ID: 1148000584

View in Genome Browser
Species Human (GRCh38)
Location 17:44385044-44385066
Sequence AAATATCCGCAACTGGAGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148000582_1148000584 -4 Left 1148000582 17:44385025-44385047 CCTGGGCGGTAACTCGAGAAAAT 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1148000584 17:44385044-44385066 AAATATCCGCAACTGGAGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 79
1148000581_1148000584 9 Left 1148000581 17:44385012-44385034 CCACAAAAGGATGCCTGGGCGGT 0: 1
1: 0
2: 2
3: 2
4: 58
Right 1148000584 17:44385044-44385066 AAATATCCGCAACTGGAGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148000584 Original CRISPR AAATATCCGCAACTGGAGCC TGG Exonic
901712786 1:11128843-11128865 AAGTATCCTCACCTGTAGCCAGG + Exonic
903543725 1:24110907-24110929 AACTCTCAGCCACTGGAGCCAGG - Intronic
903890697 1:26568451-26568473 AAAGATCAACAACTTGAGCCGGG + Intronic
912250447 1:108006662-108006684 AAATATCAACCACTGGAGACTGG + Intergenic
918048191 1:180953867-180953889 AGATATCCGCAGCTGGCACCCGG + Intergenic
922316840 1:224449891-224449913 AAATATCCACAACTGAAAGCAGG - Intronic
924270082 1:242323218-242323240 AAATATCAGCAACGGCCGCCTGG - Intronic
1062929676 10:1344661-1344683 AAATGTCAGCAACTGGTGCTAGG + Intronic
1064007485 10:11710006-11710028 AAACATCCTCCCCTGGAGCCCGG - Intergenic
1068324601 10:55467815-55467837 AAATAGCCGGAAGTGGAGGCGGG + Intronic
1071778570 10:88816866-88816888 AAATATTCTACACTGGAGCCAGG + Exonic
1080025083 11:27604845-27604867 AAAGCTCCCCAACTGGTGCCTGG - Intergenic
1086617846 11:88844717-88844739 AAATATCAGCAACAGGAGTTTGG + Intronic
1088582697 11:111331068-111331090 AAATATTCACGACTGGTGCCTGG - Intergenic
1089583728 11:119497116-119497138 AACTGTCCCCAACTGGACCCTGG + Intergenic
1091215135 11:133896710-133896732 AAATACCAGCGAGTGGAGCCTGG + Intergenic
1093598191 12:20987412-20987434 AAATATACACAACTGAAGACTGG - Intergenic
1100879589 12:99001422-99001444 AAATAACTGAAACTGGGGCCTGG - Intronic
1103291316 12:119848728-119848750 AAATATCCCCCACCGGAGCTGGG + Intronic
1103465365 12:121138256-121138278 AAATAGAAGCAAATGGAGCCAGG - Intronic
1108273299 13:48783858-48783880 AAATATCCACAAAAGGAGCAAGG + Intergenic
1108761138 13:53566539-53566561 AAATATCCTCCACTGGAGGTTGG - Intergenic
1109061566 13:57628753-57628775 AAACATCTGCAACTGGAGACTGG - Intergenic
1109753493 13:66726962-66726984 AAAAATCTAAAACTGGAGCCAGG + Intronic
1110077594 13:71268297-71268319 AAATATCTGCAAGTGGAAGCAGG - Intergenic
1115927231 14:38449150-38449172 AAATTTCAGCAACTCCAGCCAGG + Intergenic
1120654707 14:87176099-87176121 AAATATCAGCAATTTGAGTCAGG - Intergenic
1125336846 15:38635326-38635348 AGATGTCCGTCACTGGAGCCAGG - Intergenic
1127195751 15:56583727-56583749 AAATCCCGACAACTGGAGCCAGG + Intergenic
1131658707 15:94490501-94490523 AAATATTTGCAACTTCAGCCAGG + Intergenic
1135464874 16:22676650-22676672 AAATATCCCCAATTGGAGGTGGG + Intergenic
1135686731 16:24503779-24503801 AAACATCCGCACCTGGGGGCCGG + Intergenic
1139625229 16:68182812-68182834 AAATGTTCTAAACTGGAGCCAGG - Intronic
1140492881 16:75354733-75354755 GGGTATCCGCAACTGGATCCTGG + Intronic
1143067971 17:4264650-4264672 AAATATCTGCTACTGCAGCCTGG - Intergenic
1144357720 17:14461928-14461950 AAATATCTGAGACTGGAGGCCGG + Intergenic
1146753298 17:35402033-35402055 AAAAATCTGCAACAGGAGCCTGG - Intergenic
1148000584 17:44385044-44385066 AAATATCCGCAACTGGAGCCTGG + Exonic
1156739825 18:40310650-40310672 AAATATCTGTATCTGTAGCCAGG + Intergenic
1161967121 19:7554994-7555016 AAATATGCGCAGCTGGTGCTCGG + Exonic
1166555436 19:43696737-43696759 AAATGTCCAGAACTGGAGCCTGG - Intergenic
930494123 2:52117035-52117057 CAATATCCCCAAGTGTAGCCTGG - Intergenic
933976029 2:87510744-87510766 AAATAACTGCAACTGGAGGGGGG - Intergenic
936317793 2:111440062-111440084 AAATAACTGCAACTGGAGGGGGG + Intergenic
946435298 2:219647733-219647755 AAATACCTGAAACTGGGGCCAGG - Intergenic
1169091401 20:2863286-2863308 AAGTCTCCGCAACACGAGCCTGG - Exonic
1175952318 20:62590136-62590158 AAGTGTCAGCAGCTGGAGCCTGG + Intergenic
1176672379 21:9746509-9746531 AAATATCCGCAACTTTCCCCAGG - Intergenic
1178984241 21:37289396-37289418 AAATATAGGCAGCTGGGGCCAGG - Intergenic
1180155511 21:45975400-45975422 AAATTTCCCCAGCTGGGGCCTGG + Intergenic
951432848 3:22628201-22628223 GAATTTCAGCAACTGCAGCCAGG - Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
955239101 3:57164498-57164520 AAATATCCGCAACTCGAAGCAGG + Intronic
957511758 3:81198271-81198293 AAATATCCACAAAGGGAGCTTGG + Intergenic
962858423 3:139372088-139372110 AAATAAAGGCAACTGGAGGCAGG + Intronic
964730992 3:159864707-159864729 AAATATCTGGCACTAGAGCCTGG + Intronic
965299586 3:166993444-166993466 AAATATATGCAAATGGGGCCAGG + Intergenic
968155047 3:196373924-196373946 AAATATCCTCATATTGAGCCAGG + Intronic
972704077 4:41524085-41524107 AATTATCTGGAACTGGAACCAGG - Intronic
979742409 4:124167952-124167974 AAATTTCAGCAACTCCAGCCAGG + Intergenic
999769863 5:154767258-154767280 AAAAATACTCAACTGGAGCCTGG + Intronic
1002554356 5:180023465-180023487 AAATATATGCAAAAGGAGCCTGG + Intronic
1007861142 6:44910080-44910102 AAATAGGCCCAACTGGAGCAAGG - Intronic
1007970188 6:46044217-46044239 AAAAAGCCTCAACTGGAGCAAGG - Intronic
1009230857 6:61059683-61059705 GAATTTCAGCAACTGCAGCCAGG - Intergenic
1010619373 6:78055370-78055392 CAATATATGCAACAGGAGCCAGG - Intergenic
1011015770 6:82752946-82752968 AAATTTCCACAACTGAAGACAGG + Intergenic
1019557219 7:1638621-1638643 CTTTATCCGCAACTGGAGCGAGG - Intergenic
1028711127 7:93909718-93909740 AATTATTTTCAACTGGAGCCAGG - Intronic
1030041970 7:105459775-105459797 AAAAATGCACAACTGGGGCCAGG + Intronic
1030173659 7:106629311-106629333 AAATATCAGGATCTGGGGCCTGG + Intergenic
1030303697 7:107999749-107999771 AAAAAAAAGCAACTGGAGCCAGG - Intronic
1032484782 7:132277247-132277269 AAAAATTCCCAATTGGAGCCTGG - Intronic
1042418272 8:68553088-68553110 ACATATCCTCCACTGGGGCCAGG + Intronic
1043377651 8:79668422-79668444 AAAAATCTGTAACTGGAACCAGG - Intergenic
1043404766 8:79919109-79919131 TAATAGCCGCAACCGGACCCTGG + Exonic
1044446188 8:92279657-92279679 AAATATCACCAACAGAAGCCTGG - Intergenic
1046892360 8:119436725-119436747 AAATATCCTCAAGTAGAGCTAGG - Intergenic
1049271811 8:141700149-141700171 AGATGTCCGCCACTGGAGGCTGG + Intergenic
1051459085 9:17293462-17293484 GAATTTCAGCAACTGCAGCCAGG - Intronic
1051917990 9:22230396-22230418 AAATTTCAGCAACTCTAGCCAGG + Intergenic
1053250125 9:36567291-36567313 AAATATTTTCTACTGGAGCCAGG - Intergenic
1055110368 9:72553266-72553288 AAATATACAGAATTGGAGCCAGG - Intronic
1055343321 9:75308661-75308683 AAATTTCAGCAACTCCAGCCAGG - Intergenic
1193533622 X:82686514-82686536 AAATTTCAGCAACTACAGCCAGG - Intergenic
1200412025 Y:2870330-2870352 AAAAATCCAAAAATGGAGCCAGG + Intronic