ID: 1147998845

View in Genome Browser
Species Human (GRCh38)
Location 17:44375972-44375994
Sequence CCATTGTTGTGGAGCTGAAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147998838_1147998845 -5 Left 1147998838 17:44375954-44375976 CCATTCACAGTCCCAGGGCCATT 0: 1
1: 0
2: 0
3: 21
4: 195
Right 1147998845 17:44375972-44375994 CCATTGTTGTGGAGCTGAAGGGG 0: 1
1: 0
2: 0
3: 18
4: 204
1147998835_1147998845 21 Left 1147998835 17:44375928-44375950 CCGGAAGGTGGATGCTGAGGTGA 0: 1
1: 0
2: 24
3: 865
4: 12574
Right 1147998845 17:44375972-44375994 CCATTGTTGTGGAGCTGAAGGGG 0: 1
1: 0
2: 0
3: 18
4: 204
1147998834_1147998845 22 Left 1147998834 17:44375927-44375949 CCCGGAAGGTGGATGCTGAGGTG 0: 1
1: 0
2: 18
3: 799
4: 11365
Right 1147998845 17:44375972-44375994 CCATTGTTGTGGAGCTGAAGGGG 0: 1
1: 0
2: 0
3: 18
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147998845 Original CRISPR CCATTGTTGTGGAGCTGAAG GGG Exonic
901112033 1:6805214-6805236 CCATTGTTGTAGATGGGAAGTGG + Intronic
901261380 1:7874418-7874440 CCATGGATGTGGAGATGCAGGGG - Intergenic
904327114 1:29733943-29733965 TCGTTGTTGGGGAGTTGAAGTGG + Intergenic
904789192 1:33005741-33005763 ACTTTGCTGTGGGGCTGAAGTGG - Intergenic
905262760 1:36731029-36731051 CCATTCTTTTGTAGCTAAAGTGG + Intergenic
905854871 1:41303219-41303241 GCATTGTTGTGGAGAAGAATTGG + Intergenic
905961185 1:42043966-42043988 CCATTCTTGAGGAGCTCAGGAGG + Intergenic
907945362 1:59131170-59131192 CCAGTCTGGTGGAGCTGAAAGGG + Intergenic
907952588 1:59197882-59197904 CCACTGTCCTGGAGCTTAAGAGG + Intergenic
908802551 1:67895543-67895565 CCATTGTAGTGGATGTGATGTGG + Intergenic
914217345 1:145644164-145644186 TCATTGTCTTTGAGCTGAAGTGG + Intronic
914469914 1:147966849-147966871 TCATTGTCTTTGAGCTGAAGTGG + Intronic
915027442 1:152843945-152843967 TTATTGTTGCTGAGCTGAAGGGG - Exonic
915952003 1:160195677-160195699 CCATAGATTTAGAGCTGAAGAGG + Intronic
916379616 1:164195442-164195464 CCATGGAGGTTGAGCTGAAGCGG + Intergenic
918149236 1:181783723-181783745 CCATAAGTGTGGAGGTGAAGTGG - Exonic
919521899 1:198599525-198599547 CTATTGTTCTGGAGGTGGAGTGG + Intergenic
920740900 1:208580255-208580277 CCATTGTTGTGAGGATGAAATGG - Intergenic
923758341 1:236815342-236815364 CCACTGAGGAGGAGCTGAAGGGG - Intronic
1063574481 10:7249361-7249383 CTATTGCTGTGTAGCTGAAGTGG - Intronic
1063920574 10:10928187-10928209 ACATTGTTCTGGAGCTAAGGGGG - Intergenic
1063981549 10:11456399-11456421 CCATCCTTGTGGATGTGAAGTGG - Intronic
1064259693 10:13775337-13775359 CCATTGTTGGGGAGCCCAAGGGG + Intronic
1067147023 10:43701453-43701475 CCACTCCTGTGGAGCTGATGCGG - Intergenic
1068906995 10:62337661-62337683 CCATTGTAGTGGATTTGTAGTGG + Intergenic
1070375698 10:75829208-75829230 GCTTTGGTGTGGAGCTGAAGAGG - Intronic
1071244629 10:83749776-83749798 CCAGTGTTGTGGAGATGCAGGGG - Intergenic
1072646635 10:97260588-97260610 CCATTGTAGTGGATATGAAGTGG - Intronic
1072813016 10:98478177-98478199 CCATTGTTCTGGATGTGAATGGG + Intronic
1074146768 10:110723612-110723634 CCATTCTAGTGGATATGAAGGGG + Intronic
1075873975 10:125791294-125791316 CCATCCTTGTGGGTCTGAAGTGG - Intronic
1076178325 10:128385857-128385879 CCATTCTAATGGATCTGAAGTGG - Intergenic
1076915402 10:133420943-133420965 CCATTATAGTGCACCTGAAGGGG + Exonic
1081741940 11:45447042-45447064 CCAGTGTGGTGGAGGTGAGGCGG + Intergenic
1082732595 11:56818358-56818380 GCATTGTTGTGGAGAAGAATTGG - Intergenic
1089087661 11:115836864-115836886 CCATAGTGGTGGAGATGGAGAGG + Intergenic
1090342238 11:126034346-126034368 TCATTGTGTTGGAGCTGAAGAGG - Intronic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1094125814 12:27021548-27021570 GCATTGGTGTGAAGCAGAAGTGG + Intergenic
1094152126 12:27296530-27296552 CCCTGGATGTGGACCTGAAGTGG - Intronic
1094481434 12:30885448-30885470 CCCTGGTGCTGGAGCTGAAGTGG + Intergenic
1095153907 12:38829281-38829303 GCATGGTTGTGGAGCAAAAGTGG - Intronic
1097101658 12:56594020-56594042 CGAATGGAGTGGAGCTGAAGTGG - Exonic
1097926012 12:65127482-65127504 CCATTCTGATGGGGCTGAAGAGG - Intergenic
1098359707 12:69642535-69642557 CCATTGCTGTGGAGCTGACCTGG + Intergenic
1098427456 12:70381201-70381223 CCATTCTAATGGATCTGAAGTGG - Intronic
1099213591 12:79824996-79825018 TCGTTGTTGTGAAGATGAAGAGG - Intronic
1099394582 12:82121633-82121655 GCATGGTTGTGGAGCAGGAGTGG - Intergenic
1100355663 12:93826860-93826882 CCATTGTTGTAGACCAGAAATGG + Intronic
1101162566 12:101994029-101994051 CTATTGTAGTGCAGCTGAACTGG + Intronic
1101353216 12:103952702-103952724 CCATTGTAGTGGGTATGAAGTGG + Intronic
1106487535 13:30185538-30185560 CCATTGGTGTTTAGCTTAAGGGG + Intergenic
1107775843 13:43840224-43840246 CCATGCTTGTGGAAGTGAAGTGG + Intronic
1108094999 13:46892429-46892451 CCTTAGTTCTGGAGTTGAAGCGG + Exonic
1108323206 13:49306152-49306174 CCACAGTGGTGAAGCTGAAGGGG - Intergenic
1108433848 13:50382251-50382273 CCAGTTTTTTGGAGCTGAAGGGG + Intronic
1108719073 13:53111520-53111542 CCATTTTTGTGGATATGGAGAGG + Intergenic
1109619468 13:64882398-64882420 CCATTCTAGTGGATGTGAAGTGG + Intergenic
1115013638 14:28582476-28582498 CCATTTTAGTGGATGTGAAGTGG + Intergenic
1115319890 14:32068524-32068546 CCATTCTAGTGGATATGAAGTGG - Intergenic
1115809158 14:37086795-37086817 CCATTGTTTTTGAGTTGAAAGGG + Intronic
1119556246 14:75555357-75555379 CACTTGTGGTGGAGGTGAAGGGG + Intergenic
1119977850 14:79045257-79045279 CGATTGTTGAGGAGCTGAATGGG - Intronic
1124378838 15:29147345-29147367 CCATCGTAGTGGTGGTGAAGTGG - Intronic
1127188843 15:56507899-56507921 CCCTTGTTGGGGAGGTGATGTGG - Intergenic
1128475711 15:67995453-67995475 ACATTGCTGTGGAGATAAAGAGG + Intergenic
1129235258 15:74219962-74219984 GCATTGGTCTGGTGCTGAAGTGG + Intergenic
1129240423 15:74248620-74248642 CCCTTAGTGGGGAGCTGAAGAGG + Intronic
1131918855 15:97301409-97301431 CCCTTGTGGCTGAGCTGAAGTGG - Intergenic
1133395292 16:5442296-5442318 CCATTCATGCGGAGCTGCAGAGG + Intergenic
1133537469 16:6715783-6715805 CCAATTTTGTGTAGCTGAAAGGG - Intronic
1134181962 16:12055091-12055113 CCAGTGTGGTGGGGCTGAGGCGG + Intronic
1136017158 16:27407889-27407911 CCATTTTTCTGGAGCTTTAGGGG - Intronic
1136185141 16:28583678-28583700 CAATTGATGTGGAGAAGAAGGGG - Intronic
1137366689 16:47865539-47865561 GCATTGCTGTGAAGCTGCAGAGG - Intergenic
1137934153 16:52617759-52617781 CCATTGCTGTGGACCTGTACAGG + Intergenic
1138390793 16:56668660-56668682 CCACTCTTGAGGAGCTGAATGGG + Intronic
1139973830 16:70793051-70793073 CAATTGGTTTGCAGCTGAAGTGG - Intronic
1141410520 16:83829871-83829893 CCATGGTGATGGAGCTGCAGGGG + Intergenic
1141846265 16:86611034-86611056 CCATTGTTGTGGACAGGCAGTGG + Intergenic
1143775208 17:9194888-9194910 CCATTTTTGTGGGTCTGAAATGG - Intronic
1144197833 17:12912575-12912597 CCATTGTATTGGAGCTCAATGGG - Intronic
1144203576 17:12963142-12963164 CTCTTGGTGTGGAGCTGCAGTGG - Intronic
1146579489 17:34024257-34024279 CCATTGTTGGGAACATGAAGAGG - Intronic
1147998845 17:44375972-44375994 CCATTGTTGTGGAGCTGAAGGGG + Exonic
1149495494 17:57114758-57114780 CCATTGTTATGGAGCTGGGGTGG + Intronic
1149510147 17:57234196-57234218 CCATTGTTGACCAGCTGATGGGG - Intergenic
1151321602 17:73356007-73356029 CCATTGCTGTGGATTTGAAAAGG - Intronic
1151462458 17:74262637-74262659 CCATTGTCTCGGAGCTGGAGTGG + Intergenic
1152846909 17:82606317-82606339 CCATTCATGTGGAGCTTTAGGGG - Intronic
1154051835 18:10967629-10967651 CCATTGTTGTAGGACTGAAGTGG + Intronic
1155551751 18:26972542-26972564 CCAGTGTGGTGGAGCAGATGGGG + Intronic
1156409391 18:36813188-36813210 TAAGTGTTGTGGAGCTGAAGGGG + Intronic
1157198172 18:45637104-45637126 CCAGTGTTGTGGGGAAGAAGAGG - Exonic
1158866288 18:61640718-61640740 CCATTGTCGTGGGTATGAAGTGG - Intergenic
1163432852 19:17278643-17278665 CCAGTGTTAAGGATCTGAAGAGG - Intronic
1163591412 19:18196167-18196189 CCAATGCTCCGGAGCTGAAGTGG - Exonic
1166546013 19:43635318-43635340 CCATTGATGGGGGGCTGAGGGGG - Intronic
1167294926 19:48644481-48644503 CCGTGGATGTGGAGCTGAAGAGG - Exonic
1167725956 19:51212560-51212582 CCCTTGTTGTGGGGTTGAGGGGG - Intergenic
926492820 2:13545382-13545404 CCATGGTTATGTAGCTGGAGTGG + Intergenic
928195065 2:29209724-29209746 CCATTCTTGAGGGGCTGAGGTGG + Intronic
933542682 2:83667546-83667568 TCATTGTTGTGTAGAAGAAGAGG + Intergenic
934634697 2:95973677-95973699 CCACTGTTTGGGAGCAGAAGTGG - Intronic
934798938 2:97131559-97131581 CCACTGTTTGGGAGCCGAAGTGG + Intronic
935683546 2:105660908-105660930 CCATTGTAGTGGATATGAAGTGG + Intergenic
936451327 2:112635950-112635972 AAATTGTTGTGGAACTGGAGAGG + Intergenic
937321663 2:120964563-120964585 CCATTGTGGTGGAGGGGAGGAGG + Intronic
937748848 2:125449113-125449135 GCATTGTTGTGGAGAAGAATTGG + Intergenic
939124685 2:138164050-138164072 CCATTGAGGTGGATATGAAGTGG - Intergenic
940915168 2:159246462-159246484 CCATTTTAGTGGATATGAAGTGG - Intronic
941312850 2:163955685-163955707 CCATTGTGTTAAAGCTGAAGAGG + Intergenic
942301631 2:174568134-174568156 CCATTGGTGTACAGCTGATGAGG + Intronic
942528155 2:176878395-176878417 TCAATGCTGTGAAGCTGAAGAGG - Intergenic
946772783 2:223106571-223106593 CCATCCTTGTGGATGTGAAGTGG + Intronic
1169994230 20:11538916-11538938 CCATTCTTGTGGAGGTGAAATGG - Intergenic
1170029801 20:11932900-11932922 AAAATGTTGTGGAGGTGAAGAGG + Intergenic
1170290797 20:14766013-14766035 CCAATGTTGTAGATTTGAAGGGG - Intronic
1170793818 20:19529488-19529510 CCATGCTTGTGGAGATGGAGAGG - Intronic
1171235308 20:23519619-23519641 CCATTAGTGGGGAGCTGATGCGG - Intergenic
1172790294 20:37499663-37499685 CCATTGTTGGGGAGATGAGAGGG + Intronic
1173034667 20:39397073-39397095 CCATTCCTGGGGAGCTGAAATGG - Intergenic
1174700513 20:52603701-52603723 CCTTTGTTGTGGGGCTGTACTGG - Intergenic
1175223805 20:57433295-57433317 ACATGGCTGTGGAGCTGCAGAGG - Intergenic
1175703066 20:61154577-61154599 CCCCTGCTCTGGAGCTGAAGGGG + Intergenic
1176896779 21:14388305-14388327 CCATTGTAGTGGACGTGTAGTGG - Intergenic
1180956813 22:19744889-19744911 CCAGTGATGTGGGGCTCAAGGGG + Intergenic
1182005966 22:26960012-26960034 CCATTCTTTTGGGGCTGAATGGG - Intergenic
1182864468 22:33591337-33591359 CCATTGTAGTGGGTGTGAAGTGG + Intronic
1184233750 22:43172116-43172138 CCATTTTTATGGACCTGCAGAGG - Intronic
1184823250 22:46928857-46928879 CCATCCTTGTGGATGTGAAGCGG - Intronic
949811530 3:8011979-8012001 TCACTGTTGTGGACCTAAAGTGG + Intergenic
950457398 3:13100886-13100908 CCAGTGCTGTGAAGATGAAGAGG + Intergenic
951724310 3:25739639-25739661 CCAGTGATGATGAGCTGAAGTGG - Exonic
955644974 3:61127242-61127264 CCATAGTGGTGGAGGTGATGAGG + Intronic
955870124 3:63429361-63429383 CAATGGCTGTGGATCTGAAGTGG + Intronic
961744717 3:129057157-129057179 CCATTGATGTGAAACTCAAGAGG - Intergenic
961811239 3:129523114-129523136 CCAGTGTTCTGGATCTGCAGGGG - Intergenic
963172310 3:142263296-142263318 CCATTGTAGTGGATGTAAAGTGG + Intergenic
965414229 3:168372313-168372335 TCATTGCTTTGGATCTGAAGGGG + Intergenic
965737548 3:171837356-171837378 CCATTGATGTGGAGATGGACTGG - Intergenic
965804971 3:172532851-172532873 CCATTGTAGTGGATGTGAAGTGG + Intergenic
966738034 3:183205698-183205720 CCACTGTGGTGGAGGTGGAGGGG - Intronic
966930255 3:184671405-184671427 GCATGGTTGGGGAGCTGAGGAGG + Intronic
966930387 3:184671968-184671990 GCATGGTTGGGGAGCTGAGGAGG + Intronic
967094953 3:186170041-186170063 CCAGTGGTGGGCAGCTGAAGTGG + Intronic
971029521 4:22621382-22621404 CCAGTGTGGTGGAGCAGATGGGG + Intergenic
971363629 4:25958927-25958949 CCATTGCTGAGGGGCTGATGGGG + Intergenic
971675470 4:29621618-29621640 GCATTGTTGTGGAGAAGAATTGG - Intergenic
972142874 4:35983022-35983044 CCATTGCTGGGGAGCTGGTGTGG - Intronic
973831457 4:54764185-54764207 CCATTGTTGTTGAGCTAGTGTGG + Intergenic
977394478 4:96454125-96454147 CCATTGTTGAGGAACTAATGTGG + Intergenic
977891606 4:102318691-102318713 TCATTGTTTTGGAGGTGAAAGGG - Intronic
978042104 4:104079779-104079801 CCATTGTGATGGAGCTCAAAAGG + Intergenic
979425498 4:120560195-120560217 CCATTTTTGGGGTGGTGAAGTGG - Intergenic
979882692 4:125982215-125982237 CCATTCTAGTGGAGGTGTAGCGG - Intergenic
980767325 4:137323534-137323556 CCATTGTTGGGGAGGAGAGGAGG + Intergenic
980997012 4:139788949-139788971 CCACTGTTGTGGGGAAGAAGAGG + Intronic
981314621 4:143329997-143330019 CCATTGTTATGGAGAAGAATTGG - Intergenic
982172868 4:152678695-152678717 CCAGTGTTTTGGAGCTGGAAGGG - Intronic
984750902 4:183273127-183273149 CCATTCTTGTGGGTGTGAAGTGG + Intronic
985320438 4:188704633-188704655 CCATTCTCGTGGATGTGAAGTGG + Intergenic
986460395 5:7964460-7964482 GCATTGTTGTGGAGAAGAATTGG + Intergenic
986750120 5:10779677-10779699 CCATGGATGTGGAGATGCAGGGG - Intergenic
987029939 5:13966549-13966571 CCATTCTTGTGGAAGTAAAGTGG + Intergenic
987583021 5:19820429-19820451 CCATTGGTGTGTAGCTGTTGTGG - Intronic
989515318 5:42336891-42336913 CCAGGGATGTGGAGCTGCAGAGG - Intergenic
991135895 5:63181317-63181339 CCATTGGTGGCAAGCTGAAGAGG + Intergenic
992489653 5:77230123-77230145 CCATTCTTGTGGTTGTGAAGTGG + Intronic
993429561 5:87814737-87814759 CCATTGTTGCAGAGCTGGTGTGG - Intergenic
996116349 5:119624312-119624334 CTATTGTTGTGCAGCTGAGCTGG + Intronic
996518195 5:124396905-124396927 CAATTGTTGGGAAGCTGGAGAGG - Intergenic
997759637 5:136432864-136432886 CCCCTGTTGGGGAGCTGCAGAGG - Intergenic
999535259 5:152509750-152509772 GCATTGTTGTGGAGAAGAACTGG + Intergenic
1000263437 5:159612222-159612244 GCATTGTTGTGGAGAAGAATTGG + Intergenic
1000620895 5:163485368-163485390 CCATTGTAGTGGGTATGAAGTGG + Intronic
1000674092 5:164099507-164099529 TCATTGTGGTGGAGATGAGGTGG - Intergenic
1001007110 5:168062336-168062358 GCATTGTAGTGGATGTGAAGTGG - Intronic
1002779315 6:354182-354204 TCATGGTGGTGGAGATGAAGAGG + Intergenic
1003199815 6:3949042-3949064 TCACTGTTGTGAAACTGAAGGGG - Intergenic
1007438709 6:41838733-41838755 CCATTGTTGGGGAGCTAGTGTGG - Intronic
1008655863 6:53613396-53613418 ACAGTGTTGTGCAGCTGGAGGGG + Intronic
1008866633 6:56219405-56219427 GCATTGTTGTGGAGAAGAATTGG - Intronic
1009470200 6:64023583-64023605 CCATTGTAGTAGATGTGAAGTGG + Intronic
1009591527 6:65677951-65677973 CCATTGTTGTGTTGCTGTAAAGG + Intronic
1011858954 6:91731238-91731260 ACATTGTTGTGAAGCTGGTGAGG + Intergenic
1013483135 6:110569200-110569222 CTACTCTTGTGGTGCTGAAGGGG + Intergenic
1016425521 6:143932686-143932708 CCATTGCTGGGGAGCTGGTGTGG + Intronic
1021552114 7:21882165-21882187 CCATTGAGGTGGAAATGAAGGGG + Intronic
1021706525 7:23373461-23373483 CCATTCTAATGGAGGTGAAGTGG - Intronic
1021746520 7:23746063-23746085 CCAGGGTTGTGGAGTTGTAGGGG + Intronic
1021889128 7:25170233-25170255 CCATTCTAGTGGATGTGAAGTGG + Intronic
1024441282 7:49421384-49421406 CCATTGTTTTGGAACTTGAGTGG + Intergenic
1028882437 7:95894936-95894958 GCATTGTTGTGGAGAAGAATTGG + Intronic
1030639425 7:111987534-111987556 CCATTATTGTGGAGTGGGAGGGG - Intronic
1035853564 8:2946912-2946934 CCATCCTTGTGGACATGAAGGGG + Intronic
1038650088 8:29394655-29394677 CTATTGTTGTGTTGCTGGAGGGG + Intergenic
1040362634 8:46682418-46682440 CCATTGCTGGGGAGCTCATGTGG + Intergenic
1042048775 8:64684883-64684905 CCATCCTTGTGGATGTGAAGTGG - Intronic
1042639932 8:70922562-70922584 GCATTGTTGAAGAGATGAAGAGG + Intergenic
1043661766 8:82752143-82752165 GCATTGTTGTGGAGAAGAATTGG - Intergenic
1047912677 8:129547482-129547504 CCAGTTTAGTGGAGCTGAATGGG + Intergenic
1049292305 8:141810883-141810905 CCCTCGGTGGGGAGCTGAAGGGG + Intergenic
1051142691 9:13994880-13994902 GCATTGTTGTGGAGAAGAATTGG + Intergenic
1051920180 9:22256154-22256176 CCATTGCTGGAGAGCTGATGTGG + Intergenic
1051982006 9:23031656-23031678 CAAATGTTGTGGAGGTGTAGGGG - Intergenic
1055661811 9:78511386-78511408 CCATTGGTATGGAGAGGAAGCGG + Intergenic
1055709542 9:79045073-79045095 TCAGTGATGTGAAGCTGAAGAGG - Intergenic
1056434369 9:86561134-86561156 CCACTGATGTGGAGGTTAAGAGG - Intergenic
1056701655 9:88916199-88916221 CCTTTGTGGTGGATCTGGAGTGG + Intergenic
1058756995 9:108091915-108091937 GCATTGTTGTGAAGATTAAGTGG + Intergenic
1062628837 9:137454641-137454663 CCTTTGTTCTGGAGTTGAAGGGG - Intronic
1186073287 X:5847057-5847079 CTATTGATGTCGAGCTGATGAGG + Intronic
1186478959 X:9881070-9881092 GCATTGATGGGGAGGTGAAGTGG + Intronic
1193635482 X:83944535-83944557 CCACAGATGTGGAGCTGAAGGGG - Intergenic
1194213012 X:91092055-91092077 CCCTTGTTGTAGAACTGATGTGG + Intergenic
1195253066 X:103066841-103066863 CCATTTTAGTGGGGGTGAAGTGG + Intergenic
1197285781 X:124593438-124593460 GCCTTGGTGTGGAGCGGAAGGGG + Intronic
1198134624 X:133736180-133736202 CCATTGTAGTGGATTTTAAGTGG - Intronic
1199208515 X:145177972-145177994 CTATTGATGTGGAGAAGAAGTGG - Intergenic
1199669317 X:150129247-150129269 CCATTCTTGTGGGTATGAAGTGG + Intergenic
1200739147 Y:6834160-6834182 ACCTTGTTGTAAAGCTGAAGGGG - Intergenic
1201081036 Y:10246819-10246841 CTCTTGTTGTAGATCTGAAGTGG - Intergenic