ID: 1147998812

View in Genome Browser
Species Human (GRCh38)
Location 17:44375838-44375860
Sequence GAGGGTTGACAGGAGGCTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 324}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147998799_1147998812 18 Left 1147998799 17:44375797-44375819 CCGCCTTCCCAGGTCTTTCTTCC 0: 1
1: 1
2: 3
3: 63
4: 654
Right 1147998812 17:44375838-44375860 GAGGGTTGACAGGAGGCTGTGGG 0: 1
1: 0
2: 1
3: 29
4: 324
1147998806_1147998812 -6 Left 1147998806 17:44375821-44375843 CCCAGCTCTTACCTTGAGAGGGT 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1147998812 17:44375838-44375860 GAGGGTTGACAGGAGGCTGTGGG 0: 1
1: 0
2: 1
3: 29
4: 324
1147998801_1147998812 11 Left 1147998801 17:44375804-44375826 CCCAGGTCTTTCTTCCACCCAGC 0: 1
1: 0
2: 2
3: 21
4: 269
Right 1147998812 17:44375838-44375860 GAGGGTTGACAGGAGGCTGTGGG 0: 1
1: 0
2: 1
3: 29
4: 324
1147998803_1147998812 -3 Left 1147998803 17:44375818-44375840 CCACCCAGCTCTTACCTTGAGAG 0: 1
1: 0
2: 0
3: 13
4: 189
Right 1147998812 17:44375838-44375860 GAGGGTTGACAGGAGGCTGTGGG 0: 1
1: 0
2: 1
3: 29
4: 324
1147998802_1147998812 10 Left 1147998802 17:44375805-44375827 CCAGGTCTTTCTTCCACCCAGCT 0: 1
1: 0
2: 1
3: 23
4: 317
Right 1147998812 17:44375838-44375860 GAGGGTTGACAGGAGGCTGTGGG 0: 1
1: 0
2: 1
3: 29
4: 324
1147998807_1147998812 -7 Left 1147998807 17:44375822-44375844 CCAGCTCTTACCTTGAGAGGGTT 0: 1
1: 0
2: 1
3: 11
4: 97
Right 1147998812 17:44375838-44375860 GAGGGTTGACAGGAGGCTGTGGG 0: 1
1: 0
2: 1
3: 29
4: 324
1147998800_1147998812 15 Left 1147998800 17:44375800-44375822 CCTTCCCAGGTCTTTCTTCCACC 0: 1
1: 0
2: 5
3: 40
4: 381
Right 1147998812 17:44375838-44375860 GAGGGTTGACAGGAGGCTGTGGG 0: 1
1: 0
2: 1
3: 29
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147998812 Original CRISPR GAGGGTTGACAGGAGGCTGT GGG Exonic
900184168 1:1325185-1325207 GGGGGCTGACAGCAGGCTGGGGG - Intronic
900620189 1:3583267-3583289 GTGGGTTGTCTGGTGGCTGTGGG - Intronic
901184913 1:7366751-7366773 GTGCGTTGACAGGAGACTGCAGG + Intronic
901229040 1:7631782-7631804 GAGGGTAGCCAGGAGGCAGGGGG - Intronic
901233070 1:7652012-7652034 GAGGGATGGCAGGGGGCTGAGGG - Intronic
901234634 1:7661351-7661373 GAGAGTGGACAGGAGGCTGAGGG - Intronic
901839983 1:11948100-11948122 GAGGGGTGGCAGGAGGATCTAGG + Intronic
902810149 1:18883461-18883483 GAGGATGGACAGGAGGCTGTTGG - Intronic
902872557 1:19323280-19323302 GAGGCTTGTTAGGAGGCTGAGGG + Intronic
903013782 1:20348784-20348806 GAAGGCTCAAAGGAGGCTGTTGG - Intronic
903017191 1:20368855-20368877 GAGGGTGGATAGGAGGCTGGAGG + Intergenic
903171742 1:21558682-21558704 GAGGGTGGACCTGGGGCTGTCGG + Intronic
904007887 1:27373381-27373403 AAGGGTTCTGAGGAGGCTGTGGG + Intronic
904253448 1:29240056-29240078 GAGAGGAGACAGCAGGCTGTGGG - Intronic
905013920 1:34764236-34764258 GAGGGTTGGCAGGAAGTGGTAGG + Intronic
905527289 1:38648630-38648652 GAAGGGTGACCAGAGGCTGTGGG - Intergenic
906195188 1:43925870-43925892 GAGGGCTGAGAGGTGGCCGTCGG + Intronic
906197555 1:43938345-43938367 AGGGGTTGTCAGGAGGCAGTGGG + Intergenic
906289219 1:44609253-44609275 GAGGGTTGAAATGAGGGTGAGGG - Intronic
908181467 1:61610358-61610380 GACAGATGACAGGAGGCTGAGGG + Intergenic
908478873 1:64517447-64517469 GAGAGTTGGCAGGGAGCTGTGGG + Intronic
911199113 1:95026520-95026542 GAGAGAGGACAGCAGGCTGTTGG + Intronic
911530218 1:99035555-99035577 GATGGTTGCCAGGAGGCTGGGGG + Intergenic
911716089 1:101134769-101134791 GAGGGGTGGCAGGAGCCTGTAGG - Intergenic
912504213 1:110144597-110144619 GAGGCTTGGCTGGAGGCTGGAGG + Intergenic
914870553 1:151470409-151470431 GAGAGTTGAAAGGAGGTTGAGGG - Intergenic
915276020 1:154788702-154788724 GCTGGCTCACAGGAGGCTGTGGG - Intronic
915765027 1:158354090-158354112 GAGGGCTGAGAGGAAGCTCTGGG + Intronic
916269330 1:162922823-162922845 GAAGGTGGAGAGGTGGCTGTTGG + Intergenic
916466191 1:165076641-165076663 GGGGGTTGACAGAAGGGTCTGGG + Intergenic
918131737 1:181635411-181635433 GAAAGATGACAGAAGGCTGTGGG - Intronic
919340519 1:196300937-196300959 GAGGACTGACAGGAGGTTGTAGG - Intronic
920547002 1:206826569-206826591 GAGGGTGGACTGGAGGCTGCTGG - Intronic
920971710 1:210748786-210748808 CAAGGGTGACAGGAGGCTGTGGG - Intronic
920976680 1:210792280-210792302 GGGGGTTGACAGGAAGATTTGGG - Intronic
922779418 1:228239961-228239983 GAGGGTGGAGAGGAGGCCATAGG + Intronic
1063218911 10:3948367-3948389 GAGGGTGGAAGGGAGGCTGAGGG + Intergenic
1064276492 10:13910853-13910875 GAGGCTTAACAGGATGGTGTTGG - Intronic
1067095329 10:43295692-43295714 GAGGGGTGAGAGGAGGCGGAGGG - Intergenic
1067724969 10:48762927-48762949 GAGGGGTGACAGGTGTGTGTAGG + Intronic
1070601466 10:77869169-77869191 CATGGTGGACAGGACGCTGTAGG + Exonic
1070693623 10:78545491-78545513 AAGGGTTGGCAGGAAGCTGCTGG + Intergenic
1070729913 10:78819549-78819571 TAGGGCTGTCAGGATGCTGTAGG + Intergenic
1071290387 10:84184824-84184846 AAGGGGAGACAGGAGGCTGCTGG - Exonic
1071848359 10:89542856-89542878 AAGGGTGGATAGGAGGCTGTTGG - Intronic
1072210977 10:93246871-93246893 GAGACTTGAGTGGAGGCTGTAGG - Intergenic
1073197986 10:101710503-101710525 GAGGCTTGAGGGGAGGCTGAAGG + Intergenic
1073861964 10:107755049-107755071 GCAGGGTGACAGGAGGCTGGAGG + Intergenic
1074185729 10:111098217-111098239 GAGTGTGGGCAGGAGGCTGCAGG - Intergenic
1075651939 10:124132893-124132915 GAGGGGTGATAGGAGCCTGGGGG + Intergenic
1076103021 10:127797798-127797820 GAGGGATGAGGGGAGGCTGCGGG - Intergenic
1077077136 11:706896-706918 GTGGGCTGGCAGGAGCCTGTGGG + Intronic
1077168314 11:1153542-1153564 GAGGGTTCCCAGGAGGCAGGTGG + Intergenic
1077244949 11:1532229-1532251 GAGGGCTGGCCGCAGGCTGTGGG + Intergenic
1077540753 11:3145453-3145475 GAAGGTTCAGTGGAGGCTGTGGG - Intronic
1077601896 11:3580399-3580421 GAGAGTTGAGAGGAGGCAGATGG - Intergenic
1083476851 11:62920767-62920789 GAGGGAGGACAGGAGGTTCTGGG + Intronic
1083999353 11:66287921-66287943 GAGGGGAGAGAGGAAGCTGTGGG + Intronic
1084004271 11:66314963-66314985 GAGGGATGACCGGTGGCTGCTGG - Exonic
1084004447 11:66315617-66315639 CAGGGATCACAGGAGGCTGGTGG + Exonic
1084097002 11:66918041-66918063 GAGGGCTCACAGGCTGCTGTGGG - Intronic
1084185115 11:67467431-67467453 GAGGGGGTGCAGGAGGCTGTGGG + Intronic
1084256519 11:67946640-67946662 GAGGGAAGAGAGGGGGCTGTGGG - Intergenic
1084257809 11:67954945-67954967 GAGAGTTGAGAGGAGGCAGATGG - Intergenic
1084502990 11:69545860-69545882 GAGGGGCTACGGGAGGCTGTGGG - Intergenic
1084814954 11:71640292-71640314 GAGAGTTGAGAGGAGGCAGATGG + Intergenic
1084952859 11:72676318-72676340 GAGGGCAGAAAGGAGGCTGAGGG - Intergenic
1086157036 11:83678720-83678742 GTGGCTTTAGAGGAGGCTGTAGG - Intronic
1089169190 11:116500491-116500513 GAAGGTGGCCGGGAGGCTGTGGG - Intergenic
1089533203 11:119145218-119145240 GAGGGTTAACAGGGTCCTGTGGG - Intergenic
1091253421 11:134163324-134163346 GAGGGGTGGCAGGAAGCTTTTGG - Intronic
1091775471 12:3182114-3182136 GAGGGTTGACTGGGGGCCGGGGG - Intronic
1092428041 12:8389742-8389764 GAGAGTTGAGAGGAGGCAGATGG - Intergenic
1096449803 12:51728912-51728934 GTGGCTTGAATGGAGGCTGTTGG - Intronic
1097672533 12:62557234-62557256 GAAGGATGACAGGATGTTGTTGG + Intronic
1099611498 12:84877736-84877758 GAGGGTTGGCAGGGGGCAGATGG - Intronic
1099851219 12:88099750-88099772 GAGGGAAAACAGGAGGCTGAGGG + Intronic
1100816075 12:98388481-98388503 AAGGGTTGACGGGAGGGGGTGGG + Intergenic
1101395978 12:104348059-104348081 GAGGGTTGACAAGCACCTGTGGG + Intronic
1101815510 12:108143270-108143292 GACAGGTGCCAGGAGGCTGTAGG - Intronic
1102147592 12:110666614-110666636 GAGTGTGGCGAGGAGGCTGTGGG - Intronic
1103967157 12:124647072-124647094 GAGGGCAGACAGGAGGAAGTAGG + Intergenic
1105242651 13:18621523-18621545 GATGCTTGCTAGGAGGCTGTGGG + Intergenic
1105558227 13:21465807-21465829 GAGTGTTTACAGAAGGCTGGAGG - Intergenic
1107557181 13:41527050-41527072 GAGGGTTGACAGGTCAGTGTTGG - Intergenic
1108378768 13:49837334-49837356 GAGATTCGACAGGAGGCTGAGGG + Intergenic
1109198798 13:59408558-59408580 GAGGAATGACAGAAGGATGTTGG - Intergenic
1110512238 13:76364466-76364488 GAGGTTGGACAGGCAGCTGTTGG + Intergenic
1112390498 13:98979400-98979422 GAGGGCTCAGAGGAGGCAGTGGG + Intronic
1113365153 13:109669027-109669049 GAGGGGTGAGAGGAGCCTGAGGG + Intergenic
1113420213 13:110165266-110165288 GAGGGCTGGCATGAGGCTGCAGG - Intronic
1114696721 14:24632874-24632896 GAGTGTTTCCAGGAGGGTGTGGG + Intronic
1114796086 14:25716672-25716694 GAGGGTTGAGAGGAGGAGGCAGG + Intergenic
1117135402 14:52730350-52730372 GAGGGCTGACAGGAGGGCGGCGG - Exonic
1117327816 14:54684960-54684982 GAGGGTGGCCAGGAAGCTGCAGG + Intronic
1119175090 14:72562949-72562971 GAGGGATGACAGGCGGCGGTGGG - Intronic
1120057835 14:79946414-79946436 GAGGGGTCACAGTAGGCTCTGGG - Intergenic
1120853701 14:89194592-89194614 GAGGAGAGACAGGAGGCTGTTGG - Intronic
1121509733 14:94503473-94503495 GAGGGTTTGGAGAAGGCTGTGGG - Intronic
1121794427 14:96723614-96723636 GAGGGATGACAGGAGACTGAGGG + Intergenic
1122311951 14:100803047-100803069 GAAGGTTGAGATGAGGCTGATGG + Intergenic
1122322878 14:100866182-100866204 GTGGGTTGACAGGATGGGGTGGG + Intergenic
1122849027 14:104516705-104516727 CAGGGTAGGCAGGAGGCTGAGGG + Intronic
1122880982 14:104690316-104690338 GAGGGTTGACGGGTGGGTCTGGG - Intronic
1123488649 15:20763083-20763105 GATGCTTGCTAGGAGGCTGTGGG - Intergenic
1123545145 15:21332156-21332178 GATGCTTGCTAGGAGGCTGTGGG - Intergenic
1124498811 15:30208747-30208769 GAGGCCTGAGAGGAGGCAGTTGG - Intergenic
1124744768 15:32329929-32329951 GAGGCCTGAGAGGAGGCAGTTGG + Intergenic
1128512824 15:68324157-68324179 GAGGTTTGGCAGGGGACTGTGGG + Intronic
1128648377 15:69393364-69393386 GTGGGTAGAGAGGAGGGTGTGGG + Intronic
1129007200 15:72383836-72383858 GACAGTGGAAAGGAGGCTGTGGG + Intergenic
1202953491 15_KI270727v1_random:59427-59449 GATGCTTGCTAGGAGGCTGTGGG - Intergenic
1133370197 16:5240625-5240647 GAGAGTTGAGAGGAGGCAGATGG + Intergenic
1137031789 16:35531496-35531518 GTGGGGTGACAGCAGTCTGTGGG + Intergenic
1138590814 16:57998797-57998819 AAGGGTTGGCAGGAAGCTGGAGG - Intronic
1139358083 16:66379441-66379463 GTGGGTGGGCAGCAGGCTGTGGG - Exonic
1141291454 16:82721837-82721859 GAGAGTCATCAGGAGGCTGTAGG + Intronic
1141685115 16:85565731-85565753 GAGATTTGAGAGCAGGCTGTGGG + Intergenic
1141795894 16:86273945-86273967 GAAAGTCGCCAGGAGGCTGTAGG + Intergenic
1142181711 16:88674449-88674471 AAGGATGGACAGGAGGCTGCAGG - Intergenic
1142469569 17:155862-155884 GGGGGTAGCCAGGAGGCTGGGGG - Intronic
1143873424 17:9974311-9974333 GAGGGTTGCCAGGATCTTGTGGG - Intronic
1143919987 17:10323462-10323484 GAGGGTTGAGAAGAGCCTATGGG + Intronic
1143952219 17:10642442-10642464 GAGGTGTGCCAGGAGCCTGTTGG + Exonic
1144955667 17:19017705-19017727 CAGGGTTTCCAGGAGGCTGTGGG - Intronic
1145225288 17:21123405-21123427 GATGGTTGAGAGAATGCTGTGGG - Intronic
1147015987 17:37491384-37491406 GAGGGTTGCCACGAGGAGGTAGG + Intronic
1147998812 17:44375838-44375860 GAGGGTTGACAGGAGGCTGTGGG + Exonic
1149039670 17:52172615-52172637 GAAGGTAGAAAAGAGGCTGTGGG - Intergenic
1150917563 17:69451951-69451973 GTGGGTGGCAAGGAGGCTGTTGG + Intronic
1151390277 17:73782517-73782539 GAGGACAGACAGGAGGTTGTGGG - Intergenic
1151620755 17:75243409-75243431 GAGGGCTGCCTGGAGGCTGCGGG + Intronic
1151725628 17:75882116-75882138 CAGGGAGGACAGCAGGCTGTGGG - Intronic
1152143047 17:78549813-78549835 GAGGGTTGGCTGCAGGCTCTGGG - Intronic
1152681036 17:81668044-81668066 GAGGCTTGGAAGGAGGCTGTGGG + Intronic
1154446291 18:14438354-14438376 GATGCTTGCTAGGAGGCTGTGGG - Intergenic
1156652894 18:39247687-39247709 AATGGTTGCCAGGAGGATGTGGG + Intergenic
1156723927 18:40104658-40104680 GAGCTTTGACATGAGGCTTTTGG - Intergenic
1157404573 18:47412250-47412272 GAGGGTGGGCATGAGGCTGGGGG - Intergenic
1160613104 18:80104396-80104418 GAGGCTTAAGAGGAGGTTGTGGG - Intergenic
1161118174 19:2511084-2511106 GAGGGTGGACGGGATGGTGTGGG + Intergenic
1161675493 19:5645802-5645824 GAGGGTTGACAGAGCCCTGTTGG + Intronic
1162510675 19:11116269-11116291 GGGGGTTGCCAGGTGGCTCTGGG + Intronic
1163234022 19:16020681-16020703 GTGGGTGGTCAGCAGGCTGTGGG + Intergenic
1163494453 19:17637833-17637855 GTGGGATCTCAGGAGGCTGTGGG - Intronic
1163494481 19:17638097-17638119 GTGGGATCTCAGGAGGCTGTGGG - Intronic
1163738807 19:18998165-18998187 GAGGGCAGATGGGAGGCTGTAGG - Intronic
1164236918 19:23345629-23345651 GAGGGTGGACAGCAGTCTGCTGG - Intronic
1164578645 19:29420837-29420859 GTGGGTGGAGAGGAGGCTGGGGG - Intergenic
1165149756 19:33753690-33753712 GAGGGTTGGTAGGAGGATGGTGG - Intronic
1165158912 19:33804498-33804520 GAGAGTTCCCAGGAGGCTGAGGG + Intronic
1166538839 19:43592702-43592724 GAGGGTTTGCAGCAGGTTGTCGG - Exonic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166698862 19:44870302-44870324 GAGGGCGGCCAGGAGGATGTGGG + Intronic
1166703806 19:44897195-44897217 GAGACTAGAGAGGAGGCTGTGGG + Intronic
1166909104 19:46138551-46138573 AAGTGTTGAGGGGAGGCTGTGGG + Intergenic
1167224818 19:48230749-48230771 GTGGGGTGAGCGGAGGCTGTGGG - Intronic
1167464504 19:49642927-49642949 AATGGGTGACAGGAGGCTGGGGG + Intronic
1167671483 19:50856188-50856210 CAGGGTTGACAGGAGGAACTGGG - Intronic
1167780378 19:51594954-51594976 GGGGGTGCTCAGGAGGCTGTGGG + Intergenic
1168695490 19:58401633-58401655 GATGGGGGACAGGAGGCTGCGGG + Intronic
925024252 2:595235-595257 GATGCTTGCCAGGAGGCTGGGGG + Intergenic
925131843 2:1499306-1499328 GATGGTCTACAGGAGGCTGAAGG - Intronic
925326077 2:3023091-3023113 GAGTGAGGACAGGAAGCTGTTGG + Intergenic
925332437 2:3069154-3069176 GGGGGTTGCCAGGAGGCTGGGGG + Intergenic
927889322 2:26738562-26738584 GTGGGGTGACATCAGGCTGTGGG + Intergenic
927937329 2:27083168-27083190 GAGGGATTACAAGAGGTTGTGGG + Exonic
928032979 2:27797264-27797286 GAGGGCTGAGAGTGGGCTGTGGG + Intronic
930749504 2:54919528-54919550 GAAGGTTGCCAGGCGGCTTTGGG - Intronic
931771073 2:65498717-65498739 GAGGGGTGACAGGGAGCTTTTGG + Intergenic
933035987 2:77398925-77398947 GAAGGTTGACAGGTGGAGGTTGG + Intronic
933666595 2:84970432-84970454 GAGGGAAGCCAGGAGGCTGCCGG - Intergenic
934983911 2:98870194-98870216 GAGTGTTGACAGAGGGCTCTGGG + Intronic
936795166 2:116195602-116195624 GAGTGGTTACAGCAGGCTGTGGG - Intergenic
937121878 2:119446208-119446230 GTGGGGTGTCAGGAGGCTGCTGG - Intronic
937478835 2:122238874-122238896 GAAGGTTGACAGGAGCGTGTTGG - Intergenic
938249923 2:129806619-129806641 GAGGATTGACAGGTGGATGGAGG - Intergenic
938366196 2:130736564-130736586 GAGGGCTGGGGGGAGGCTGTAGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
939129709 2:138220102-138220124 CAGGGGAGACATGAGGCTGTGGG + Intergenic
939466363 2:142562006-142562028 GAGGGAGGCCAGGAGGCTGAGGG + Intergenic
940398967 2:153224336-153224358 GGGGGTGGGGAGGAGGCTGTGGG + Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942318407 2:174714972-174714994 GAGGGCTGAGAGGAGGCAGGAGG + Intergenic
943209051 2:184938987-184939009 AAGGGATGACAGTAGGGTGTGGG - Exonic
946146167 2:217732795-217732817 GAGGCATGACAGAAGGCTGAAGG + Intronic
946180712 2:217947289-217947311 GAGGGAGGGCAGGAGGCTGAAGG + Intronic
946316911 2:218922333-218922355 GAGAGCTGAAAGTAGGCTGTGGG - Intergenic
947527152 2:230885680-230885702 CAGGGATGGCAGGAAGCTGTAGG + Intergenic
948385680 2:237579164-237579186 CAGCTTTGACAGGAGCCTGTCGG - Intronic
948456154 2:238105578-238105600 GAGGATGGACAGGAGGCGGCCGG + Intronic
948879768 2:240850801-240850823 GAGGATGGTCAGGAGGCAGTCGG - Intergenic
948915057 2:241030239-241030261 GGGGATTGACTGGGGGCTGTGGG - Intronic
1168850084 20:970363-970385 GAGGGTTATCAGCAGGATGTGGG - Intronic
1171065824 20:22014112-22014134 TAGGGTTGACTTGAGGATGTAGG - Intergenic
1171188580 20:23141843-23141865 GATGGTGGGCAGGAGGCTGGAGG - Intergenic
1171298770 20:24041376-24041398 GGGGGTAGCCAGGAGGCTGGAGG - Intergenic
1171983584 20:31644145-31644167 GAGGGTTGAAAGTAGGAAGTAGG - Intronic
1172856154 20:38004294-38004316 CAGGGTTGGCATGAGGCTGGGGG - Intronic
1174551548 20:51366137-51366159 GAGGGGTGGCAGGAGGCTGAAGG - Intergenic
1176193230 20:63824000-63824022 GAGTGCAGAGAGGAGGCTGTAGG + Intronic
1176449690 21:6851492-6851514 GATGCTTGCTAGGAGGCTGTGGG + Intergenic
1176827862 21:13716516-13716538 GATGCTTGCTAGGAGGCTGTGGG + Intergenic
1178167720 21:30000028-30000050 GAGGTGTGACAGAATGCTGTTGG - Intergenic
1179187622 21:39096977-39096999 GAGGGTGCACAGGAGCCCGTGGG + Intergenic
1179548054 21:42125344-42125366 GAGGGTGGCCAGGAAGCTGAGGG + Intronic
1179883124 21:44301672-44301694 GAGGGCAGACAGGTTGCTGTGGG + Intronic
1182253767 22:29023269-29023291 CAGGGTTGACAGGAAGCAGTTGG + Intronic
1183675168 22:39295074-39295096 GAGGGTAGACAGAACACTGTTGG - Intergenic
1183910980 22:41079032-41079054 GAGGGTGGGCAGAAGGCTTTGGG - Intergenic
1184037738 22:41926517-41926539 GAGGGCTGAAAGGACCCTGTGGG - Intronic
1184091927 22:42297479-42297501 GAGGGTGCTCAGGAGGCAGTGGG - Intronic
1184387951 22:44186904-44186926 AAAGGTTGTCAGGAGGTTGTCGG - Intronic
1184737788 22:46409435-46409457 CAGGCTTGACAGGAGGCAGACGG + Intronic
1185180570 22:49358452-49358474 CAGGTTTGACAGGAGGCTGCTGG - Intergenic
1185305271 22:50112042-50112064 GAGGGTGGACTTGGGGCTGTGGG + Intronic
1185326641 22:50228855-50228877 GGGGATTGAGAGGAGGGTGTTGG - Intronic
1185408742 22:50672159-50672181 GTGGGTTGGCAGGAGGCGGCTGG + Intergenic
950461310 3:13123797-13123819 GAGCAGTGACAGGAGGCTGCAGG - Intergenic
950521794 3:13501835-13501857 GAGGGTAGACATGAGGATCTGGG - Intronic
950647441 3:14385686-14385708 GAGGAATGGCAGGAGGCTGAAGG - Intergenic
952268349 3:31808211-31808233 CAGGTTTGACAGGAGGTTGGAGG + Intronic
952924702 3:38312622-38312644 GGGGCTCTACAGGAGGCTGTGGG + Intronic
953373082 3:42406567-42406589 GGGAGTTGAGAGGAGGCTGCAGG - Intronic
954520605 3:51222243-51222265 CAGAGTTTACAGGAGGCTCTTGG + Intronic
954626443 3:52024444-52024466 GAAGGTGCACAGGTGGCTGTGGG + Intergenic
956136064 3:66100284-66100306 GAGGCCTGTCAGGGGGCTGTGGG - Intergenic
957072739 3:75579433-75579455 GAGAGTTGAGAGGAGGCAGATGG - Intergenic
961034935 3:123635540-123635562 GAGGGTTGTCAGGAGGGAGGAGG - Intronic
961034995 3:123636053-123636075 GAGGGGTGCCAGAGGGCTGTGGG + Intronic
961238126 3:125386227-125386249 GTGGGATGACAGGAGGGTGGTGG - Intergenic
961437077 3:126926635-126926657 GAGGGTAGAGATGAGGCTGGTGG + Intronic
961441675 3:126957280-126957302 GAGGGTTAAAAGGATGCTGCTGG + Intronic
961503101 3:127351179-127351201 GAGGGTGGAGAGGAGGCAGCTGG - Intergenic
961504351 3:127360451-127360473 TAGGGGTGGCAGGAGGCGGTGGG - Intergenic
961513941 3:127421183-127421205 GAGCATCTACAGGAGGCTGTGGG + Intergenic
962123873 3:132593744-132593766 GAGGGATGAGAAGAGGGTGTGGG + Intronic
964227843 3:154428257-154428279 AAGGGATGACAGAAGGTTGTGGG + Intronic
964251141 3:154719149-154719171 GAAGGTTGACAGGGGCCAGTAGG + Intergenic
964480502 3:157134175-157134197 AGGTGTTGATAGGAGGCTGTCGG + Intergenic
964697888 3:159530408-159530430 GAGGGTAGGGAGAAGGCTGTTGG - Intronic
965081766 3:164041900-164041922 GGGGGTTGAGAGGAGGCTGAAGG - Intergenic
965361825 3:167750525-167750547 AAAGGTTTACAGGAGGCAGTGGG + Intronic
965400418 3:168206495-168206517 AAGGGCTGCCAGAAGGCTGTGGG - Intergenic
967078453 3:186026462-186026484 GAGGAATGACAGGGGGCTGGGGG - Intergenic
968672602 4:1859800-1859822 GTGGGGTGAGAGGAGGCTGGAGG - Intergenic
968725466 4:2245911-2245933 GAGGGTGGGTAGGAGGCTGCAGG + Intergenic
968745183 4:2356273-2356295 GACTGTTCACAGGAGGCTGACGG + Intronic
969016344 4:4106743-4106765 GAGAGTTGAGAGGAGGCAGATGG - Intergenic
969446345 4:7246878-7246900 CAGAGATGGCAGGAGGCTGTGGG - Intronic
969683881 4:8658175-8658197 TAGGGTTGCCAGGAGGCTTGAGG - Intergenic
969737611 4:9001581-9001603 GAGAGTTGAGAGGAGGCAGATGG + Intergenic
969796808 4:9533142-9533164 GAGAGTTGAGAGGAGGCAGATGG + Intergenic
970410189 4:15798441-15798463 GAGGGTTGAAAGAGGGCTGCTGG - Intronic
985676528 5:1234370-1234392 GAGAGGTGCCAGGAGGCTGATGG - Intronic
985763060 5:1761518-1761540 CAGGGTGCACAGGAGGCTTTGGG - Intergenic
988835855 5:35031712-35031734 CAGGGTTGTCAGCAGCCTGTAGG + Intronic
989090421 5:37724546-37724568 CAGGGCTGACAGCAAGCTGTTGG + Intronic
989359310 5:40582105-40582127 GAGGCTGGACAGGAGGGTGAGGG + Intergenic
990347553 5:54884493-54884515 GAGGGTTGGGAGGAGGCAGAAGG + Intergenic
993414415 5:87609004-87609026 GAGGCTTGAGAGAAAGCTGTGGG - Intergenic
994213174 5:97108610-97108632 CTGGGTTCACAGGAGCCTGTAGG - Intronic
994221411 5:97199325-97199347 AAGGATTTACAGGAGGCTTTTGG - Intergenic
998824195 5:146084381-146084403 GAGGTTTGAGAGGAGGGTGTTGG + Exonic
1001255675 5:170181833-170181855 GAGGTTTGTCAGGAGGGTGGAGG + Intergenic
1001310260 5:170605175-170605197 GAGGGTGGGCAGGTGGCTGGTGG - Intronic
1001535931 5:172497860-172497882 GGGGGGTGACAGGGGGCTGGGGG - Intergenic
1001749309 5:174116789-174116811 GAGGGCTGCGAGGAGGCTGGAGG - Intronic
1002851498 6:1000846-1000868 TGAGGTCGACAGGAGGCTGTGGG - Intergenic
1004270507 6:14191121-14191143 GGGAGTTGACAGGCGGCTGATGG + Intergenic
1005231750 6:23709634-23709656 GAGAGTTGAAAGGAGGCAATGGG + Intergenic
1005253223 6:23971818-23971840 GATGGATGAAAGGAGGATGTGGG - Intergenic
1006373094 6:33657404-33657426 GAGGGCTGCCTGGAGGCAGTGGG + Intronic
1006405688 6:33843556-33843578 GAGGCTTGGGAGGAGGCTGGGGG - Intergenic
1006521357 6:34572982-34573004 GAGGGTTGAAAGGATGCTTTGGG - Intergenic
1007364482 6:41381757-41381779 GAGGCTGGGCAGGAGGTTGTAGG + Intergenic
1007402969 6:41615017-41615039 GGGTGTTGACAGGAGGGTTTGGG - Intergenic
1011590001 6:88963095-88963117 GAAGGTAGACAGGAGGTTGGTGG - Intronic
1013170542 6:107634109-107634131 GGGGTTGGACAGGGGGCTGTTGG - Exonic
1013195450 6:107841065-107841087 GATGGTTGACAGGAGGGAGATGG - Intergenic
1016446843 6:144142090-144142112 GACAGTGGACAGGAGGCTATAGG + Intergenic
1018537415 6:164836243-164836265 GAGGTTGGACAGGAGGTTGCTGG - Intergenic
1018910997 6:168101017-168101039 GAGGGCAGACAGGAGGCTAGGGG + Intergenic
1019212845 6:170420471-170420493 GAGGGTTGCCAGGGTGCTGTGGG + Intergenic
1019232629 6:170581037-170581059 GAGACTTGGCAGGAGGCAGTAGG - Intronic
1019660833 7:2223204-2223226 CAGCGTGGACAGGAGGCTGTGGG + Intronic
1019925927 7:4191745-4191767 CAGGGTGGACAGGGGGCTGCAGG + Intronic
1022278397 7:28880158-28880180 TAGGGTTGACAAGAAGCTTTGGG - Intergenic
1023843212 7:44108002-44108024 GAGGCTTCACAGGAGGCTCTGGG - Exonic
1024741283 7:52357818-52357840 GATGGTGGAGAGGAGGCTGGAGG - Intergenic
1025705417 7:63858235-63858257 GAGGGTTGACAGGAGGAAAAGGG + Intergenic
1026503569 7:70963363-70963385 GTGTGTTTACAGGGGGCTGTTGG + Intergenic
1029058984 7:97777518-97777540 GAAGGTTGACAGCAGGCAGTGGG + Intergenic
1034104810 7:148481381-148481403 GATGGTTGGCAGGATGCTGGAGG - Intergenic
1034150899 7:148914685-148914707 GAGGGGTGAAGGGTGGCTGTGGG - Intergenic
1034403561 7:150885030-150885052 GAAGGTTGAGAGGAGGATGAGGG + Intergenic
1034439358 7:151078785-151078807 GAGGGCTGACAGGAGGAGGAAGG - Intronic
1035323566 7:158050568-158050590 GAGGGAAGCCGGGAGGCTGTGGG - Intronic
1035736145 8:1888903-1888925 GAGGGTTGTGAGGAGACAGTGGG + Intronic
1036824375 8:11964929-11964951 GAGGCTGGACAGGAAGCTGCCGG + Intergenic
1036830027 8:12014303-12014325 GAGAGTTGAGAGGAGGCAGATGG - Intronic
1037319396 8:17629502-17629524 GAGGGTTGGCAGGTGGCAATGGG - Intronic
1038049761 8:23797457-23797479 GAGAGTCGTCATGAGGCTGTAGG - Intergenic
1039350415 8:36757992-36758014 GAGGGTTGACTGGAGCCTTAAGG - Intergenic
1040520593 8:48172961-48172983 GAGGGTGGACAGGAGGAAGAGGG - Intergenic
1041373539 8:57189893-57189915 GAGGGATGAAGGGAGGCTCTAGG - Intergenic
1042523444 8:69739242-69739264 CAGTGTTTACAAGAGGCTGTAGG - Intronic
1042523463 8:69739799-69739821 CAGTGTTTACAAGAGGCTGTAGG - Intronic
1044765228 8:95565111-95565133 GGAGGTTGGCAGGAGGTTGTGGG + Intergenic
1044805753 8:96006371-96006393 GAGGATTGACAGCAGCCTGAAGG + Intergenic
1048317978 8:133375875-133375897 GAGGGTTGAATGGAGGCAGAAGG - Intergenic
1049220536 8:141426878-141426900 GAGGGTAGAGAGGCGGCTCTGGG - Intronic
1049425913 8:142537796-142537818 GAGGCTCCACAGGGGGCTGTTGG - Intronic
1049471052 8:142775182-142775204 GAGGGTGGCCAGGAGGATGGGGG + Intronic
1049492766 8:142913921-142913943 GAGGGTTGAGAGGCAGCTGGAGG - Intronic
1049847131 8:144808295-144808317 GAGGGTGGACAGCCGGCTGCAGG - Exonic
1050766100 9:9135844-9135866 GAGGGATGACAGAAAACTGTGGG - Intronic
1052878371 9:33584286-33584308 GAGGGGTGAAAGGTGGGTGTTGG + Intergenic
1053497612 9:38559923-38559945 GAGGGGTGAAAGGTGGGTGTTGG - Intronic
1055624991 9:78167517-78167539 TAGTGTTGCCAGGTGGCTGTTGG + Intergenic
1056303141 9:85262460-85262482 GGGGCTTGGCAGGAAGCTGTGGG - Intergenic
1057593612 9:96395310-96395332 GAGGCCGGCCAGGAGGCTGTCGG - Intronic
1058430444 9:104913936-104913958 GCGTGTTGGCAGGCGGCTGTCGG - Intronic
1058535459 9:105955347-105955369 CACTGTTGTCAGGAGGCTGTTGG + Intergenic
1059243211 9:112826317-112826339 GAGGGTTGGCAGAAGGCTGGGGG + Intronic
1059982645 9:119790135-119790157 CAGGGTTGACAGGAGCCTTAGGG - Intergenic
1060153030 9:121300705-121300727 CAGGGTCTGCAGGAGGCTGTTGG - Intronic
1060763870 9:126278780-126278802 GGGGGTTGACTGAAGGCTGGTGG + Intergenic
1061198168 9:129119860-129119882 GAGGGAGGGCAGGAGGCTGTGGG + Intronic
1061370376 9:130194330-130194352 CGGGGTGGAAAGGAGGCTGTGGG + Intronic
1062079952 9:134618571-134618593 CAGGGTGGACATGAGGCTGCGGG + Intergenic
1062378832 9:136277048-136277070 GATGGATGGCAGGAGTCTGTGGG + Intergenic
1062421984 9:136487049-136487071 CAGGGCTGACATGAGGCTGAAGG + Intergenic
1062425855 9:136505890-136505912 GAGGGAAGACAGGACGGTGTCGG + Intronic
1062636228 9:137492972-137492994 GAGGGCTCCCAGGAGGCTCTGGG + Intronic
1203519495 Un_GL000213v1:33025-33047 GATGCTTGCTAGGAGGCTGTGGG - Intergenic
1185812738 X:3125714-3125736 GCTGGATGACAGGAGACTGTTGG + Intergenic
1187156324 X:16723445-16723467 GAGGATAGACCTGAGGCTGTGGG + Intronic
1187213572 X:17253329-17253351 GTGGGTAGACAGTAGGCTATAGG - Intergenic
1187275568 X:17813961-17813983 GAGTGAAGAGAGGAGGCTGTTGG + Intronic
1187566932 X:20460059-20460081 GAGAGTTGACAAGAGGATGTAGG + Intergenic
1188976940 X:36687202-36687224 GACGATTGAGAGGAGGCTGAGGG - Intergenic
1189847105 X:45148088-45148110 GAGGGTTAGCAGGTGGCTGGCGG + Intergenic
1190909703 X:54759348-54759370 CAGAGTTGACAGGAGGCAGTGGG + Intronic
1190942856 X:55059772-55059794 AGGGGTTGGCAGGAGGTTGTAGG - Intergenic
1191615084 X:63162222-63162244 GAAAGTTGCCAGGAGACTGTGGG + Intergenic
1191621214 X:63216701-63216723 GAAAGTTGCCAGGAGACTGTGGG - Intergenic
1194940787 X:100007685-100007707 GGGGATTTACAGGAGTCTGTGGG + Intergenic
1195141736 X:101967489-101967511 GAGGGTAGACAGGAGCATCTTGG + Intergenic
1198999538 X:142618063-142618085 GAGTGGTAACAGGAAGCTGTGGG - Intergenic
1199063983 X:143391934-143391956 GAAGGTTGGAAGGGGGCTGTAGG - Intergenic
1201268802 Y:12234527-12234549 GCTGGATGACAGGAGACTGTTGG - Intergenic