ID: 1148002313

View in Genome Browser
Species Human (GRCh38)
Location 17:44397099-44397121
Sequence AGGCCAAGCTGTTCTAGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148002313_1148002323 30 Left 1148002313 17:44397099-44397121 CCACCACTAGAACAGCTTGGCCT 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1148002323 17:44397152-44397174 TGGGCCCACAGCAAGTGCTCTGG 0: 1
1: 0
2: 0
3: 32
4: 277
1148002313_1148002321 11 Left 1148002313 17:44397099-44397121 CCACCACTAGAACAGCTTGGCCT 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1148002321 17:44397133-44397155 CTGAGAAGGCAAGACCAGATGGG 0: 1
1: 1
2: 1
3: 20
4: 292
1148002313_1148002320 10 Left 1148002313 17:44397099-44397121 CCACCACTAGAACAGCTTGGCCT 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1148002320 17:44397132-44397154 GCTGAGAAGGCAAGACCAGATGG 0: 1
1: 1
2: 0
3: 24
4: 378
1148002313_1148002317 -3 Left 1148002313 17:44397099-44397121 CCACCACTAGAACAGCTTGGCCT 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1148002317 17:44397119-44397141 CCTTCCCTGTGGCGCTGAGAAGG 0: 1
1: 0
2: 2
3: 21
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148002313 Original CRISPR AGGCCAAGCTGTTCTAGTGG TGG (reversed) Intronic
909360478 1:74753453-74753475 AGGCCAACAAGTGCTAGTGGTGG + Intronic
910279372 1:85481796-85481818 AGGCTAAGGTGTTCCCGTGGTGG - Intronic
911686467 1:100782392-100782414 AGGCACTGATGTTCTAGTGGGGG - Intergenic
915571282 1:156746682-156746704 AGGCCAAGCTGAGCCAGGGGTGG + Intronic
916045669 1:160998431-160998453 AGGGCCAGCTGTTCTAGAGCGGG - Exonic
916121714 1:161534081-161534103 AGGACCAGCTGTGCCAGTGGAGG + Intergenic
916131307 1:161614027-161614049 AGGACCAGCTGTGCCAGTGGAGG + Intronic
918503680 1:185227745-185227767 AGGCCCAGCAGCTCTAGCGGGGG + Intronic
1064512036 10:16105491-16105513 AAGCCAAGGTTTTCTGGTGGAGG - Intergenic
1065491969 10:26291354-26291376 AGCCCAAGCTCTTCTTGGGGAGG + Intronic
1065632302 10:27692918-27692940 TGGCCAAGCTGTTCGCCTGGTGG - Intronic
1070769836 10:79075783-79075805 TGGCCAAGCTGTTCTGATGGGGG + Intronic
1071818145 10:89253440-89253462 AGCCCATACTGTTCTTGTGGTGG - Intronic
1074198514 10:111209933-111209955 AGGCCAATTTGCTCTAGTGAGGG + Intergenic
1074323971 10:112429951-112429973 AGGCCAAGCAGTTGTTGGGGGGG + Intergenic
1075614687 10:123882786-123882808 AGGCCATGGTGTTATGGTGGGGG - Intronic
1075634092 10:124018660-124018682 ATGCCAAGCTGTTATATTTGGGG + Intronic
1077336891 11:2009319-2009341 AGGCCGAGATGTGCTGGTGGGGG - Intergenic
1077496879 11:2890795-2890817 AGGACAGGCTGTTCTTGGGGCGG + Intronic
1078849608 11:15151706-15151728 AGGCCAGGCTGTGATGGTGGAGG - Intronic
1079475255 11:20823309-20823331 CGCCCATACTGTTCTAGTGGTGG - Intronic
1083390839 11:62348853-62348875 AGGCCAATCTGCAGTAGTGGTGG + Intronic
1085041169 11:73327161-73327183 AGGACAAACTGTTGGAGTGGTGG + Intronic
1088866288 11:113851144-113851166 AGGCCAGGCTGCTGTGGTGGAGG - Intronic
1090515836 11:127425641-127425663 AGTGCAAGCTGTTTCAGTGGAGG + Intergenic
1202819875 11_KI270721v1_random:64501-64523 AGGCCGAGATGTGCTGGTGGGGG - Intergenic
1096094521 12:48925460-48925482 AGGACAGGCTGTTCGGGTGGCGG + Exonic
1096498670 12:52052815-52052837 TGGCCAGGCTGTCCTAGTGCAGG + Intronic
1098895164 12:76051616-76051638 AGTCCCAGCTGCTCTGGTGGCGG - Intronic
1101550809 12:105759848-105759870 GGGCCGAGCTGTTCAGGTGGTGG + Intergenic
1101794332 12:107958945-107958967 AGGTCAAGGTGTTCTAATGCTGG - Intergenic
1103919292 12:124391038-124391060 ATGACGAGCTGTTCTTGTGGGGG + Intronic
1109345844 13:61113723-61113745 TGCCCAAGCTGTTCATGTGGAGG - Intergenic
1111148931 13:84222525-84222547 AGGGCATGCTGTTCTGGTGATGG + Intergenic
1118859036 14:69647497-69647519 AGGCAAAGCTTTTCTGCTGGGGG + Intronic
1119804783 14:77475589-77475611 AGGCCAAGGAGTACTAGTGACGG - Exonic
1121191670 14:92036231-92036253 AGGCCAAGTTTTTCTTGTTGGGG - Intronic
1133565777 16:6992043-6992065 AGGCCAATATTTTCTAGAGGTGG - Intronic
1134793421 16:17012163-17012185 AGACCAAGGTGTTCTAATGAAGG + Intergenic
1140094055 16:71860192-71860214 AGGCCAAGCGGCTCAAGAGGAGG - Exonic
1147014811 17:37483172-37483194 AGGCCAAGATTTTCTTGTTGGGG - Intergenic
1148002313 17:44397099-44397121 AGGCCAAGCTGTTCTAGTGGTGG - Intronic
1148793374 17:50185900-50185922 AGGCCACGCTGTTCTTGCAGTGG + Exonic
1157225341 18:45858032-45858054 AGGCAAAGCTGTTTTTGTGGTGG - Exonic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1161575533 19:5052492-5052514 AAGCCAGGCTGTTCTTGGGGTGG + Intronic
1161606382 19:5217036-5217058 AGGCCAGGCTGGTCTGGGGGAGG - Intronic
1161849356 19:6730755-6730777 AGGCCAGGCTGAGCTAGGGGTGG - Intronic
1163015682 19:14452597-14452619 AGTCCTAGCTGTTCTAGAGGTGG + Intronic
1165104845 19:33462657-33462679 ACGGCAAGCTGTTTTACTGGCGG + Intronic
1167362667 19:49038578-49038600 AGGCCAAGCAGTCCTATGGGCGG - Intergenic
932381252 2:71285356-71285378 AGGCCAAGCTGCTACAGTGAAGG - Intronic
935268929 2:101416972-101416994 AGGTCAAGGTGTTCTAGGTGTGG - Intronic
935340357 2:102053974-102053996 AGTCCAAGCTATTCTAGCTGGGG + Intergenic
938482166 2:131671773-131671795 GGGCCCAGCTCTTCTAGTGCAGG - Intergenic
945414599 2:209555389-209555411 AGGGGAAGCTGTTTTAATGGAGG + Intronic
945879943 2:215314789-215314811 AGGCCAAGATTTTGTAGGGGTGG + Intronic
1175701475 20:61140804-61140826 TGGCCAGGCTGGTCTAGGGGAGG + Intergenic
1175838536 20:62012001-62012023 AGGCCAGGCTGTTCTGGAAGGGG - Intronic
1182110856 22:27722266-27722288 GAGCCAAGCTGTCCTAGTTGAGG - Intergenic
1184265906 22:43345826-43345848 ATGCCAAGCTGGGATAGTGGAGG + Intergenic
1184708451 22:46232323-46232345 AGCCTGAGCTGTTCCAGTGGAGG + Intronic
950431062 3:12951525-12951547 AGGGGAGGCTGTTCTAGTGCCGG + Intronic
961404130 3:126666912-126666934 AGGGCAAGCTGTGCTGCTGGGGG + Intergenic
964845410 3:161039441-161039463 ATCCGAAGCTGTTCTAGTGTTGG + Intronic
968489974 4:884738-884760 TGGCCAAGCTGTTCTTGTGAGGG + Intronic
968857790 4:3140543-3140565 AGGACAAGCTGATCCAGTAGTGG + Exonic
969611061 4:8228052-8228074 GGGCCAAGCTGGTGTAGAGGGGG - Exonic
972124024 4:35741066-35741088 AGAGGAAGCTGTTCTAGGGGAGG - Intergenic
978113668 4:104993250-104993272 AGGCTGAGGTGTTCCAGTGGTGG - Intergenic
978622660 4:110649667-110649689 ACGCCAAGATGTTCTTGGGGAGG - Intergenic
979352232 4:119657545-119657567 AGGCCAAGCATTTCAAGTTGTGG - Intergenic
980222013 4:129929899-129929921 AGGCCAAACTGGTCTAGGGAAGG + Intergenic
980481482 4:133394061-133394083 TAGCCAAGCTGTTCTATTTGGGG + Intergenic
982285121 4:153726000-153726022 AGGCCAAGCTTTCCTTTTGGAGG - Intronic
983599420 4:169508794-169508816 AGGCCCAGCTCTTCAAGAGGAGG - Exonic
988395983 5:30698514-30698536 TGTCCCAGCTGCTCTAGTGGTGG + Intergenic
988930062 5:36028695-36028717 AGGACATCCTGTTCTAGAGGTGG - Intergenic
989765541 5:45078366-45078388 AGTCCCAGCTATTCTGGTGGTGG - Intergenic
990247751 5:53880077-53880099 AGACAAGGCTGTTCTAGAGGAGG + Intergenic
993976448 5:94488235-94488257 AGGCCAGGTTGTCTTAGTGGGGG - Intronic
1003380473 6:5620407-5620429 AGGAGGAGGTGTTCTAGTGGGGG + Intronic
1007065203 6:38983875-38983897 ATGCCAAGCTGTTACAGAGGAGG - Intronic
1010392937 6:75357501-75357523 TGGTCAAGCTGTGCTAGTGTTGG - Intronic
1016304672 6:142671210-142671232 CTCCCATGCTGTTCTAGTGGTGG + Intergenic
1025104117 7:56156873-56156895 AGGGGAAGCTGTTCAAGAGGAGG - Intergenic
1030440006 7:109577418-109577440 AGGACATTCTTTTCTAGTGGAGG - Intergenic
1033532968 7:142284656-142284678 AGCCCAAGATGTTTTAGTTGGGG + Intergenic
1040500066 8:47997842-47997864 GGGTCATGCTGTTCTGGTGGAGG + Intergenic
1041010320 8:53535878-53535900 AGCCCAAGTTGTTCTAAAGGTGG - Intergenic
1045421163 8:102016383-102016405 AGGCAGAGCTGTGGTAGTGGTGG - Intronic
1060587398 9:124795154-124795176 AGGCCAGGCTGCTCTGGTGCTGG + Intronic
1195036430 X:100974163-100974185 TGGCAAAACTGTTCTTGTGGAGG + Exonic
1198228197 X:134665920-134665942 AGGTCATGCTGTTCTTGAGGTGG - Intronic
1199299619 X:146197706-146197728 AGGCCAAGGTGTTCTCCTGGTGG + Intergenic