ID: 1148003064

View in Genome Browser
Species Human (GRCh38)
Location 17:44401656-44401678
Sequence GCTGGCCCTGGGAATTTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148003064_1148003072 27 Left 1148003064 17:44401656-44401678 CCTACCAAATTCCCAGGGCCAGC 0: 1
1: 0
2: 1
3: 11
4: 209
Right 1148003072 17:44401706-44401728 TGTCTAAAGTACAAAAAGCTGGG 0: 1
1: 0
2: 1
3: 21
4: 313
1148003064_1148003071 26 Left 1148003064 17:44401656-44401678 CCTACCAAATTCCCAGGGCCAGC 0: 1
1: 0
2: 1
3: 11
4: 209
Right 1148003071 17:44401705-44401727 CTGTCTAAAGTACAAAAAGCTGG 0: 1
1: 0
2: 1
3: 19
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148003064 Original CRISPR GCTGGCCCTGGGAATTTGGT AGG (reversed) Intronic
900091332 1:922033-922055 GCTGGCCCTGGGTTTCTGGCTGG - Intergenic
901397198 1:8990029-8990051 GCTGTCCCCGGGAGGTTGGTGGG + Intergenic
902225518 1:14994142-14994164 GCAGGGCCTGTGAATTGGGTCGG + Intronic
902236574 1:15061418-15061440 GCTGGCCCGGGGACTTTAGATGG + Intronic
903140368 1:21335505-21335527 CCTGGCTCTGGGACTTTGGGCGG - Intronic
903604076 1:24562193-24562215 GCTGTTACTGGGAATTAGGTAGG - Intronic
904312780 1:29640100-29640122 TCGGGCCCTGGGAAGCTGGTGGG + Intergenic
904314806 1:29653236-29653258 GCAGGCCATGGGACCTTGGTTGG + Intergenic
905111192 1:35595666-35595688 GCAGGGCCTGGGAATTGGGCAGG + Intergenic
905733647 1:40312305-40312327 GCTGGCCCTGGGTCTCTGGCAGG + Intronic
906568698 1:46818374-46818396 CCTGTCCCTGGGAAGTGGGTGGG + Intronic
907883051 1:58569320-58569342 GCTGGAGATGGGAATTTGGGAGG - Intergenic
908452732 1:64271977-64271999 TCTGGACCTGGGGGTTTGGTGGG + Intergenic
910368806 1:86494359-86494381 ACTGGCCCTGAGAATTGGGGAGG - Exonic
915840580 1:159209552-159209574 ACTGGCTCTGGAAAATTGGTTGG + Intergenic
917237784 1:172913108-172913130 GCTGGGTCTGGGGATTTTGTGGG + Intergenic
920178962 1:204120812-204120834 GCTGGGCCTGGGAGTGAGGTAGG + Intronic
920567568 1:206987200-206987222 GCTGTCTCTGGGAATTGGTTTGG - Intergenic
922563098 1:226583159-226583181 GCTGGCCCTGGGACTTTCCTTGG - Intronic
922614233 1:226951643-226951665 GCTGTCCCAGGAAATTTGGAAGG - Intronic
1067163687 10:43848128-43848150 GCTGGTCCTGGGGATTTGCGTGG - Intergenic
1070890671 10:79940524-79940546 GCTGGACCTGGGACTGTGGCAGG - Intronic
1072255987 10:93620790-93620812 GCTAACCCTGGGCATCTGGTTGG + Intronic
1072416233 10:95249086-95249108 GCCGGGCCTGGGAATGTGATGGG - Intronic
1074885517 10:117690004-117690026 GCTGCCCCTGGTAATTTGCAAGG - Intergenic
1075076221 10:119352415-119352437 GCTGGCCCTGGTTATTAGGGAGG + Intronic
1075298191 10:121296623-121296645 AATGGCCCAGGGAATTTTGTGGG - Intergenic
1077439566 11:2561747-2561769 GGTGGCACTGGGAGTATGGTGGG - Intronic
1078141862 11:8699046-8699068 GCTGACCCTGGGAACCTGGGAGG - Intronic
1079011080 11:16828822-16828844 GTTAGCCCTGGGACTTGGGTTGG + Intronic
1079840247 11:25388147-25388169 GCTGGCCCTGTGACTTGTGTTGG - Intergenic
1081634571 11:44712255-44712277 GGTGGCCCTGGCTATTCGGTGGG + Intergenic
1082097419 11:48142666-48142688 GCCTGCCCTGGGGATTTGGCTGG + Intronic
1083733373 11:64665703-64665725 GCTGGGCCTGTGAGTTTGGGTGG - Intronic
1083827359 11:65211181-65211203 GCTGGACCTGGGGTTTGGGTGGG + Intronic
1083923676 11:65793553-65793575 GCTGGCCTTGGGGGTTTGGGTGG - Intronic
1084499335 11:69525550-69525572 GCTGGCTCTGAGGATGTGGTGGG - Intergenic
1085604815 11:77887563-77887585 GCTGGCCAGGGCAATTAGGTAGG + Intronic
1085878593 11:80438737-80438759 GCAGGCACTGGGAATTTGGCAGG + Intergenic
1086017914 11:82189683-82189705 GATGGCCCTGGGAATGGGGCAGG - Intergenic
1088685957 11:112284792-112284814 CCTGGCCCTGTGAAGCTGGTGGG + Intergenic
1094054508 12:26255824-26255846 CCTTCCCCTGGGAATTTGGTAGG - Intronic
1096499779 12:52057600-52057622 ACTGTCCCAGGGAGTTTGGTGGG + Intronic
1096995094 12:55833375-55833397 GCTGGCACTGGGGAGTTGGCTGG + Intergenic
1100483945 12:95006594-95006616 AATGGCCCTGGGATTTTGATAGG + Intergenic
1102184757 12:110939159-110939181 GCAAGCCCTGGCAATGTGGTAGG - Intergenic
1104405191 12:128511081-128511103 GCTGGCCCTGGCATTTGGGTGGG + Intronic
1105781566 13:23709276-23709298 GCTGGCCCTGTGGCTTTGCTGGG + Intergenic
1105998753 13:25699203-25699225 ACTGACCTTGGGAATTTGCTGGG + Exonic
1107891955 13:44921692-44921714 GCTGGCCTTGGGATTGAGGTCGG - Intergenic
1108997498 13:56752818-56752840 GCTCCACCTGGGAATTTGTTAGG - Intergenic
1113681215 13:112246253-112246275 GCTGGCCCTGGAAAAGTGGGTGG - Intergenic
1114431693 14:22666934-22666956 GCTGACCTAGGGTATTTGGTGGG - Intergenic
1117156820 14:52950635-52950657 GCCGGCGCTGCGAATTCGGTGGG - Intronic
1117157121 14:52951550-52951572 CCTTGCCCTGGGAATTTCCTGGG - Intronic
1118320890 14:64752797-64752819 GCTGTCCCTGGGAATATGGCTGG + Intronic
1118775089 14:68968915-68968937 GCTGGCCCTGGGACTGTTCTGGG - Intronic
1119211616 14:72836290-72836312 GGTTGCCCTGGGAGTTTGGCAGG - Intronic
1120962030 14:90133952-90133974 GTAGGCCCTGGGAATATGGATGG - Intronic
1121266865 14:92609520-92609542 GCTGGAGCTGGCAATTTTGTTGG + Intronic
1121275161 14:92662369-92662391 GCTGGCCCTGGGACCCTGGGGGG + Intronic
1123710032 15:22980316-22980338 GCGGGCCCTGGGAGTTTCCTTGG + Exonic
1125308013 15:38344328-38344350 GCAGGCCCTGGGAATTTATTTGG + Intronic
1126787153 15:52186605-52186627 TGTGGCCCTGTCAATTTGGTAGG + Intronic
1128008571 15:64269303-64269325 TCTGGTCCTGGGTTTTTGGTTGG + Intronic
1128058404 15:64718002-64718024 CCTGGAGCTGGGAAGTTGGTGGG - Intergenic
1129230160 15:74192622-74192644 GCTGGCCCAGGGAAGGTGGAGGG - Intronic
1130608721 15:85341056-85341078 GGTGAACCTGGGAATATGGTGGG + Intergenic
1131264524 15:90907710-90907732 GCTGGCCCTGGCAGTTTGTTAGG - Intronic
1132558026 16:580994-581016 GCTGGCCCTGGGTAGGTGGAGGG + Intronic
1132725316 16:1335874-1335896 GCTGGCTCTGGGACCTTGGGCGG + Intronic
1135274136 16:21096723-21096745 ACTGGCTCAGGCAATTTGGTTGG - Intronic
1135685738 16:24497110-24497132 GCCTCCCCTGGGAATGTGGTAGG - Intergenic
1136233454 16:28901071-28901093 GCTGGGCCTGGCACTTTGGGAGG + Intronic
1136496511 16:30648377-30648399 CCTGGACCTGAGTATTTGGTAGG - Intergenic
1136716870 16:32288683-32288705 GGCGGCCCTGGGCACTTGGTGGG - Intergenic
1136835246 16:33494928-33494950 GGCGGCCCTGGGCACTTGGTGGG - Intergenic
1139674980 16:68517433-68517455 GCCAGCTCTGGGAATGTGGTGGG + Intergenic
1140804523 16:78520750-78520772 TCTGGCCCTGGGATTTAGGGAGG - Intronic
1142142712 16:88479706-88479728 GCTGGCCCTGGGTAGCAGGTGGG - Intronic
1203009557 16_KI270728v1_random:229104-229126 GGCGGCCCTGGGCACTTGGTGGG + Intergenic
1203145418 16_KI270728v1_random:1795249-1795271 GGCGGCCCTGGGCACTTGGTGGG - Intergenic
1143741643 17:8958634-8958656 CCTGTCCCTGGGAACTTGGGAGG + Intronic
1146055195 17:29577499-29577521 GCTGGCACTGGGATTTGGGAAGG - Intronic
1148003064 17:44401656-44401678 GCTGGCCCTGGGAATTTGGTAGG - Intronic
1148910756 17:50941277-50941299 GCTGGCTGAGGGAAATTGGTTGG + Intergenic
1149134960 17:53353608-53353630 GCTGGCCCTGGTGCTTGGGTAGG + Intergenic
1151805201 17:76400713-76400735 ACTGGTCCTGGGCATTGGGTGGG - Intronic
1152984117 18:306572-306594 GCTGGCCTTGGGAATGTGAAAGG + Intergenic
1154870937 18:20083197-20083219 GCTAGCCTTGAGAATTTCGTTGG + Intergenic
1156445527 18:37233839-37233861 GCTGCCCCTGGGGATGGGGTGGG + Intergenic
1157733328 18:50023733-50023755 GCAGGCCCTGGGGCTGTGGTAGG + Intronic
1160357923 18:78244401-78244423 ACTGGCCTTGGGGGTTTGGTTGG - Intergenic
1161043094 19:2120527-2120549 GCTGGCCCTGGGCATCTGCAAGG - Intronic
1161768063 19:6217583-6217605 GCTGGCCCTGGGGAGCGGGTGGG + Intronic
1161818738 19:6516320-6516342 GCTGGGCCTGGGAGTCTGCTGGG + Intergenic
1162621325 19:11846787-11846809 GTTTCCCCAGGGAATTTGGTGGG + Intergenic
1162933695 19:13969948-13969970 GCAGTCCCTGGGGAATTGGTGGG - Intronic
1163602672 19:18258250-18258272 GCTGGCCCCGGGAGTTCGGAGGG - Intronic
1164500425 19:28815008-28815030 CCTGCCCCTGGGACTTTGCTGGG + Intergenic
1164687724 19:30179265-30179287 GCTAGCCCTGGGGAAGTGGTAGG + Intergenic
1167888514 19:52521623-52521645 GCAGCCCCTGGGAATGTGCTCGG - Intergenic
1168706938 19:58475769-58475791 GCTGGCCCGGGGAATGGCGTGGG + Intronic
925342368 2:3146383-3146405 GCTCGCCCTGGGGAGGTGGTGGG + Intergenic
925800894 2:7599331-7599353 GCTGGCCCTATCAATTAGGTTGG + Intergenic
926717814 2:15939073-15939095 CCTGGCCCTGGGATTGGGGTGGG - Intergenic
928494696 2:31819999-31820021 TCTGCCCCTGTGAATTTGGAGGG + Intergenic
934334122 2:92107808-92107830 GCTGGCTCTGAGGATTTCGTTGG + Intergenic
934334451 2:92112576-92112598 GCTGGCTCTGAGGATTTCGTTGG + Intergenic
934335219 2:92124321-92124343 GCTGGCCTTGAGGATTTCGTTGG + Intergenic
934335433 2:92127546-92127568 GCTGGCCTTGAGGATTTCGTTGG + Intergenic
934405412 2:93297843-93297865 GCTGGCCTTGAGGATTTCGTTGG + Intergenic
936008513 2:108910206-108910228 GAAGGCCCAGGGAATTTGGCAGG + Intronic
936061239 2:109297028-109297050 CCTGGCCCTGGGTATTTGGTGGG + Intronic
937094164 2:119224675-119224697 GGTGGCCCTGGATATTTGGGAGG - Intronic
937229238 2:120387892-120387914 TCTGACCCTGGGCATGTGGTTGG + Intergenic
938315471 2:130323958-130323980 TCTGGTCCTGGGCTTTTGGTAGG + Intergenic
941714860 2:168753259-168753281 GCTGTGCCTGGGAATATGGGTGG - Intronic
942302439 2:174574876-174574898 GCTGGCCCTGGAAATCTGCCTGG - Intronic
943449004 2:188024929-188024951 GCTGGCTCTGTGAATATGATGGG + Intergenic
944212201 2:197218263-197218285 CCTGCTCCTGGGAATTTGGAAGG - Intronic
948600640 2:239105856-239105878 GCTGGCACTGGAAGTCTGGTGGG + Intronic
948786752 2:240356682-240356704 GCTGGCTCTTGGAATTCGGTGGG - Intergenic
1168937539 20:1679341-1679363 GCTGTACCTGGTCATTTGGTAGG - Intergenic
1170605173 20:17870231-17870253 GCTGGCCGTGGGAAGCTGGGAGG - Intergenic
1171578853 20:26373622-26373644 GCTGGCTCTGAGGATTTCGTTGG + Intergenic
1171682445 20:27972940-27972962 GCTGGCTCTGAGGATTTCGTTGG + Intergenic
1174535263 20:51246518-51246540 GCTGGCCCCTTGAATTTGGCTGG + Intergenic
1175270044 20:57727377-57727399 GCTGGCTGTGGGAAGTTGCTGGG - Intergenic
1175829365 20:61953644-61953666 GCTGGCCCTGGGCTTGTGCTTGG - Intronic
1178871973 21:36385062-36385084 GCTGGCGCTGGGCACTTGGAGGG - Intronic
1179625059 21:42644635-42644657 GCCGGCCCTGGGAGAGTGGTGGG - Intergenic
1179791205 21:43757051-43757073 CTTGCCCCTGGGCATTTGGTGGG - Exonic
1181571230 22:23768590-23768612 GCCGGCCCGGGGAATCCGGTGGG - Intronic
1183709039 22:39491710-39491732 GCATACACTGGGAATTTGGTGGG + Exonic
1202715958 2_KI270715v1_random:2163-2185 GCTGGCTCTGAGGATTTCGTTGG + Intergenic
1202716287 2_KI270715v1_random:6931-6953 GCTGGCTCTGAGGATTTCGTTGG + Intergenic
1202716665 2_KI270715v1_random:12383-12405 GCTGGCTCTGAGGATTTCGTTGG + Intergenic
1202717325 2_KI270715v1_random:22258-22280 GCTGGCCTTGAGGATTTCGTTGG + Intergenic
1202718215 2_KI270715v1_random:36011-36033 GCTGGCCTTGAGGATTTCGTTGG + Intergenic
1202718705 2_KI270715v1_random:43654-43676 GCTGGCCTTGAGGATTTCGTTGG + Intergenic
1202728651 2_KI270716v1_random:36122-36144 GCTGGCTCTGAGGATTTCGTTGG + Intergenic
1202728980 2_KI270716v1_random:40890-40912 GCTGGCTCTGAGGATTTCGTTGG + Intergenic
1202729641 2_KI270716v1_random:50766-50788 GCTGGCCTTGAGGATTTCGTTGG + Intergenic
950170656 3:10837083-10837105 GCTGGCCCTGGGGTTGGGGTGGG + Intronic
950187968 3:10957118-10957140 GCTGGCCCTGGAAATTATCTGGG - Intergenic
954210337 3:49093708-49093730 GGTGGCCCGGGGATTTGGGTGGG - Intronic
955308561 3:57860136-57860158 GCTGGCCGTGGCACTTTGGGAGG - Intronic
955664454 3:61335597-61335619 GCTGGCCATGGAAATTGGATGGG - Intergenic
955905024 3:63797855-63797877 CCTGGCCCTGGAATTTAGGTAGG + Intergenic
958618011 3:96521055-96521077 TGTGGGCCTGGGATTTTGGTAGG + Intergenic
961393818 3:126572206-126572228 CCTGGCCCTGGGAAAGTGGAGGG - Exonic
961532954 3:127551080-127551102 GCTGGCCATGGGGACTTGCTGGG - Intergenic
961638346 3:128349144-128349166 CCTGGCCCTGGGCATCTGGGAGG + Intronic
964499692 3:157335147-157335169 GTTGGCACTGGGAAATTGGGAGG + Intronic
969618963 4:8269591-8269613 GCAGGCCTTGGGACTCTGGTCGG - Intergenic
972244241 4:37227609-37227631 CCTTTCCCTGGGAATTTGGGTGG - Intergenic
973472299 4:50832174-50832196 GATGGCTCTGAGAATTTCGTTGG + Intergenic
978985279 4:115004572-115004594 GCTGGCCCTGAGCATGAGGTTGG + Intronic
980744709 4:136999508-136999530 CCCCACCCTGGGAATTTGGTAGG + Intergenic
981035588 4:140165227-140165249 GCTCCCTCTGGGAATTTTGTTGG + Intergenic
981901933 4:149876180-149876202 GGTGTCACTGGGAATTAGGTAGG - Intergenic
982315793 4:154030465-154030487 TCAGGGCCTGGGCATTTGGTAGG + Intergenic
987834752 5:23146454-23146476 CCTACCCCTGGGAGTTTGGTAGG + Intergenic
988723652 5:33903808-33903830 GAAAGCCCTGTGAATTTGGTGGG - Intergenic
989091997 5:37743403-37743425 CCTTCCCCTGGGAATTCGGTAGG - Intronic
989176083 5:38527951-38527973 GCTGGGGCTGGGTAGTTGGTGGG - Intronic
989665559 5:43850040-43850062 GCTGGCCCAGAAAGTTTGGTAGG - Intergenic
992067110 5:73119242-73119264 TCTTGCCATTGGAATTTGGTGGG - Intergenic
993355256 5:86898537-86898559 GCTGGACCTGTGAATATGGAGGG - Intergenic
995910366 5:117179650-117179672 CCTGACCCTGGGCACTTGGTGGG - Intergenic
1000728972 5:164807199-164807221 GCTGTTCCTGGGCATTTTGTGGG + Intergenic
1001178470 5:169495445-169495467 GCTGGGTCTTGGAATTTGGAGGG - Intergenic
1003133967 6:3418744-3418766 GCTGGGCCTGGGAATCCAGTTGG - Intronic
1005968142 6:30742048-30742070 TCTGGTGCTGGGAAGTTGGTAGG + Intronic
1006813118 6:36833399-36833421 GCGGGACCTGGGAATATGATAGG + Intronic
1006949286 6:37808329-37808351 ACGGGCCATTGGAATTTGGTGGG - Intergenic
1007943099 6:45800458-45800480 GCTGTCCCTGGGAAGGTGGCAGG - Intergenic
1009524087 6:64721094-64721116 TCTGGGCCTGGGGATTTAGTAGG + Intronic
1012005959 6:93713603-93713625 TCTGGTCCTGGGCATTTTGTGGG + Intergenic
1012082752 6:94782067-94782089 TCTGGTCCTGGGCTTTTGGTTGG + Intergenic
1015482524 6:133728452-133728474 TCTGGTCCTGAGAATTTGGGAGG + Intergenic
1016168698 6:140980202-140980224 GAGGGCTTTGGGAATTTGGTAGG + Intergenic
1018871729 6:167789429-167789451 GCTTCCCCTGGGAATTTGCAGGG - Intronic
1020357556 7:7293589-7293611 GTTCGCCTTGGGATTTTGGTAGG - Intergenic
1021926535 7:25539653-25539675 GCTGCTCCTGAGAATTTGGCTGG - Intergenic
1022238741 7:28488527-28488549 GATGGCCCTGCATATTTGGTGGG - Intronic
1022466342 7:30655317-30655339 CCTGTCCCAGGGCATTTGGTTGG + Intronic
1022530613 7:31064750-31064772 ACTGCCCCTGGGGCTTTGGTAGG + Intronic
1023736302 7:43238828-43238850 GAGGGGCCTGGGAATTTGGAAGG + Intronic
1023889633 7:44382952-44382974 TCTGGCCCTGGGAGTATGCTAGG + Exonic
1025300822 7:57818739-57818761 GCTGGCCCTGGGGAAGGGGTTGG + Intergenic
1029399923 7:100337581-100337603 TCGGGCCCTGGGATGTTGGTGGG - Intronic
1029536437 7:101160328-101160350 GCTGGCCCTGGGAGGCTGGTGGG + Intronic
1031858088 7:126946072-126946094 GCTGGCCCTGTGAGTTGGTTTGG + Intronic
1033458953 7:141528066-141528088 GCTGGGACAGGGAATTAGGTGGG + Intergenic
1034179440 7:149126267-149126289 GCTGTACCTGGGAGTTGGGTTGG - Exonic
1034758259 7:153644237-153644259 GGGAGCCCTTGGAATTTGGTGGG - Intergenic
1037386874 8:18352290-18352312 GGTGGCACTGGGATTTTGCTTGG - Intergenic
1037647304 8:20804140-20804162 GCTGGGCAGGGGAATCTGGTGGG + Intergenic
1037887484 8:22602465-22602487 GCTGTCTCTGGGAGCTTGGTCGG + Intronic
1038417327 8:27406660-27406682 GCTGGGGCTTGGCATTTGGTGGG + Intronic
1041146306 8:54880126-54880148 TCTGACCCTGGGCATTTGGCTGG + Intergenic
1041713734 8:60914998-60915020 ACGGGCCCTGGGAAGTTGATTGG + Intergenic
1045038109 8:98193327-98193349 GCTGGCCATGGAAATCAGGTGGG + Intronic
1045511364 8:102814450-102814472 GCTGGCAGTGGGGATTTGGGAGG - Intergenic
1049274431 8:141712751-141712773 GGTGGCCCTGGGGGTTGGGTGGG + Intergenic
1051210770 9:14740168-14740190 GGTGGCTCTGGGACATTGGTGGG - Exonic
1053793005 9:41699932-41699954 GCTGGGCCTGGGGATGGGGTTGG - Intergenic
1054152170 9:61614892-61614914 GCTGGGCCTGGGGATGGGGTTGG + Intergenic
1054181414 9:61911953-61911975 GCTGGGCCTGGGGATGGGGTTGG - Intergenic
1054471944 9:65546036-65546058 GCTGGGCCTGGGGATGGGGTTGG + Intergenic
1059046568 9:110875342-110875364 CCTTGCCCTGGCAATTGGGTAGG + Exonic
1061667785 9:132170412-132170434 GCAGGCCCTGGGAATGTGGGTGG - Intronic
1062088451 9:134661155-134661177 GGTGGCCTGGGGAGTTTGGTTGG + Intronic
1062255569 9:135619203-135619225 GCTGGCCCTTGGCTGTTGGTTGG - Intergenic
1187501283 X:19841118-19841140 GCTGGCCCTGAGAAGCTGCTAGG - Intronic
1193185807 X:78510997-78511019 TCTTGCCCTGGAAATTTTGTGGG - Intergenic
1196513704 X:116545695-116545717 GCTGGCCTTTGGAATTTGGGGGG + Intergenic
1196828382 X:119758420-119758442 GCTTGCCCTGGGGACTTGGCTGG + Intergenic
1200763901 Y:7064158-7064180 GCAGGCTCTGGAAGTTTGGTGGG + Intronic
1201010571 Y:9546207-9546229 GCTCTCCATGGGAATTGGGTGGG + Intergenic