ID: 1147999824

View in Genome Browser
Species Human (GRCh38)
Location 17:44381023-44381045
Sequence GGCCACTGGGACCCCCGTAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 103}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147999816_1147999824 -8 Left 1147999816 17:44381008-44381030 CCAGCACTTGGCCCCGGCCACTG 0: 1
1: 0
2: 2
3: 25
4: 276
Right 1147999824 17:44381023-44381045 GGCCACTGGGACCCCCGTAGGGG 0: 1
1: 0
2: 1
3: 5
4: 103
1147999810_1147999824 14 Left 1147999810 17:44380986-44381008 CCCTCACTCTGACCCAGGAACAC 0: 1
1: 0
2: 2
3: 28
4: 278
Right 1147999824 17:44381023-44381045 GGCCACTGGGACCCCCGTAGGGG 0: 1
1: 0
2: 1
3: 5
4: 103
1147999811_1147999824 13 Left 1147999811 17:44380987-44381009 CCTCACTCTGACCCAGGAACACC 0: 1
1: 0
2: 3
3: 42
4: 333
Right 1147999824 17:44381023-44381045 GGCCACTGGGACCCCCGTAGGGG 0: 1
1: 0
2: 1
3: 5
4: 103
1147999814_1147999824 1 Left 1147999814 17:44380999-44381021 CCAGGAACACCAGCACTTGGCCC 0: 1
1: 0
2: 3
3: 22
4: 198
Right 1147999824 17:44381023-44381045 GGCCACTGGGACCCCCGTAGGGG 0: 1
1: 0
2: 1
3: 5
4: 103
1147999809_1147999824 15 Left 1147999809 17:44380985-44381007 CCCCTCACTCTGACCCAGGAACA 0: 1
1: 0
2: 2
3: 24
4: 300
Right 1147999824 17:44381023-44381045 GGCCACTGGGACCCCCGTAGGGG 0: 1
1: 0
2: 1
3: 5
4: 103
1147999813_1147999824 2 Left 1147999813 17:44380998-44381020 CCCAGGAACACCAGCACTTGGCC 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1147999824 17:44381023-44381045 GGCCACTGGGACCCCCGTAGGGG 0: 1
1: 0
2: 1
3: 5
4: 103
1147999807_1147999824 21 Left 1147999807 17:44380979-44381001 CCTCAGCCCCTCACTCTGACCCA 0: 1
1: 0
2: 7
3: 80
4: 678
Right 1147999824 17:44381023-44381045 GGCCACTGGGACCCCCGTAGGGG 0: 1
1: 0
2: 1
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147999824 Original CRISPR GGCCACTGGGACCCCCGTAG GGG Exonic
900246400 1:1638170-1638192 GGCCACTGGGATCCCAGGTGAGG - Intronic
900257629 1:1705312-1705334 GGCCACTGGGATCCCAGGTGAGG - Intronic
900541404 1:3204878-3204900 GGAGAGTGGGACCCCCGTTGGGG + Intronic
900809866 1:4793714-4793736 GTCCACTGGGACCCCCCTCCTGG - Intergenic
901644172 1:10707674-10707696 GGATACTGGGACCCCAGTGGGGG + Intronic
904380617 1:30108260-30108282 GGCCACAGGGAGCCCAGAAGAGG + Intergenic
907267426 1:53271438-53271460 GGGCAGTGGGACTCCCATAGAGG + Intronic
918315918 1:183322638-183322660 GGCCATTGGGACCCAGGTAGTGG - Intronic
920695160 1:208176223-208176245 GGCCACTGGGACCCCTCTGCAGG - Intronic
920725175 1:208428270-208428292 AGACACTGGAACCCCCATAGTGG - Intergenic
1067685648 10:48464890-48464912 GGCCACTGGAACCCTTGGAGGGG + Intronic
1075703437 10:124484005-124484027 GGCCACTGCGAGCCCCTGAGGGG - Intronic
1076339292 10:129732024-129732046 GGTCACTGAGACCCCTTTAGGGG - Intronic
1076846240 10:133070881-133070903 GTCCACTGCGCCCCCCTTAGAGG - Intergenic
1077161817 11:1116952-1116974 GGCCACTGGGACCCCAGGAAGGG + Intergenic
1081633356 11:44704190-44704212 GGTCACTGGGACCATCTTAGAGG + Intergenic
1081861049 11:46333422-46333444 GGCCGCTGGGCCCCCGGTGGAGG + Intronic
1081862043 11:46338928-46338950 GGCCTCTGGAACCCACGGAGGGG - Intronic
1083656599 11:64232754-64232776 GGCCACAGGGGCCCCAGTTGAGG + Exonic
1084421230 11:69061667-69061689 GGCCACTGGGACCCACCTGGGGG - Intronic
1088888794 11:114028811-114028833 GGACAGTGGGACCCCTGAAGAGG - Intergenic
1089149129 11:116351244-116351266 GGTCACTTGGACCCCCGTGTGGG - Intergenic
1091170502 11:133516123-133516145 GGGGACTGCGACCCCCGCAGAGG + Intronic
1094515378 12:31122588-31122610 GGCCCTTGGGACCCCCATAGCGG + Intergenic
1095570226 12:43675717-43675739 GGCCACTGGGACAACCGTCCAGG - Intergenic
1096961465 12:55582261-55582283 GGCCTCTGGGACCCCAGCTGAGG - Intergenic
1102256545 12:111418628-111418650 CGCCCCCGGGACCCCCGGAGAGG + Exonic
1109667152 13:65553842-65553864 GGCCTCTGGAACCCTGGTAGGGG - Intergenic
1117077680 14:52121152-52121174 GGCCAGTGGGAGCCCCTTAATGG + Intergenic
1117913234 14:60653652-60653674 TGCCACGGGGACACACGTAGAGG - Intronic
1121945716 14:98119771-98119793 GGTCTCTGGGACCCACGCAGAGG - Intergenic
1123783494 15:23647263-23647285 GGCCATTGGGGTCCCCGGAGGGG + Exonic
1128482911 15:68054840-68054862 GGCTACTGGGATCCACGGAGGGG - Intronic
1132632569 16:926902-926924 GGCCACAGGGACCCCAGCATAGG - Intronic
1134541351 16:15069158-15069180 GGAGACTGCGACCCCCGCAGAGG + Intronic
1136365449 16:29807141-29807163 GGCCGCTGTGTCCACCGTAGAGG - Exonic
1136601919 16:31297861-31297883 GGCCATTGGGGCCCCAGGAGAGG + Exonic
1137628791 16:49927658-49927680 GTCCACTGGGACCTCAGTAGGGG + Intergenic
1137635963 16:49986662-49986684 GGCCAGTGGGAACCCTCTAGCGG - Intergenic
1138591268 16:58000780-58000802 GGCCACGGGGTCCCCGGCAGGGG - Intronic
1140525623 16:75620414-75620436 GGCCTCTGGGAATCCCCTAGAGG - Intronic
1141978787 16:87536424-87536446 GGCCACTGGGAAACCTCTAGGGG - Intergenic
1143437557 17:6940440-6940462 GGCCAATGGGAACCCTCTAGAGG - Intronic
1146558461 17:33847789-33847811 GGCCAATGGGAGCCCAGTGGAGG + Intronic
1147999824 17:44381023-44381045 GGCCACTGGGACCCCCGTAGGGG + Exonic
1152665909 17:81569376-81569398 GGGCACTGGGACTCCCCTCGTGG + Intronic
1153146562 18:2039458-2039480 GGCCACTGCCACCCCCACAGTGG - Intergenic
1160164229 18:76495769-76495791 CGCACCTGGGACCCCCGAAGGGG - Exonic
1161108559 19:2456221-2456243 CGCGACTGGGAGCCCCGCAGTGG + Intronic
1165207967 19:34207471-34207493 AGCCACTGGGACTCCCTTGGAGG - Intronic
1165258204 19:34592640-34592662 GGCCACTGAGACCTCCATCGAGG + Intergenic
1166785102 19:45362896-45362918 GGACACTGGGACTCCCAGAGGGG - Intronic
1166812442 19:45522427-45522449 TGCAGCTGGGACCCCCGAAGGGG - Exonic
927117243 2:19916949-19916971 GGTCCCTGGGACCCATGTAGGGG + Intronic
928606437 2:32947891-32947913 GGCCACTCGGAGCCCCGCGGTGG + Intronic
929737461 2:44565131-44565153 GGCCAAAGGGACCCCCCAAGTGG + Intronic
933651842 2:84855972-84855994 GGCCACTGTGAGCCGCGTAATGG - Intronic
935688857 2:105712304-105712326 GGCCACTGGAACCCCCAGGGGGG - Intergenic
938392452 2:130916364-130916386 GGCCACTGAGAGCCCAGGAGGGG + Intronic
1172568979 20:35954236-35954258 GGCCACTGGGAGTCCCGCGGCGG - Exonic
1173569980 20:44069778-44069800 GACCACTGTTACCCCCTTAGAGG - Intergenic
1174188446 20:48723239-48723261 GGCCACGGGGACCCCTGCAAGGG + Intronic
1175711896 20:61227975-61227997 GGCCACAGGGACCCCTCTTGTGG - Intergenic
1176038264 20:63050680-63050702 GGCTGCTGGGACCCCCACAGGGG + Intergenic
1180038731 21:45264873-45264895 GGCCTCAGGGAGCCCCGTGGAGG - Exonic
1180613831 22:17114642-17114664 GGCCAGTGGGACACCCGTGCAGG - Exonic
1183067852 22:35375847-35375869 GGCAACTGGGGCCCCTGGAGGGG + Intergenic
1184262879 22:43329376-43329398 GGCCCCTGGGACCCTCGCTGTGG - Intronic
952967103 3:38628214-38628236 AGCCACTGGGAACCCAGTACAGG + Intronic
956635387 3:71359076-71359098 GACCACTGGGTCCCCCGCAAAGG + Intronic
999282299 5:150373823-150373845 GGCCAGTGGGAGCCCAGCAGAGG + Intronic
1001419317 5:171574572-171574594 GGCCAATGGGACCCCAGAGGGGG - Intergenic
1003604526 6:7547147-7547169 GGCCACTGGGACCAGCCCAGCGG - Intronic
1003641931 6:7883052-7883074 GGCCACTGGGTTCCCAGTGGTGG - Exonic
1003767239 6:9252879-9252901 GGCCACTGGGTCCTCCGCTGAGG + Intergenic
1006646891 6:35521123-35521145 GTCCACTGGGCCCCCCACAGTGG + Intergenic
1007706301 6:43793537-43793559 GGCCTCTGGGACCCAGGCAGGGG + Intergenic
1018692358 6:166357607-166357629 GGCCACTGGGAGCCCTTTAATGG - Intergenic
1019414874 7:922533-922555 GGCCACTGTGACCCCCATAGCGG + Intronic
1019910373 7:4096836-4096858 GACCACAGCGACCCCCGTGGGGG - Intronic
1022522314 7:31016316-31016338 GGCCACGGGGCCCCAGGTAGAGG + Intergenic
1024752386 7:52482876-52482898 GGCCAATGGGAAACCCCTAGAGG - Intergenic
1025161359 7:56663884-56663906 GGCCCCTGTGACCTCTGTAGAGG - Intergenic
1026771818 7:73206935-73206957 GGCCACGGCGACCCCTGGAGAGG - Intergenic
1027012686 7:74760331-74760353 GGCCACGGCGACCCCTGGAGAGG - Intronic
1027075354 7:75185722-75185744 GGCCACGGCGACCCCTGGAGAGG + Intergenic
1027173245 7:75887732-75887754 TGCCACTGAGACCACCGGAGGGG - Intronic
1031361696 7:120856758-120856780 GGCCATTGTGAGCCCCGTAAGGG + Exonic
1035043098 7:155945205-155945227 GGCCAATGGGAAACCCCTAGAGG + Intergenic
1037682748 8:21111100-21111122 GGCCACTGGGAAACCTTTAGAGG + Intergenic
1038038798 8:23707011-23707033 GTCCACGGGGACCCTCCTAGTGG + Intergenic
1043592105 8:81844153-81844175 GGCCAATGGGAACCCTCTAGAGG + Intergenic
1048140679 8:131791232-131791254 GGCCAATGGGACCTCAGAAGAGG - Intergenic
1049473136 8:142785126-142785148 GGCTCCTGGCACCCCCGTTGCGG + Exonic
1049748704 8:144273677-144273699 AGCCGCTGGGACCCCCGGGGAGG - Intronic
1051231670 9:14961697-14961719 GGCCAATGGGAAACCTGTAGAGG + Intergenic
1053117417 9:35517738-35517760 GGCCACTGTGACCCTAGAAGAGG + Intronic
1055690159 9:78821608-78821630 GGCCAATGGGAAACCTGTAGGGG - Intergenic
1057197157 9:93121548-93121570 GGGTGCTGGGACCCCCGTGGAGG + Exonic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1061529374 9:131198203-131198225 GGCATCAGGGACCCCCGTGGTGG - Exonic
1061609882 9:131739551-131739573 GGCCCCTGGCGCCCCCGCAGCGG + Intronic
1062386874 9:136315949-136315971 GGCCACTGGGGCCCCCACATTGG + Intergenic
1186298947 X:8177989-8178011 AGCCACTGGGACCCTCCCAGTGG - Intergenic
1186477112 X:9866055-9866077 GGCCTCTGGGACCACAGCAGGGG + Intronic
1188680841 X:33002410-33002432 GGCCAATGGGAAACCTGTAGAGG - Intronic
1193768581 X:85561451-85561473 GCCTACTGGGACCCCGGTGGGGG - Intergenic
1196937294 X:120742584-120742606 TGCTACTGGGACACCCTTAGCGG + Intergenic
1201439692 Y:13994273-13994295 AGCCACTGGGACCCTCCCAGTGG - Intergenic
1201444879 Y:14048435-14048457 AGCCACTGGGACCCTCCCAGTGG + Intergenic