ID: 1148002861

View in Genome Browser
Species Human (GRCh38)
Location 17:44400133-44400155
Sequence GCCTGAACAAGCAGGAGCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148002861_1148002869 25 Left 1148002861 17:44400133-44400155 CCCAGGCTCCTGCTTGTTCAGGC 0: 1
1: 0
2: 0
3: 12
4: 238
Right 1148002869 17:44400181-44400203 TGCGTCCATTCTGCCTCCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 151
1148002861_1148002866 2 Left 1148002861 17:44400133-44400155 CCCAGGCTCCTGCTTGTTCAGGC 0: 1
1: 0
2: 0
3: 12
4: 238
Right 1148002866 17:44400158-44400180 CTACAGGCAGACCCTGAAGCAGG 0: 1
1: 0
2: 1
3: 20
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148002861 Original CRISPR GCCTGAACAAGCAGGAGCCT GGG (reversed) Exonic