030527528 7:110672424-110672446 GATTTGGGAGGGGCTGGGTGTGG - Intronic
1031332871 7:120487660-120487682 GCTCTGGAAGGAGAGGGATTGGG - Intronic
1033477013 7:141701723-141701745 GCTTGGGGAAGGGCGGGGGTCGG - Intronic
1034397521 7:150838562-150838584 GGGCTGGGAGGGGCTGGGCTTGG - Intronic
1034645421 7:152642051-152642073 GCTAAGGAAGGGGTGGGGTTGGG - Intergenic
1034882496 7:154773186-154773208 CCTCTGGGAGGGGCATGGCTGGG + Intronic
1034976639 7:155453171-155453193 GCCCTGGGAGGGGCAGGTTTGGG - Intergenic
1035264727 7:157684711-157684733 GCCCGGGGAGGGGCGGGGAGGGG - Intronic
1035436579 7:158864027-158864049 GCTCTGGGTGTGGCGGGGTGGGG + Intronic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1035740697 8:1926009-1926031 CCTCTGGGAGAGGCTGGGGTGGG + Intronic
1036642394 8:10592582-10592604 GCCCTGGGAGGGGCAGGCTGTGG - Intergenic
1037815634 8:22110194-22110216 GCCCTGGGAGGGCGGGGGTGGGG + Intergenic
1037820249 8:22131669-22131691 CCTCTGGGAGGGCCTGGGCTTGG + Exonic
1038933439 8:32220730-32220752 GCTCCGGGAGGGGCGTTGCTGGG - Intronic
1039473453 8:37827360-37827382 GCCCTGGCAGGTGTGGGGTTAGG + Intronic
1039882010 8:41630909-41630931 GGTCCGGGAGAGGCAGGGTTGGG - Intergenic
1039887863 8:41665425-41665447 TCTCTGGGCAGGGCGGGGTTAGG - Intronic
1040543602 8:48380435-48380457 GTTCCGGGAGGCGCGGGGTCTGG - Intergenic
1040878022 8:52173502-52173524 GCTCTGGGAGTGGCCAGGTTGGG + Intronic
1040944523 8:52869857-52869879 TCTCTGGTTGGGGAGGGGTTTGG + Intergenic
1041569574 8:59322352-59322374 GCTATGGGAGGGGCAGGTCTGGG - Intergenic
1042061469 8:64822773-64822795 GCTCTGGGAGGCTGGGGGTAAGG + Intergenic
1042399730 8:68331411-68331433 TCCCTGGGAGGGGTGGGATTGGG - Exonic
1042884503 8:73532896-73532918 GCTGTGGAAGGGGCTGGGTGGGG - Intronic
1042938656 8:74086036-74086058 GGGCTGGGAGGGGGGTGGTTGGG - Intergenic
1044713890 8:95082571-95082593 CCTGTGGTAGGGGCGGGGGTGGG + Intronic
1047211164 8:122841528-122841550 GCACTTGGAGGGTCGGGGGTTGG + Intronic
1047448281 8:124939034-124939056 GCCCTGGGAGGGGTGGGGAGGGG - Intergenic
1047731345 8:127731446-127731468 TCTCCTGGAGGGCCGGGGTTGGG - Intergenic
1047732488 8:127738134-127738156 GCTCTGCAAGGGGAGAGGTTCGG + Intronic
1048308068 8:133297301-133297323 GGTCTGGGAGGGGCGAGGCGCGG - Exonic
1048967456 8:139625045-139625067 GTTCTGGGAGGGGCCAGGTGAGG - Intronic
1049248505 8:141575775-141575797 GCACTGGGAGGGGCAGGGCAGGG - Intergenic
1049400362 8:142423979-142424001 GGTCCAGGAGGGGCTGGGTTTGG + Intergenic
1049427443 8:142543716-142543738 GGGCAGGGAGGGGCGGGGTGGGG + Intronic
1049555352 8:143278756-143278778 GCTCCTGGAGGGGCGGGGAGGGG + Intergenic
1049709377 8:144056797-144056819 GCGCTGGGTGGGGTGGGGTCAGG - Intronic
1049789304 8:144465711-144465733 GGGCTGCGAGGGGCGGGGTCTGG + Intergenic
1049803464 8:144528692-144528714 TCTCTGGGCGGGGCGGGGGGGGG - Intronic
1050151488 9:2622516-2622538 GCTCTGGGGGAGGCGGAGTGAGG - Intronic
1050848321 9:10252525-10252547 ACTCTGGGAGTGACTGGGTTGGG - Intronic
1051629325 9:19127626-19127648 ACTCTAGGAGGGCCGGCGTTGGG - Intronic
1052967592 9:34352480-34352502 GCAGTGGGGGGGGCGGGGTGGGG + Intergenic
1053786017 9:41653417-41653439 GCTCTTGGTGGGGCTGGGGTTGG - Intergenic
1054159033 9:61660779-61660801 GCTCTTGGCGGGGCTGGGGTTGG + Intronic
1054174733 9:61867350-61867372 GCTCTTGGTGGGGCTGGGGTTGG - Intergenic
1054478807 9:65591784-65591806 GCTCTTGGCGGGGCTGGGGTTGG + Intergenic
1054662805 9:67713443-67713465 GCTCTTGGTGGGGCTGGGGTTGG + Intergenic
1055740387 9:79382127-79382149 CCTCTGGGAGGGGTGGGCTGGGG + Intergenic
1056223243 9:84470266-84470288 GAGCTGGGATGGGCGTGGTTTGG - Intergenic
1056223609 9:84473515-84473537 TCTTTGGAAGGGGCAGGGTTTGG - Intergenic
1056491031 9:87107318-87107340 GTTTTGGGAGGGGAGGGGTGGGG + Intergenic
1057311694 9:93947341-93947363 GCTTGGGGCGGGGCGGGGTGGGG - Intergenic
1057781916 9:98056974-98056996 GCGCCGGGAGGGGCGGGGCGGGG + Intronic
1057877905 9:98771708-98771730 GCTGTGGGAGGAGTGGGGTAAGG - Intronic
1058661058 9:107269398-107269420 GCTCTGGGTGGGGTGGGATGTGG - Intergenic
1058778147 9:108305837-108305859 GGTCGGGGGGGGGCGGGGGTGGG - Intergenic
1059068562 9:111110412-111110434 GCTCTGGGATGGGCTGGCTCTGG - Intergenic
1059346534 9:113632673-113632695 GTTCTTGGAGGTGCGGAGTTGGG + Intergenic
1060552350 9:124491557-124491579 ATGCTGGGAGGGGAGGGGTTGGG + Intronic
1060598397 9:124861857-124861879 GCGCTGTGAGGCGCGGGGGTTGG - Intronic
1060745068 9:126125977-126125999 GCCCTGGGAGGGGGGTTGTTGGG - Intergenic
1060801376 9:126547792-126547814 GCTCTGGGTGGGGAGGGATGAGG - Intergenic
1060962064 9:127688102-127688124 CCCCTGGGAGGGGAGGGGATGGG - Intronic
1061370414 9:130194512-130194534 GCCCTGGGAGAGGGGGGGCTGGG - Intronic
1061397109 9:130349262-130349284 GCTCTGTGAGGATGGGGGTTGGG - Intronic
1061486565 9:130923445-130923467 GCAGGGGGTGGGGCGGGGTTTGG - Intronic
1061579289 9:131527019-131527041 GCTCTGGGTGGGGCTGGGGCCGG + Intronic
1061871393 9:133522556-133522578 ACTCTGGGTGGGGCAGGGTGGGG + Intronic
1061880258 9:133565448-133565470 GCCCAGGGAGGTGCGGGGCTGGG - Intronic
1061929599 9:133825531-133825553 GAGCTGGGAGAGGCTGGGTTTGG - Intronic
1062055793 9:134469180-134469202 CATCTGGGAGGGGCAGGGCTGGG + Intergenic
1062063679 9:134514506-134514528 GCTCAGGGTGGGGCTGGGGTGGG - Intergenic
1062197314 9:135281498-135281520 GGTCAGGGAGGGGCAGAGTTAGG - Intergenic
1062290386 9:135791741-135791763 GAGCTGGGAGGGGCAGGGCTGGG + Intronic
1062346512 9:136117727-136117749 GCTGTGGGAGGGAAGGGGCTGGG + Intronic
1203472950 Un_GL000220v1:124788-124810 GCTCTGGGCGGGGCGAGGCGAGG + Intergenic
1186760274 X:12716002-12716024 GTTTTGGGTGGGGCGGGGGTGGG - Intronic
1186964935 X:14776599-14776621 GCTCTTGGAGAGGTGGGGCTGGG - Intergenic
1187303912 X:18077740-18077762 GCTCTAGGAGGGATGGGGTAGGG + Intergenic
1188274088 X:28178633-28178655 GCTCAGTGCGGGGCGGGGTGGGG + Intergenic
1188995292 X:36877501-36877523 GCTTTGGGAGGGGCAGGGTTGGG + Intergenic
1189216200 X:39326953-39326975 GCTCTGGGAGGGGAAGGCTTTGG - Intergenic
1189321562 X:40090445-40090467 GTTCGGGGAGGGGCGGGGCGGGG + Intronic
1189333135 X:40155053-40155075 GCTGCGGGAGGGGAGGGGGTCGG + Intronic
1191717796 X:64205277-64205299 GCTTTCGGGGGGGCGGGGATGGG - Intronic
1192155865 X:68746210-68746232 GCTCGGGCAGGGGTGGGGGTGGG - Intergenic
1192210256 X:69123355-69123377 ACTCTTTGAGGGGCGGGGTGGGG + Intergenic
1197726785 X:129781803-129781825 GCTCTGGCAGGGGTTGGGGTGGG - Intronic
1198750566 X:139933089-139933111 GGCCTGGGTGGGGCGGGGTGGGG - Intronic
1199649620 X:149939246-149939268 GCTCGGGGAGGGGTGGGGCGGGG + Intergenic
1199949937 X:152699290-152699312 GCTAAGGGAGGGAAGGGGTTCGG + Intronic
1199952129 X:152715163-152715185 GCTAAGGGAGGGAAGGGGTTGGG + Intronic
1199954771 X:152734356-152734378 GCTCAGGGAGGGAAGGGGGTCGG + Intronic
1199957554 X:152753285-152753307 GCTAAGGGAGGGAAGGGGTTGGG - Intronic
1199959737 X:152769171-152769193 GCTAAGGGAGGGAAGGGGTTCGG - Intronic
1200054936 X:153455394-153455416 GGGCTGGGAGGGGCTGGGCTGGG - Intronic
1200066782 X:153507781-153507803 TCTCTGGGAGGAGCGGAGGTGGG - Intronic
1200068277 X:153515378-153515400 GCTCTGGGAGGGCAGGTGTGGGG - Intergenic
1200129022 X:153830963-153830985 GCGCCGGGAGGGGCGGGGAGGGG + Intergenic
1200237949 X:154478256-154478278 GTTCTGAAAGGGACGGGGTTGGG - Intronic
1202367904 Y:24179466-24179488 GCTGTGGGAGGGCCGGGGAGGGG + Intergenic
1202376939 Y:24246442-24246464 GCTGTGGGAGGGCCGGGGAGGGG - Intergenic
1202493841 Y:25423679-25423701 GCTGTGGGAGGGCCGGGGAGGGG + Intergenic
1202502879 Y:25490651-25490673 GCTGTGGGAGGGCCGGGGAGGGG - Intergenic