ID: 1148002288

View in Genome Browser
Species Human (GRCh38)
Location 17:44396937-44396959
Sequence CACATTTGGCACTGTTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 174}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148002288_1148002296 29 Left 1148002288 17:44396937-44396959 CCAAGATAACAGTGCCAAATGTG 0: 1
1: 0
2: 1
3: 10
4: 174
Right 1148002296 17:44396989-44397011 ATTGCAGCCTGAGTTATATCAGG 0: 1
1: 0
2: 1
3: 12
4: 108
1148002288_1148002292 -5 Left 1148002288 17:44396937-44396959 CCAAGATAACAGTGCCAAATGTG 0: 1
1: 0
2: 1
3: 10
4: 174
Right 1148002292 17:44396955-44396977 ATGTGTGGCTCCGTTGATGTGGG 0: 1
1: 0
2: 0
3: 2
4: 89
1148002288_1148002291 -6 Left 1148002288 17:44396937-44396959 CCAAGATAACAGTGCCAAATGTG 0: 1
1: 0
2: 1
3: 10
4: 174
Right 1148002291 17:44396954-44396976 AATGTGTGGCTCCGTTGATGTGG 0: 1
1: 0
2: 2
3: 3
4: 73
1148002288_1148002293 1 Left 1148002288 17:44396937-44396959 CCAAGATAACAGTGCCAAATGTG 0: 1
1: 0
2: 1
3: 10
4: 174
Right 1148002293 17:44396961-44396983 GGCTCCGTTGATGTGGGAACTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1148002288_1148002295 5 Left 1148002288 17:44396937-44396959 CCAAGATAACAGTGCCAAATGTG 0: 1
1: 0
2: 1
3: 10
4: 174
Right 1148002295 17:44396965-44396987 CCGTTGATGTGGGAACTGGATGG 0: 1
1: 0
2: 1
3: 6
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148002288 Original CRISPR CACATTTGGCACTGTTATCT TGG (reversed) Intronic
900080103 1:850228-850250 GACATTTGGCAGTGTTTTCTCGG + Intergenic
902133581 1:14284723-14284745 GACATTTGTCACTGTCACCTGGG - Intergenic
904062144 1:27720058-27720080 CACATTTGGCCCTGGTGTCCTGG + Intergenic
905610933 1:39350817-39350839 CTCATTTGCCACTGTTGTCAAGG + Exonic
908420482 1:63954107-63954129 TACATATGTCACTGTTATCTGGG - Intronic
908878208 1:68701478-68701500 CACTTTTCTCACTGATATCTTGG + Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
913978905 1:143489792-143489814 CCCATTTGGCACTTCTTTCTGGG + Intergenic
914073310 1:144315441-144315463 CCCATTTGGCACTTCTTTCTGGG + Intergenic
914105844 1:144650919-144650941 CCCATTTGGCACTTCTTTCTGGG - Intergenic
918187644 1:182142369-182142391 TACATTTGGCTCTGTGAACTAGG + Intergenic
921071311 1:211660467-211660489 CAAAGTTGGCACTGCCATCTAGG - Intronic
921662034 1:217815067-217815089 CACAATTCACACTGATATCTTGG - Intronic
921662874 1:217828008-217828030 CACATTTGGCACACGTACCTGGG + Intronic
922134453 1:222811152-222811174 GAAATTTGGCACTGTTGTCCAGG - Intergenic
924252565 1:242147829-242147851 CATATTTGGCACAGTTTTATTGG + Intronic
1067533092 10:47088525-47088547 CAAATGTGGCACTCTGATCTTGG + Intergenic
1069647757 10:70016500-70016522 CAGATTTGGCAGTGATTTCTTGG + Intergenic
1075888122 10:125919767-125919789 CTCATTTGGCACTTCTTTCTGGG + Intronic
1078222243 11:9361568-9361590 CACTTTTTTCACTGTTATTTTGG + Intergenic
1079139209 11:17796575-17796597 CAGATGTGGCCCTGTGATCTTGG + Intronic
1081715010 11:45243944-45243966 CACATCTGTCACTGTCTTCTGGG + Exonic
1082037319 11:47655740-47655762 AACATTTTGCACTGAGATCTTGG - Intergenic
1082679934 11:56154662-56154684 AACATTTGGAACAGTTATTTGGG + Intergenic
1084226673 11:67719698-67719720 CAGATTGGGCAATGTTCTCTGGG - Intergenic
1084260121 11:67971483-67971505 CAGATTGGGCAATGTTCTCTGGG - Intergenic
1084808518 11:71597154-71597176 CAGATTGGGCAATGTTCTCTGGG + Intronic
1084812648 11:71623774-71623796 CAGATTGGGCAATGTTCTCTGGG + Intergenic
1084845623 11:71897160-71897182 CAGATTGGGCAATGTTCTCTGGG + Intronic
1084921541 11:72474717-72474739 CACATTTGGCAATGCTTTTTGGG - Intergenic
1085170140 11:74442778-74442800 CTCATTTGACACTGTACTCTGGG - Intergenic
1085578508 11:77628988-77629010 CACATTTGGCAGTGACATTTTGG - Intronic
1086031637 11:82365796-82365818 CACAACTGGCACTGAGATCTTGG + Intergenic
1086873449 11:92067179-92067201 CACATCTGGAAATCTTATCTAGG - Intergenic
1087487865 11:98780971-98780993 CACATTTGTTGCTGTTATTTGGG + Intergenic
1090644339 11:128755575-128755597 TAAATTTTGAACTGTTATCTGGG - Intronic
1093019399 12:14189074-14189096 TACATTTAGCACTGTTACTTTGG + Intergenic
1095199645 12:39368336-39368358 CACATTTGGCACATGTTTCTAGG - Intronic
1097876652 12:64649654-64649676 GACATTTGACACTGATAACTTGG - Intronic
1098854586 12:75637818-75637840 CACAATTGCCAATGTCATCTGGG + Intergenic
1101482910 12:105119443-105119465 CAATTTTGGCACTGTTCTTTTGG + Intronic
1105220430 13:18321601-18321623 CGCATTTGGCACTTCTTTCTGGG - Intergenic
1105794692 13:23839437-23839459 TATATTTGTCACTTTTATCTGGG - Intronic
1105906395 13:24814441-24814463 CAGATTTGATAATGTTATCTTGG - Intronic
1107095730 13:36533085-36533107 CACATTTGACTCTGCAATCTTGG + Intergenic
1107741953 13:43460151-43460173 CACTTTTGTCTCTGTTATGTAGG - Intronic
1111097988 13:83539523-83539545 CAATTTTGCTACTGTTATCTTGG - Intergenic
1111386577 13:87536436-87536458 CAGATTTGTGACTGGTATCTGGG + Intergenic
1113658488 13:112086751-112086773 CTCTTTTGGCTCTGTTTTCTTGG + Intergenic
1114276478 14:21150268-21150290 CACCTTTGGCACAGCTGTCTGGG - Intergenic
1114935067 14:27524911-27524933 TTCATTTGGCAATGATATCTTGG - Intergenic
1116138445 14:40957840-40957862 CACTTTTGGGACTTTTAGCTAGG + Intergenic
1116371660 14:44142019-44142041 CACATTCTGGTCTGTTATCTAGG + Intergenic
1116650052 14:47578379-47578401 CACATTCTGCACTTGTATCTTGG + Intronic
1119290148 14:73489233-73489255 GACATTTGGCAATGTCATATAGG - Intronic
1120123051 14:80705675-80705697 GAGATTTTGCACTGTTACCTGGG + Intronic
1122065058 14:99167235-99167257 CACATGTGGCACTCTCATCAGGG + Intergenic
1202870027 14_GL000225v1_random:154239-154261 CTCATTTGGCACTTCTTTCTGGG - Intergenic
1123708817 15:22971196-22971218 CAGATTTGGCAATGATTTCTTGG + Intronic
1126276082 15:46882962-46882984 CACATTCTGCACAGGTATCTCGG + Intergenic
1126755163 15:51918735-51918757 CCCATATGGCACTGTGCTCTTGG - Intronic
1127204402 15:56698363-56698385 CTCATTTGCCACCGTGATCTTGG - Intronic
1127993870 15:64140904-64140926 CACATTTGGCACCCAGATCTTGG - Intronic
1129452873 15:75660413-75660435 GACATATGGCTCTGTCATCTGGG - Exonic
1130191312 15:81738687-81738709 CTCATGTGTCAGTGTTATCTGGG + Intergenic
1130705374 15:86228287-86228309 ACCATCTGGCACTGATATCTGGG + Intronic
1130867541 15:87945402-87945424 CACATATGGAATAGTTATCTTGG - Intronic
1136179975 16:28544648-28544670 CAGATTTGACATTTTTATCTGGG - Intergenic
1140101351 16:71920241-71920263 CACATCTAGCACAGATATCTTGG + Intronic
1145759314 17:27417138-27417160 CACACTTGGCCCTCGTATCTGGG - Intergenic
1145799730 17:27675212-27675234 CACACTTGGCCCTCATATCTGGG + Intergenic
1146791945 17:35755941-35755963 AACATTTGGCAATGTCTTCTGGG + Intronic
1148002288 17:44396937-44396959 CACATTTGGCACTGTTATCTTGG - Intronic
1158062941 18:53368502-53368524 TAGATTTGGCAATGTTTTCTTGG - Intronic
1159654430 18:71014858-71014880 CACATTCACCACTGTTAACTTGG + Intergenic
1166155552 19:40908893-40908915 CATATTTGCGAGTGTTATCTGGG - Intergenic
928051475 2:28001032-28001054 CACATCTGGCACTAAGATCTTGG - Intronic
932515200 2:72339684-72339706 CACATTTGCAAATGGTATCTTGG - Intronic
934183628 2:89650873-89650895 CTCATTTGGCACTTCTTTCTGGG + Intergenic
934293913 2:91725044-91725066 CCCATTTGGCACTTCTTTCTGGG + Intergenic
936902823 2:117503161-117503183 AACATTTGCCACTGTGATCTAGG - Intergenic
939533777 2:143398976-143398998 CACATTTTGTTCTGTTATCCAGG + Intronic
940220319 2:151344610-151344632 CACATTTTTCACATTTATCTAGG - Intergenic
940900887 2:159125414-159125436 CACATCTGGCTCTCTTCTCTAGG + Intronic
941080590 2:161056345-161056367 CACATCTAGCACAGATATCTTGG - Intergenic
944909469 2:204295762-204295784 AACATTTGACACTCTTCTCTTGG + Intergenic
947987826 2:234463975-234463997 CACATTAGCCACTGTCTTCTAGG + Intergenic
948659494 2:239498371-239498393 CACATGTGGAACTATGATCTGGG - Intergenic
1170117385 20:12875038-12875060 CTCATATGGCAATGTTGTCTGGG - Intergenic
1174406216 20:50305006-50305028 CATATTGGGCCCTGTTCTCTAGG + Intergenic
1177530853 21:22355933-22355955 CAGATTTGCCACTGGTAACTTGG + Intergenic
1178096016 21:29216756-29216778 CACATATGGCAGGATTATCTTGG + Intronic
1179601857 21:42484380-42484402 CACATTTGGGACTATTGTGTAGG - Intronic
956143689 3:66171278-66171300 CACATTTGTCACTGTTACCAAGG - Intronic
956417548 3:69049404-69049426 AACATTTGTCACCATTATCTTGG - Intronic
956832687 3:73069140-73069162 TACATTTGGCAAAGTAATCTAGG - Exonic
957114427 3:76006423-76006445 CACATTTTGCAAAGTTATATTGG + Intronic
960638534 3:119807115-119807137 CACATTTGGGCCTGTGAACTCGG - Intronic
961276123 3:125728249-125728271 CAGATTGGGCAATGTTCTCTGGG + Intergenic
961279036 3:125750826-125750848 CAGATTGGGCAATGTTCTCTGGG + Intergenic
961875368 3:130018786-130018808 CAGATTGGGCAATGTTCTCTGGG - Intergenic
962122131 3:132572941-132572963 CACATTTTGCACTTGTATCCCGG - Intronic
962694378 3:137933052-137933074 CACATATTGCACTGTAGTCTGGG - Intergenic
963276103 3:143331563-143331585 CCCATATGGCACAGTAATCTGGG - Intronic
966865210 3:184255062-184255084 CACCTTTGGTAAAGTTATCTTGG + Intronic
968987717 4:3886542-3886564 CAGATTGGGCAATGTTCTCTGGG - Intergenic
969794538 4:9516630-9516652 CAGATTGGGCAATGTTCTCTGGG + Intergenic
970492441 4:16588229-16588251 CAGATTTAGCACTGTGATCAGGG + Intronic
971707044 4:30058397-30058419 CACTTCTGGCACTGGTAGCTTGG + Intergenic
975772326 4:77739844-77739866 AACAGTTAGAACTGTTATCTGGG - Intronic
975954946 4:79826100-79826122 CACTTTAGTCACTGTTATCATGG - Intergenic
977110383 4:92944955-92944977 CATATTTGCCACTGTTTTCATGG + Intronic
978403560 4:108356189-108356211 CCCATCTGGCACTGTGAGCTGGG + Intergenic
978411202 4:108427917-108427939 CAGCTTTGACACTGTTTTCTTGG - Intergenic
978965720 4:114738679-114738701 CCCATTTGGCACTTTTCTTTTGG - Intergenic
981317069 4:143350336-143350358 GTCATGTGGCACTGTTATCATGG + Intronic
984563541 4:181299805-181299827 AACATTTGGAAGTGTAATCTAGG + Intergenic
984747593 4:183238177-183238199 CACATTTGGTCCTGTTCTCCAGG + Intronic
985329223 4:188809171-188809193 TTCAGTTGACACTGTTATCTTGG + Intergenic
987984406 5:25127516-25127538 CAAAACTGGCTCTGTTATCTTGG - Intergenic
988968092 5:36439953-36439975 CACTTTTGGCAATGTTTACTGGG + Intergenic
994735756 5:103553630-103553652 CACATTTGCAAGAGTTATCTAGG - Intronic
996524035 5:124458520-124458542 CACATTGGGCATTTTGATCTTGG - Intergenic
999251566 5:150185448-150185470 CACCTTGTGCACTGTTATCATGG - Intergenic
999798480 5:155010211-155010233 CACATTTAACACTTTTATTTTGG + Intergenic
1000073718 5:157764860-157764882 CACATGTGGCACTGGTCACTAGG + Intergenic
1000854531 5:166381680-166381702 CACTTCTGCCACTGTTTTCTGGG + Intergenic
1007174940 6:39889455-39889477 CTCATTTGGCACAATTATTTTGG + Intronic
1012819021 6:104061481-104061503 CATATTTTGCAGTGTTTTCTGGG + Intergenic
1013515368 6:110880420-110880442 TACATTTGGCAATGATTTCTTGG - Intronic
1013745431 6:113339866-113339888 CTCATTTTGCACTGTTCTCAAGG + Intergenic
1015364398 6:132380864-132380886 CACATCTGGCACTGAAATCTGGG + Intronic
1015693068 6:135947490-135947512 CACATTTGGCATTCTGATCGGGG - Exonic
1018017230 6:159723561-159723583 CACATCTGACACTGAGATCTTGG - Intronic
1018772736 6:166986266-166986288 CAGATTTGCAACTGATATCTGGG - Intergenic
1020525813 7:9256974-9256996 CACATTCTGCACTTTTATCCGGG + Intergenic
1022946428 7:35289649-35289671 CACATTTGGGACTGTGATGTGGG + Intergenic
1023315952 7:38936791-38936813 CAGATTTGGCAATGATTTCTTGG - Intergenic
1026071128 7:67120659-67120681 CCCATCTGACATTGTTATCTAGG + Intronic
1026705768 7:72691626-72691648 CCCATCTGACATTGTTATCTAGG - Intronic
1026764811 7:73154011-73154033 CACCTTTGGCAGAGTAATCTGGG - Intergenic
1027041284 7:74963781-74963803 CACCTTTGGCAGAGTAATCTGGG - Intergenic
1027082356 7:75238595-75238617 CACCTTTGGCAGAGTAATCTGGG + Intergenic
1027991209 7:85362944-85362966 CACATTTGGAAATGTTTTCTGGG + Intergenic
1028606972 7:92665502-92665524 ATCATCTGTCACTGTTATCTGGG - Intronic
1028947479 7:96596920-96596942 CATATTTGCCTCTGATATCTGGG - Intronic
1029077168 7:97944233-97944255 CAGATTGGGCAATGTTCTCTGGG - Intergenic
1031236244 7:119181961-119181983 AACATTTGTCAATGTAATCTGGG - Intergenic
1033490405 7:141837851-141837873 CACACTTACCACTGTTTTCTTGG + Exonic
1035525408 8:308689-308711 GACATTTGGCAGTGTTTGCTCGG - Intergenic
1036261441 8:7243863-7243885 CAGATTGGGCAATGTTCTCTGGG - Intergenic
1036305158 8:7595693-7595715 CAGATTGGGCAATGTTCTCTGGG + Intergenic
1036313481 8:7702407-7702429 CAGATTGGGCAATGTTCTCTGGG - Intergenic
1036356008 8:8043689-8043711 CATATTGGGCAATGTTCTCTGGG + Intergenic
1036902547 8:12681636-12681658 CAGATTGGGCAATGTTCTCTGGG - Intergenic
1038774557 8:30516588-30516610 CACATTTGGAACTGGTATTGTGG - Intronic
1038978226 8:32725341-32725363 CCCATTCAGCACTGTCATCTGGG + Intronic
1042491513 8:69404166-69404188 CACACCTAGCACTTTTATCTTGG - Intergenic
1044426259 8:92054367-92054389 AACACTTGGCACTGTTTTGTGGG + Intronic
1044432613 8:92126529-92126551 GAAATTTGGTACTGTTATCTTGG + Intergenic
1045655725 8:104384363-104384385 CACTTCTGGCATTGTTCTCTGGG + Intronic
1045878076 8:107005829-107005851 CACATTTTGCACTTGTATCCTGG + Intergenic
1047695550 8:127400347-127400369 CACATTTGGCCCTGGAATCAGGG - Intergenic
1050206919 9:3206209-3206231 CACATTTTTCAGTGATATCTTGG - Intergenic
1052805011 9:33005308-33005330 CAGATTTGGCAATGTTTTCTTGG - Intronic
1054707663 9:68479512-68479534 CAAATTTGGCCCAGTGATCTCGG - Exonic
1055223561 9:73967182-73967204 CCCATTTGGCACTATTATCTAGG + Intergenic
1057456157 9:95213739-95213761 CAGATTTGGCAATGATTTCTTGG + Intronic
1058233002 9:102453605-102453627 CAAATTTTGCTCTGTCATCTAGG - Intergenic
1061581252 9:131538143-131538165 CACATTTTGCACTCTTTGCTTGG - Intergenic
1203734427 Un_GL000216v2:122304-122326 CTCATTTGGCACTTCTTTCTGGG + Intergenic
1186225436 X:7394288-7394310 CATTTTTAGTACTGTTATCTCGG - Intergenic
1186387874 X:9128200-9128222 CACTTTTGGCAGTGCCATCTGGG + Intronic
1186387967 X:9129374-9129396 CACATTTGCCAGTGTCATTTTGG + Intronic
1188179919 X:27042128-27042150 CATATTTGGAATTGTTGTCTTGG + Intergenic
1188424804 X:30034318-30034340 GAGATCAGGCACTGTTATCTTGG - Intergenic
1188585357 X:31767960-31767982 CACACATTGCACTGTTACCTGGG - Intronic
1189186918 X:39062717-39062739 CCTATTTGGCTCAGTTATCTTGG + Intergenic
1189390454 X:40571908-40571930 CACATTGGGCACTGCTAACTTGG + Intergenic
1189668984 X:43387688-43387710 CAGATTTGCCACTGGTAACTTGG - Intergenic
1190453629 X:50604715-50604737 CACATTAGGCACTATATTCTAGG + Intronic
1193767638 X:85550197-85550219 CAAATTTGTCTCAGTTATCTAGG - Intergenic
1193969045 X:88027895-88027917 CACAATTAGCTTTGTTATCTGGG - Intergenic
1196740649 X:119022648-119022670 CACATTTGCCACTGTTTACGTGG - Intergenic
1200129757 X:153834882-153834904 ACCAGTTGGCACTGTGATCTTGG - Intergenic
1202626606 Y:56866301-56866323 CTCATTTGGCACTTCTTTCTGGG - Intergenic