ID: 1148006591

View in Genome Browser
Species Human (GRCh38)
Location 17:44436117-44436139
Sequence TGCCTTTGTAGAATTGGGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 235}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148006591 Original CRISPR TGCCTTTGTAGAATTGGGTA CGG (reversed) Intronic
904495533 1:30884373-30884395 TGCCTTTGTAGATGGGAGTAGGG - Intronic
906421648 1:45673457-45673479 GGCATTTGGGGAATTGGGTATGG - Intronic
908070815 1:60457531-60457553 TGCCATTCTAGAAATGTGTAAGG + Intergenic
908325330 1:63017961-63017983 AGCCTTTGGAAACTTGGGTAGGG - Intergenic
909243360 1:73243623-73243645 TGCCTTCATAGAATGAGGTATGG - Intergenic
910836105 1:91513061-91513083 TGCCTTGGTAGACTTTGGTTTGG + Exonic
911857295 1:102895524-102895546 AGCCTGTGTAGATTTGGATATGG + Intronic
912618532 1:111132126-111132148 TGCCTTCCTGGAATTGGGGATGG - Intronic
912891487 1:113537163-113537185 TGCATTGGTAGTAGTGGGTAAGG + Intronic
914734786 1:150405090-150405112 TTCCTTTGGAGGATTTGGTATGG + Intronic
917214048 1:172659477-172659499 TGCCTTGGTAGGATTGGGCCTGG + Exonic
918145478 1:181752309-181752331 TGCCTTTGGAGAATTTGTTCTGG + Intronic
918507624 1:185273853-185273875 TGTATTTGTAGAACTGGGCATGG + Intronic
918655226 1:187017471-187017493 TGGCTTTGTAGAATGAGTTAGGG - Intergenic
918655568 1:187021787-187021809 TGGCTTCGTAGAATGAGGTAGGG - Intergenic
920443869 1:206001043-206001065 TGCCCTTCTAGGATAGGGTAGGG - Intronic
920892002 1:209996592-209996614 TGGCTTTGTAGAATGAGTTAGGG - Intronic
921426055 1:215002383-215002405 TACCTTTGTGGAAATGGGTTTGG - Intergenic
922368722 1:224889105-224889127 TGGCTTTGTAGAAGGGGTTAGGG - Intergenic
923834660 1:237596982-237597004 TGCCTTAGAAGAAATGCGTAAGG + Intronic
924030385 1:239880074-239880096 TGTCTTTGGAGAGTTGGGTTTGG - Intronic
1063832822 10:9975570-9975592 TGGCTTTGTAGAATTAGTTCTGG - Intergenic
1065260194 10:23915809-23915831 TACCTTTGTAGAATTGCCTGTGG + Intronic
1066804523 10:39232361-39232383 TGCCTTTGTAGAATCTGCAATGG + Intergenic
1068146898 10:53083224-53083246 TGGCTTTGTAGAATGAGTTAGGG + Intergenic
1069068210 10:63967916-63967938 TGGCTTTGTAGAATGAGTTAGGG - Intergenic
1071495074 10:86162558-86162580 TGGATTTGCAGAATTGGGAATGG - Intronic
1075201861 10:120411236-120411258 TGCATTTCAAGAATTGGGGAAGG + Intergenic
1075928267 10:126271048-126271070 GGCCCTTGTAGAACTGGGCATGG - Intronic
1077288157 11:1776730-1776752 TGGCTTTGAAGATGTGGGTAGGG - Intergenic
1078896006 11:15597805-15597827 TGCCTTTGTTGAATTGGGAGGGG - Intergenic
1079109248 11:17595081-17595103 AGCCTATGTAGACTGGGGTAAGG + Intronic
1079297746 11:19248798-19248820 TGGCTTTGTAGAATGAGTTAGGG - Intergenic
1079525123 11:21377551-21377573 TGTCTTTGTAGAATGAGTTAGGG + Intronic
1079562052 11:21833917-21833939 CCCCTTTGTATAATTGGGTTTGG - Intergenic
1079797319 11:24822037-24822059 GGCCTTTGAATAATTGGGTTAGG + Intronic
1080056204 11:27909199-27909221 TGTCTTTGTGGGATTGGGAAGGG + Intergenic
1080667874 11:34351582-34351604 TGCCTTGGTAGAAATGGGGACGG + Intronic
1081279381 11:41189433-41189455 TGTGTTTGTAGAGCTGGGTAAGG + Intronic
1081388274 11:42499043-42499065 TTCCATTGTAGAGTTGCGTAAGG + Intergenic
1085336015 11:75696390-75696412 TGGCTTTGTAGAATTAGTTATGG + Intergenic
1086196884 11:84151114-84151136 TGGCTTTGTAGAATGGGTTAGGG + Intronic
1086568499 11:88255324-88255346 TGGCTTTGTAGAATTAGTTAGGG - Intergenic
1086599157 11:88611221-88611243 TGGCTTTGTAGAATGAGTTAGGG + Intronic
1086928842 11:92670372-92670394 TGATTTTGTATAATTGGATAGGG - Intronic
1087561808 11:99799752-99799774 TGCCTTTGTAGAATGAGTTAGGG + Intronic
1091483897 12:864983-865005 TGACTTTGTGGAATTGGGAGAGG + Intronic
1093383570 12:18523578-18523600 TTCATTTCTAGGATTGGGTAGGG + Intronic
1094859134 12:34440283-34440305 TGTTTTTGTAGAATTGCGAAGGG - Intergenic
1095073683 12:37890898-37890920 TGCTTTTGTAGAATCTGCTATGG - Intergenic
1095759450 12:45812514-45812536 TGCTTTTGTATAATTGGGGTAGG + Intronic
1096059126 12:48681775-48681797 TGCCTGTGGAGACTTGGGGAGGG - Intronic
1096774999 12:53958181-53958203 TGCCTTTGGAGAGTTTGTTAGGG - Exonic
1098406868 12:70135869-70135891 TGGCTTTGTAGAATGAGTTAGGG - Intergenic
1098730048 12:74024651-74024673 TGACTATATAGAATTGGGTATGG + Intergenic
1099009519 12:77275543-77275565 TGCTTTTGTAGTACTAGGTACGG - Intergenic
1099163979 12:79279144-79279166 TGGCTTTGTAGAATGAGTTAGGG - Intronic
1101073982 12:101109123-101109145 TGCGTTTGCACAATTGGGTTGGG + Intronic
1101094791 12:101327070-101327092 TGCCTTTTCAGAATTTTGTATGG + Exonic
1103790260 12:123465312-123465334 GGCATTTGTAGGAGTGGGTAAGG + Intronic
1107307107 13:39034426-39034448 TTTCTTTGTAGAAGTTGGTAGGG - Intronic
1107354457 13:39551820-39551842 TGACTTTGAAGAATTGAGTGAGG - Intronic
1109120986 13:58456968-58456990 TGGCTTTGTAGAATTATGTAGGG - Intergenic
1109817608 13:67606097-67606119 TGTCTTTGTAGAATGAGTTAGGG + Intergenic
1109905941 13:68841932-68841954 TGGCTTTGTAGAATGAGTTAGGG - Intergenic
1110488588 13:76075287-76075309 TGACTTTGTAGAATGAGTTAGGG - Intergenic
1111331394 13:86764323-86764345 TGAGTTTGTAAGATTGGGTAAGG + Intergenic
1114151563 14:20045880-20045902 TGCTGTTGTACAGTTGGGTAGGG + Intergenic
1114237384 14:20834803-20834825 TGCCTTTGTACCAGTGGGTTGGG + Intergenic
1114730984 14:24992334-24992356 TGCCTTTGCAGCATTGGTCATGG - Intronic
1115329247 14:32176864-32176886 TGGCTTTGTAGAATTAGTTAGGG + Intergenic
1116202859 14:41821635-41821657 GAGCTTTGTAGAATGGGGTATGG + Intronic
1116282078 14:42921668-42921690 TTCCTTTGTAGTATTGGGTTTGG + Intergenic
1116403494 14:44539308-44539330 TGACTTTGTAGAATGAGTTAGGG - Intergenic
1117829952 14:59740316-59740338 TGCCTTAGTAGAAGTAGGTCTGG + Intronic
1117845895 14:59911657-59911679 TACCTTTGTAGAAATGGAAAAGG - Intergenic
1119270422 14:73298978-73299000 TCTCTTTGTGGAATTGGGGAAGG + Intronic
1120995075 14:90411179-90411201 TGCTTTTGTAAAAATGGGAATGG - Intergenic
1125906359 15:43396417-43396439 TGCATGAGTAGAGTTGGGTAAGG + Intronic
1126873982 15:53018822-53018844 TGGCTTTGTAGAATGAGTTAGGG + Intergenic
1127145848 15:56022775-56022797 TGGCTTTGTAGAATTAGTTAGGG + Intergenic
1130287227 15:82566116-82566138 TGCCTTTGTACTCTTGGGGAAGG - Intronic
1131087779 15:89591412-89591434 TGGCTTTGTATGGTTGGGTACGG - Intronic
1131920649 15:97324446-97324468 TTCCTTTCTGGAATGGGGTATGG + Intergenic
1135007251 16:18836925-18836947 TGCCATTGTACAAATGAGTAAGG + Intronic
1135554320 16:23423516-23423538 TGCCTTTGTGGAAGTGGCTAAGG - Intronic
1136741769 16:32538329-32538351 TGTCTTTGTAGAATTTGTGAAGG + Intergenic
1137715707 16:50597060-50597082 GGACTTTGGGGAATTGGGTAGGG + Intronic
1138569478 16:57860130-57860152 TGCCTTTATAGAATTTCCTAGGG - Intronic
1138941558 16:61797173-61797195 TGGATATGTAGCATTGGGTATGG - Intronic
1141060672 16:80865785-80865807 TGGCTTTGTAGAATGAGTTAGGG - Intergenic
1141889894 16:86919485-86919507 GGCCTTTGTAGAGATGGGAACGG + Intergenic
1203027834 16_KI270728v1_random:536905-536927 TGTCTTTGTAGAATTTGTGAAGG - Intergenic
1203043887 16_KI270728v1_random:797526-797548 TGTCTTTGTAGAATTTGTGAAGG + Intergenic
1144153524 17:12474557-12474579 TGGCTTTGTAGAATGAGTTATGG + Intergenic
1148006591 17:44436117-44436139 TGCCTTTGTAGAATTGGGTACGG - Intronic
1148235097 17:45963569-45963591 TGCCTCCTTAGAAATGGGTATGG - Intronic
1148518071 17:48240866-48240888 TTCCTTTGAAGACTTGGGTCAGG + Intronic
1150451363 17:65271631-65271653 TGCCTTTATCGAGTGGGGTAAGG - Intergenic
1151067667 17:71170133-71170155 TGCCTTGGTAGAAAGGAGTATGG + Intergenic
1151123250 17:71816684-71816706 CGCTTTGGTAGAATTTGGTAGGG - Intergenic
1151584556 17:75001296-75001318 TAACTTTTTAGAATTGGGCAGGG - Intronic
1153072420 18:1120663-1120685 TGCCTTAGTAGAATGAGTTAGGG + Intergenic
1153269046 18:3300839-3300861 TGGCTTTGTAGAATGAGTTAGGG - Intergenic
1153517920 18:5921679-5921701 TGGCTTTGCATAATTGTGTATGG + Intergenic
1153862698 18:9229973-9229995 TGGCTTTGTAGAATGGGTTAGGG + Intronic
1154977371 18:21473032-21473054 TGTCCTTGTAGACTTGGGTCTGG + Exonic
1155999115 18:32365369-32365391 TGCTTTAGTAGACTTGGGTTTGG - Intronic
1156084125 18:33378942-33378964 TGGCTTTGTAGAATTAGTTTGGG + Intronic
1156181251 18:34607596-34607618 TGTATTTGTAGTATTGGGGAAGG - Intronic
1157968902 18:52242614-52242636 TGCCTATGCAGAAATGAGTAAGG + Intergenic
1159667622 18:71181588-71181610 TGCCTTTGGATAGTTGGTTATGG - Intergenic
1159858896 18:73622594-73622616 TGGCTTTGTAGAATAAGTTAGGG - Intergenic
1161956711 19:7500149-7500171 TGCCTTTGTGGAATTGATAATGG - Intronic
1164327612 19:24212431-24212453 TGTTTTTGTAGAATTTGATAAGG - Intergenic
1164704855 19:30312741-30312763 TGCAGTTGTATAATAGGGTATGG + Intronic
1165583351 19:36889301-36889323 TGGCTTTGTAGAATGAGTTAGGG + Exonic
925750514 2:7086459-7086481 TGGCTTTGTAGAATAAGTTAAGG + Intergenic
928175896 2:29034122-29034144 TACCTTTGAAGAAGTGGGCATGG - Intronic
928590935 2:32814550-32814572 TTCCTTTTTATAATTGGGTGGGG - Intronic
932030583 2:68179631-68179653 TACCTTTGCAGAAATGGGAAGGG + Exonic
935500022 2:103827727-103827749 TGGCTTTGTAGAATGAGTTATGG + Intergenic
937889647 2:126927520-126927542 TGGCTTTGTAGAATGAGTTAGGG + Intergenic
938297442 2:130187042-130187064 TTTCTTTGTAGAAATGGGTGGGG - Intronic
938459334 2:131487626-131487648 TTTCTTTGTAGAAATGGGTGGGG + Intronic
939125137 2:138168771-138168793 TGGCTTTGTAGAATGAGTTAGGG - Intergenic
939908317 2:147946635-147946657 TGCCTTGATATAATTAGGTATGG - Intronic
940458960 2:153938214-153938236 TGGACTTGTAGAATTTGGTATGG + Intronic
940501087 2:154494391-154494413 TGCCTCAGCAGAGTTGGGTATGG - Intergenic
941195819 2:162450359-162450381 TGCATTTGTAGAAACTGGTATGG + Intronic
941587274 2:167376351-167376373 TGGCTTTGTAGAATAAGTTAGGG + Intergenic
941624537 2:167816663-167816685 TGCTTTTGTAGAATTTACTATGG - Intergenic
942914343 2:181285055-181285077 TGGCTTTGTAGAATTGGTTATGG + Intergenic
945063265 2:205926547-205926569 GTCCTTTGTAGAAATGGGGATGG + Intergenic
945521189 2:210829473-210829495 TGGCTTTGTAGAATGAGTTAGGG + Intergenic
948071254 2:235128421-235128443 TAACTTTGCAAAATTGGGTAAGG - Intergenic
1169500369 20:6154394-6154416 TGGCTTTGTAGAATGAGCTATGG + Intergenic
1169741061 20:8894731-8894753 TGCCTTAGTACAATTTGCTAAGG - Intronic
1172371784 20:34399056-34399078 TGCCTTTCTAGAATCAAGTAAGG + Intronic
1174992385 20:55525316-55525338 TGGCTTTGTAGAATGAGTTAGGG + Intergenic
1175704715 20:61168153-61168175 TGCCCTTGTCGAGTTGGGCATGG - Intergenic
1177718611 21:24874418-24874440 TGCCTTTGTAGAATGATTTAGGG + Intergenic
1178862123 21:36298193-36298215 TGGCTTTGTAGAATGGGCTAAGG - Intergenic
1185008871 22:48301962-48301984 TATCTTTGTAGAATTGGTGACGG + Intergenic
949785635 3:7738147-7738169 AGCCTTTGTAAAATTGGGAGAGG - Intronic
950824486 3:15803048-15803070 TGCAGTTGGAGAAGTGGGTATGG + Intronic
953366065 3:42346356-42346378 TGCCTTTGCAGAATGGTATAAGG - Intergenic
956260865 3:67339568-67339590 TGGATTTGTAGAATGGGTTATGG - Intergenic
957600122 3:82323250-82323272 TGACTTTGTAGAATGAGTTAGGG - Intergenic
958327188 3:92421073-92421095 TCCCTTTGTAGAATTTGCAAGGG + Intergenic
958383077 3:93336311-93336333 TCCCTTTGTAGAATTTGCAAGGG + Intergenic
958388165 3:93419653-93419675 TCCCTTTGTAGAATTTGCAAGGG + Intergenic
958390879 3:93464050-93464072 TCCCTTTGTAGAATTTGCAAGGG + Intergenic
960032280 3:113066439-113066461 TGGCTTTGTAGAATTAGCTAGGG + Intergenic
961339601 3:126209161-126209183 TCCATTTGCAGAATTGGGGAAGG - Intergenic
962501957 3:136003920-136003942 TGCCTGTGTAGACCTGTGTAAGG + Intronic
963360483 3:144266161-144266183 TGGGTGGGTAGAATTGGGTATGG + Intergenic
963705341 3:148680047-148680069 TGCCTTTGTATTATTAGGTTTGG - Intergenic
966116884 3:176474674-176474696 TGGCTTTGTAGAATGAGCTATGG + Intergenic
967664734 3:192157476-192157498 TCTCTTTGTAGGATTAGGTATGG + Intronic
968240273 3:197074681-197074703 TGCCTTTATAGGATTTAGTAAGG - Intronic
970773527 4:19644434-19644456 TGGCTTTGTAGAATAAGTTAAGG + Intergenic
971298194 4:25419286-25419308 TGCCTTTTCAGACTTGGTTAAGG + Intergenic
973761945 4:54125897-54125919 TTGCTTTGTAGAATTGGGGCTGG + Intronic
974822435 4:67084318-67084340 GGCCTGAGTAGAATTGGGGAAGG - Intergenic
974914126 4:68158510-68158532 TGACTTTGTAGAATGAGTTAGGG + Intergenic
975502898 4:75106794-75106816 TGCCTTTGTATATTTGGGCTAGG - Intergenic
977001780 4:91513468-91513490 TGGCTTTGTAGAATGAGTTAGGG + Intronic
978921447 4:114188015-114188037 GGCCTTTGCAGAATTAGGCATGG - Intergenic
981043403 4:140243797-140243819 TGCCTTGGGAGAATTAGGGAGGG + Intergenic
981191148 4:141865023-141865045 TGGCTTTGTAGAATGTGTTAGGG + Intergenic
983125564 4:163946915-163946937 TGTCTTTATAGAATTTGATAGGG - Intronic
983690404 4:170462934-170462956 TGGCTTTGTAGAATGAGTTAGGG + Intergenic
984020553 4:174479856-174479878 TGGCTTTGTAGAATGAGTTAGGG - Intergenic
988132045 5:27119347-27119369 CGCCTTTGAAGAAATGGGTTTGG + Intronic
988624691 5:32861066-32861088 TGTCTTTGTAGAATAAGTTAGGG + Intergenic
988937992 5:36108421-36108443 TGCCTTTGTAGAATTATAAATGG - Intronic
989855675 5:46286334-46286356 TGTTTTTGTAGAATTGGCAACGG - Intergenic
990974300 5:61544254-61544276 TGCCTTTGTAGATTTGTTTCAGG - Exonic
992009030 5:72509038-72509060 TGCCTTTGTAGAAATGGGAAGGG + Intergenic
992129485 5:73676846-73676868 AGGCTTTGTAGAATTAGGCATGG + Intronic
993005168 5:82421960-82421982 TGCCTCTGCAAAATTAGGTATGG + Intergenic
994342430 5:98646986-98647008 TGCATTTGGACAAGTGGGTATGG + Intergenic
998555728 5:143121766-143121788 TGCCCTTGTAAAACTGGGGAGGG + Intronic
999648855 5:153746177-153746199 TCCCTTTGAAGAATTGGCTGGGG + Intronic
999712853 5:154333677-154333699 TATCTTTTTAGGATTGGGTATGG - Intronic
1000372480 5:160550346-160550368 TGCCTCTGAAGACTTGGGTTGGG - Intergenic
1000857276 5:166414495-166414517 TGGCTTTGTAGAATGAGTTAGGG - Intergenic
1003042995 6:2705313-2705335 TCCCTTTGTAGAAAGGGGAATGG - Intronic
1008041756 6:46808939-46808961 TGTCTTTTTAGATTGGGGTAAGG + Intronic
1009063290 6:58423316-58423338 TGTTTTTGTAGAATTGGAGAAGG - Intergenic
1009250958 6:61297873-61297895 TGTTTTTGTAGAATTGGAGAAGG - Intergenic
1009259194 6:61462278-61462300 TGTTTTTGTAGAATTTGTTAAGG + Intergenic
1009262835 6:61517120-61517142 TGCTTTTGTAGAATCTGCTAAGG + Intergenic
1009611719 6:65952068-65952090 TTCCTTTGTAGAATGTGTTAAGG + Intergenic
1009898419 6:69781605-69781627 TGCCTTTGTAGAAGTAAGTTTGG - Intronic
1010612086 6:77964893-77964915 TGGCTTTGTAGAATGAGTTAGGG + Intergenic
1010811270 6:80301639-80301661 TGTCTTTGTAGAATTAGTTAGGG - Intronic
1010988767 6:82455890-82455912 TGTCTTTGTAGAATGAGCTAGGG + Intergenic
1013254979 6:108375820-108375842 TGGCTTTGTAGAATGAGTTAGGG + Intronic
1013722764 6:113050698-113050720 AGTCTTTGTAGGATTGGGTTAGG - Intergenic
1013876879 6:114842351-114842373 TGACTTTGTAGAATGAGTTAGGG - Intergenic
1017517244 6:155167661-155167683 TGTTTTTGTAGAAATGGGGATGG + Intronic
1018429366 6:163711566-163711588 TTCCTTTCCAGAATTGGTTATGG - Intergenic
1025547376 7:62194158-62194180 TGTTTTTGTAGAATTGGCAAAGG - Intergenic
1025574838 7:62623344-62623366 TGCTTTTGTAGAATTTGCAAAGG - Intergenic
1025577306 7:62663896-62663918 TGCTTTTGTAGAATTTGCAAAGG - Intergenic
1025584544 7:62766602-62766624 TGTTTTTGTAGAATTTGGGAAGG - Intergenic
1026235077 7:68520346-68520368 TGGCTTTGCAGAAGTGGGAAGGG + Intergenic
1028148679 7:87346781-87346803 TGCATTTGTGTAATTGGTTAAGG - Intronic
1028562478 7:92190604-92190626 TGGCTTTGTAGAATGAGTTAGGG + Intergenic
1031052258 7:116955823-116955845 TGCCTTTGTTAATTTGTGTAGGG + Intronic
1031904829 7:127448930-127448952 TGGCTTTGTAGAACAAGGTAGGG - Intergenic
1033862126 7:145641257-145641279 TGCCTTTGTAGAATGAGTTAGGG + Intergenic
1034112656 7:148553232-148553254 TGGCTTTGTAGAATGAGTTAAGG + Intergenic
1034347341 7:150395718-150395740 TGCCTCTGTAGACTTGTGCACGG + Intronic
1034430244 7:151037679-151037701 TGCCTCAGTAGAATGGGGTGGGG - Intronic
1036705407 8:11042833-11042855 TGCCTTGGCAGAAATGGGGAAGG + Intronic
1038219165 8:25591483-25591505 TGCATTGCTAGAAATGGGTAGGG - Intergenic
1040282626 8:46072054-46072076 TGCTTTTGTAGAATTTGTGAAGG + Intergenic
1040346887 8:46511575-46511597 TGTTTTTGTAGAATTGGTGAAGG - Intergenic
1041244026 8:55874160-55874182 TGTTTTTGTAGAATTGAATATGG + Intergenic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1042626463 8:70763334-70763356 GGCCTTTGTAGAATAGAGCAGGG + Intronic
1043198107 8:77326421-77326443 TGGCTTTGTAGAATGAGTTAAGG + Intergenic
1045410926 8:101917964-101917986 TGGCTTTGTAGAATGAGTTAGGG - Intronic
1046111072 8:109725558-109725580 TGACTTTGTAGAATGAGTTAGGG - Intergenic
1046719814 8:117606644-117606666 TTCCTTTGTAAAATTAGGTGTGG + Intergenic
1047200535 8:122761470-122761492 TGCCTTTGTTGGCTTGGGTGGGG - Intergenic
1048233833 8:132670897-132670919 TGTCTTTTTAAAATTGGGAATGG - Intronic
1048690931 8:136962408-136962430 TGTCTTTGTAGAAATTGGAATGG + Intergenic
1054362603 9:64191170-64191192 TGTTTTTGTAGAATTTGTTAAGG + Intergenic
1055767786 9:79683458-79683480 TGCCTTTGTAAAATTGGCATAGG - Intronic
1056858593 9:90158532-90158554 TGCTTTTGTAGAACTGGGAAGGG - Intergenic
1058030294 9:100188693-100188715 TGGCTTTGTAGAATGAGATAGGG + Intronic
1058148095 9:101433713-101433735 TACCTCTGAAGAATGGGGTAGGG + Intronic
1059624920 9:116053040-116053062 TGGTTTTGTGGATTTGGGTAAGG + Intergenic
1059899842 9:118911446-118911468 TTCATTTGTAAAAATGGGTATGG + Intergenic
1060419791 9:123459935-123459957 ATCCTTTGTAAAATTAGGTAGGG - Intronic
1060500910 9:124154345-124154367 TGGCTTTGTAGAATGAGTTAGGG - Intergenic
1187234612 X:17455476-17455498 TGCCTATGTTCAATTGAGTATGG - Intronic
1189011648 X:37051145-37051167 TGGCTTTGTAGAACATGGTAAGG + Intergenic
1190278424 X:48913925-48913947 CTCCTTTGTAGGATTGGGAAGGG + Exonic
1190531424 X:51381885-51381907 TGGCTTTGTAGAATGAGTTAAGG - Intergenic
1191008216 X:55733806-55733828 TGGCTTTGTAGAATGAGTTAAGG + Intronic
1192863454 X:75104680-75104702 TGCCCTTGTAGAATGAGTTACGG - Intronic
1193779886 X:85688363-85688385 TGGCTTTGTAGAATGAGTTAAGG - Intergenic
1193867756 X:86757377-86757399 TGGCTTTGTAGAATGAGTTAGGG + Intronic
1194641055 X:96404733-96404755 TGTCTTTGTAGACCAGGGTAAGG - Intergenic
1195103386 X:101578352-101578374 TGGCTTTGTAGAATGAGTTATGG + Intergenic
1195415324 X:104613675-104613697 TGGCTTTGTAGAATGAGTTATGG + Intronic
1197285424 X:124589425-124589447 TGCCTTCATAGAATTAGTTAGGG + Intronic
1197579011 X:128258592-128258614 TGGCTTTGTAGAATGAGTTAGGG - Intergenic
1197801189 X:130351153-130351175 TTCTTTTGTAAAATTGAGTAAGG - Intronic
1197998154 X:132402871-132402893 TGCCTTTGCAGAATTGAATATGG - Intronic
1199313568 X:146349863-146349885 TATCTTTGTATAATTGGGGAGGG - Intergenic
1199561755 X:149170934-149170956 TGATTTTGTAAAATTGGGCAGGG + Intergenic