ID: 1148008860

View in Genome Browser
Species Human (GRCh38)
Location 17:44458133-44458155
Sequence CCTTAGACCCATGAGTAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 911
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 883}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148008860_1148008866 0 Left 1148008860 17:44458133-44458155 CCCCACTACTCATGGGTCTAAGG 0: 1
1: 0
2: 0
3: 27
4: 883
Right 1148008866 17:44458156-44458178 CAGGAGGATCACTTGAGCCCAGG 0: 5667
1: 20854
2: 87258
3: 198358
4: 294179
1148008860_1148008867 9 Left 1148008860 17:44458133-44458155 CCCCACTACTCATGGGTCTAAGG 0: 1
1: 0
2: 0
3: 27
4: 883
Right 1148008867 17:44458165-44458187 CACTTGAGCCCAGGAGATCAAGG 0: 147
1: 3295
2: 10169
3: 24709
4: 48953

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148008860 Original CRISPR CCTTAGACCCATGAGTAGTG GGG (reversed) Intronic
900727441 1:4226280-4226302 CCTTAGCCCCCTGAGTAGCTGGG + Intergenic
901111395 1:6799181-6799203 CCTCAGCCTCCTGAGTAGTGAGG + Intronic
901486754 1:9568733-9568755 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
901818776 1:11811996-11812018 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
902046234 1:13526789-13526811 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
902321365 1:15669416-15669438 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
902338911 1:15770060-15770082 CCTCAGCCCCATGAGTAGCTGGG + Intronic
902346903 1:15824953-15824975 CCTTAGCCCCACGAGTAGCTGGG + Intergenic
902972025 1:20060831-20060853 CCTCAGACCCCTGAGTAGCTGGG + Intronic
903054885 1:20628990-20629012 CCTTAGCCTCCTGAGTAGGGGGG - Intergenic
903060507 1:20665513-20665535 CCTCAGCCCCCTGAGTAGTTGGG + Intronic
903107902 1:21100610-21100632 CCTCAGACTCCTGAGTAGTTGGG - Intronic
903198140 1:21709023-21709045 CCTTAGCCTCCTGAGTAGTCTGG + Intronic
903880473 1:26505284-26505306 CCTCAGCCTCATGAGTAGTTGGG + Intergenic
903893364 1:26585492-26585514 CCTCAGCCCCCTGAGTAGTAGGG - Intergenic
903962832 1:27067585-27067607 CCTTAGCCTCCTGAGTAGTTGGG - Intergenic
903975602 1:27147876-27147898 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
904186026 1:28705563-28705585 CCTTAGACTCCTGAGTAGCTGGG + Intronic
904479296 1:30783948-30783970 CCTTCCACCCATGAGTAGCCAGG + Intergenic
904529768 1:31160714-31160736 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
904686389 1:32263793-32263815 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
904693651 1:32314306-32314328 CCTTAGCCTCTTGAGTAGTTAGG + Intronic
905438815 1:37979739-37979761 CCTTAGACTCCTGAGTAGCTGGG - Intronic
905536243 1:38724172-38724194 CCTTAAACCCATGAGATCTGAGG - Intergenic
906215953 1:44039296-44039318 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
907041961 1:51269313-51269335 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
907075594 1:51575314-51575336 CCTTAGACTCCTGAGTAGCTGGG + Intergenic
907121427 1:52011407-52011429 CCTCAGTCCCTTGAGTAGAGGGG + Intergenic
907134358 1:52125143-52125165 CCTCAGCCTCCTGAGTAGTGGGG + Intergenic
907201717 1:52732647-52732669 CCTCAGACTCCTGAGTAGTTGGG - Intronic
907603937 1:55796914-55796936 CCTTAGACTCCTGAGTAGCTTGG - Intergenic
907651641 1:56300476-56300498 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
907804143 1:57801771-57801793 CCTTAGTCCCCTGAGTAGCTCGG + Intronic
907859441 1:58337164-58337186 CCTTAGTCTCCTGAGTAGTTGGG - Intronic
908325430 1:63018909-63018931 CCTCAGCCCCCTGAGTAGTTGGG + Intergenic
908744173 1:67359844-67359866 TCTTTGACCTATGAGAAGTGAGG + Intronic
908749347 1:67404608-67404630 CCTCAGACTCCTGAGTAGTTGGG - Intergenic
908946567 1:69505057-69505079 ACTTAGTCACATGACTAGTGTGG + Intergenic
909446011 1:75749826-75749848 CCTTAGCCTCATGAGTAGCTGGG + Intronic
909590177 1:77339759-77339781 CCTTAGACTCCTGAGTAGCTGGG + Intronic
910279270 1:85480627-85480649 CCTTAGTCCCCTGAGTAGCTGGG - Intronic
910734543 1:90438230-90438252 GTTTAGACCCATGATGAGTGTGG + Intergenic
912016814 1:105048190-105048212 CCTCAGACCCCTGAGTAGCTGGG - Intergenic
912908668 1:113734142-113734164 CCTTAGCCTCCTGAGTAGCGGGG - Intronic
912919681 1:113853979-113854001 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
913028327 1:114870127-114870149 CCTCAGCCTCTTGAGTAGTGGGG + Intronic
913162854 1:116161059-116161081 CCTCAGGCCCCTGAGTAGTTGGG - Intergenic
913443601 1:118925800-118925822 CCCTAAACCCATGAATAGGGAGG - Intronic
914260054 1:145991311-145991333 CCTCAGACTCTTGAGTAGTTGGG - Intergenic
914840848 1:151247539-151247561 CCTCAGCCCCTTGAGTAGTTGGG + Intronic
915207124 1:154278394-154278416 CCTCAGACCCCTGAGTAGCTGGG - Intergenic
915354317 1:155246960-155246982 CCTTAGCCACCTGAGTAGTTGGG + Intergenic
915565791 1:156711927-156711949 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
915778417 1:158517631-158517653 CCTTAGTCTCTTGAGTATTGGGG - Intergenic
916019925 1:160782743-160782765 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
916407133 1:164508725-164508747 CCTCAGTCTCCTGAGTAGTGGGG + Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
917555314 1:176080059-176080081 TCTTCGACCCATGATTACTGAGG - Intronic
917935478 1:179862810-179862832 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
918278525 1:182979358-182979380 CCTCAGCCCCATGAGTAGCTGGG - Intergenic
920005176 1:202828054-202828076 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
920492122 1:206424537-206424559 CCTCAGACTCATGAGTAGCTGGG - Intronic
920609971 1:207426425-207426447 CTTTAGACCCCTGAGTAGCTGGG - Intergenic
920909514 1:210202176-210202198 CCTTAGACTCCTGAGTAGCTGGG - Intergenic
921379334 1:214507863-214507885 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
921757716 1:218879477-218879499 TCCCAGACCCTTGAGTAGTGAGG - Intergenic
921913062 1:220573437-220573459 CCTTAGCCTCCTGAGTAGCGGGG + Intronic
922521243 1:226254045-226254067 CCTCAGACTCCTGAGTAGTAGGG + Intronic
922897409 1:229111190-229111212 CCTTAGTCTCCTGAGTAGTTGGG - Intergenic
923056904 1:230433357-230433379 CCTCAGACCCCTGAGTAGATGGG - Intergenic
923187748 1:231590411-231590433 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
924224867 1:241913133-241913155 CCTTAGCCCCCTGAGTAGCTGGG - Intergenic
924478809 1:244407609-244407631 CCTCAGACTCCTGAGTAGTTGGG - Intergenic
924845899 1:247770543-247770565 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
924932158 1:248741320-248741342 CCTCAGCCCCCTGAGTAGTACGG + Intronic
1062847033 10:715627-715649 CCTTGGCCTCCTGAGTAGTGGGG + Intergenic
1062853404 10:763910-763932 CCTCAGACCCCTGAGTAGCTGGG - Intergenic
1063412423 10:5846895-5846917 CCTCAGACTCCTGAGTAGTTGGG + Intergenic
1064249376 10:13695254-13695276 CCTTAGCCTCCTGAGTAGTGGGG + Intronic
1064675549 10:17756409-17756431 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
1064816887 10:19275551-19275573 CCTCAGCCACCTGAGTAGTGGGG - Intronic
1065294246 10:24259497-24259519 CCTTAGCCTCTGGAGTAGTGGGG - Intronic
1065349078 10:24779394-24779416 CCTCAGTCTCCTGAGTAGTGGGG - Intergenic
1065548888 10:26850540-26850562 CCTTAGCCTCTTGAGTAGTTGGG - Intronic
1066308046 10:34166500-34166522 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1066310606 10:34192181-34192203 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1066388520 10:34960694-34960716 CCTCAGCCTCCTGAGTAGTGGGG + Intergenic
1066641272 10:37556613-37556635 CCTCAGCCCCATGAGTAGCTGGG + Intergenic
1067399663 10:45959324-45959346 CCTTAGCCTCATGAGTAGCTAGG + Intergenic
1067596085 10:47559239-47559261 CCTTAGCCTCATGAGTAGCTAGG + Intergenic
1068319396 10:55391600-55391622 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
1069472982 10:68709410-68709432 CCTTAGCCCCCTGAGTAGCTGGG + Intergenic
1069570429 10:69491476-69491498 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1069979994 10:72245778-72245800 CCTTAGACTCCTGAGTAGCTGGG - Intergenic
1069990504 10:72312580-72312602 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
1070114162 10:73512907-73512929 CCTCAGCCCCTTGAGTAGTTGGG - Intronic
1070629489 10:78074835-78074857 CCTCAGACTCCTGAGTAGTTGGG + Intergenic
1071198158 10:83185752-83185774 CCTTAGCCTCCTGAGTAGTCGGG - Intergenic
1071540435 10:86477937-86477959 CCTTAGTCTCCTGAGTAGCGGGG - Intronic
1071614401 10:87061730-87061752 CCTTAGTCTCCTGAGTAGTTGGG + Intronic
1071770424 10:88722998-88723020 CCTCAGCCCCATGAGTAGCTGGG + Intergenic
1071978734 10:90981799-90981821 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
1072210740 10:93244584-93244606 CCTCAGCCTCCTGAGTAGTGGGG + Intergenic
1072211872 10:93253755-93253777 CTTTAGCCCCCTGAGTAGTTGGG + Intergenic
1072278930 10:93848525-93848547 CCTTAGTCCCCTGAGTAGTTAGG - Intergenic
1072338504 10:94422688-94422710 CCTTAGCCTTTTGAGTAGTGGGG + Intronic
1072414364 10:95234458-95234480 CCTCAGTCCCCTGAGTAGTTGGG - Intergenic
1072641936 10:97218009-97218031 CCTTAGTCCCCTGAGTAGCTGGG - Intronic
1072647927 10:97273602-97273624 CCTCAGACTCCTGAGTAGTTGGG + Intronic
1072933602 10:99690656-99690678 CCTCAGCCCCCTGAGTAGTTGGG + Intronic
1072981008 10:100097536-100097558 CCTCAGTCTCCTGAGTAGTGGGG - Intergenic
1073342591 10:102757001-102757023 CCTCAGCCCCATGAGTAGCTGGG + Intronic
1073551781 10:104408982-104409004 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
1073743009 10:106432703-106432725 CCTTAGCCTCCTGAGTAGTTGGG - Intergenic
1073863045 10:107769529-107769551 CCTCAGACTCCTGAGTAGTTGGG - Intergenic
1074960682 10:118442599-118442621 TCAAAGACACATGAGTAGTGAGG - Intergenic
1075046427 10:119149875-119149897 CCTTAGTCCCATGTGTGGGGAGG + Intronic
1075250779 10:120869903-120869925 CCTCAGCCCCATGAGTAGCTGGG + Intronic
1075760781 10:124854739-124854761 CCTTAGCCTCATGAGTAGCTAGG + Intergenic
1076879292 10:133231970-133231992 CCTTTGACCCAGGAGTAGCATGG + Intergenic
1077054320 11:583399-583421 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
1077086358 11:753606-753628 CCTCAGCCCCATGAGTAGCTGGG - Intronic
1077471079 11:2760826-2760848 CCCTAGAACTTTGAGTAGTGGGG - Intronic
1077631379 11:3813330-3813352 CCTCAGACTCCTGAGTAGTTAGG + Intronic
1077635314 11:3838090-3838112 CTGTAGACCCATTAGTGGTGAGG - Intronic
1077724716 11:4662473-4662495 CCTTAGACTCCTGAGTAGGTGGG + Intergenic
1078193137 11:9109995-9110017 CCTTAGCCTCATGAGTAGCTAGG - Intronic
1078214333 11:9298648-9298670 CCTCAGTCCCCTGAGTAGTTGGG - Intronic
1080433918 11:32222566-32222588 CCTCAGCCTCCTGAGTAGTGAGG - Intergenic
1080735741 11:35012097-35012119 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
1080825346 11:35844003-35844025 CCTCAGCCTCATGAGTAGTTGGG - Intergenic
1081515346 11:43823384-43823406 CCTTAGCCTCCTGAGTAGTTAGG + Intronic
1081519237 11:43865556-43865578 CCTTAGCCTCATGAGTAGCTGGG - Intergenic
1081894702 11:46575339-46575361 CCTCAGACTCCTGAGTAGTTGGG - Intronic
1082020296 11:47527273-47527295 CCTCAGCCCCCTGAGTAGTTGGG - Intronic
1082080567 11:48009478-48009500 CCTCAGACCCCTGAGTAGCTGGG - Intronic
1082804917 11:57441831-57441853 CCTTAGCCTCCTGAGTAGTTAGG - Intergenic
1083320943 11:61846230-61846252 CCTCAGACTCCTGAGTAGTTGGG + Intronic
1083684158 11:64366284-64366306 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1083770054 11:64862022-64862044 CCTTAGACTCCTGAGTAGCTGGG + Intronic
1083924942 11:65800376-65800398 CCTTAGCCCCAGGAGTAGCTGGG - Intergenic
1083930121 11:65837702-65837724 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
1083963448 11:66027429-66027451 CCTTAGCCCCCTGAGTAGCTGGG + Intergenic
1084101179 11:66950691-66950713 CCTTAGATCCATCAATAGAGAGG - Intronic
1084159492 11:67338449-67338471 CCTCAGCCCCATGAGTAGCTGGG - Intronic
1084206196 11:67594858-67594880 CCTTAGCCTCTTGAGTAGCGGGG - Intergenic
1084278215 11:68067477-68067499 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1084524404 11:69686769-69686791 CCTTCTCCCCATGAGTTGTGTGG - Intergenic
1084619919 11:70262752-70262774 CCTCAGCCTCCTGAGTAGTGGGG + Intergenic
1084832272 11:71778798-71778820 CCTCAGCCCCCTGAGTAGTTGGG + Intergenic
1084899427 11:72298611-72298633 CCTCAGCCTCCTGAGTAGTGAGG + Intronic
1084977614 11:72811446-72811468 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
1086320455 11:85641601-85641623 CCTTAGACACCTGAGTAGCTGGG - Intergenic
1087583843 11:100093374-100093396 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
1087639483 11:100741144-100741166 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
1087777984 11:102274138-102274160 CCTCAGACCCCTGAGTAGCTGGG - Intergenic
1088348872 11:108862132-108862154 CCTTAGCCTCCTGAGTAGCGAGG + Intronic
1088633094 11:111793097-111793119 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1089957742 11:122587697-122587719 CCTCAGTCCCATGAGTAGCTGGG + Intergenic
1090300282 11:125630424-125630446 CCTTAGGCCCCTGAGTAGCTGGG + Intronic
1091430589 12:430405-430427 CCTTAGCCTCCTGAGTAGCGGGG + Intronic
1091436204 12:474996-475018 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1091542351 12:1473512-1473534 CCTTAGACCGCTGAGTAGCCGGG - Intronic
1091794691 12:3291358-3291380 CCTTAGACTCCTGAGTAGCTGGG + Intergenic
1092803627 12:12198032-12198054 CCTTAGCCCCCTGAGTAGCTGGG + Intronic
1092824647 12:12387116-12387138 CCTCAGCCCCCTGAGTAGTTGGG + Intronic
1093113713 12:15183759-15183781 ACACAGACCCATGAATAGTGTGG + Intronic
1093651828 12:21655003-21655025 CCTTAGCCTCCTGAGTAGTTAGG - Intronic
1093732932 12:22586535-22586557 CCTTAGTCTCATGAGTAGCTGGG + Intergenic
1093846571 12:23979337-23979359 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
1093984896 12:25519470-25519492 CCTTAGCCTCATGAGTAGCTGGG - Intronic
1093989219 12:25571477-25571499 CCTTAGCCTCATGAGTAGCTGGG + Intronic
1094367107 12:29695420-29695442 CCTCAGACTCCTGAGTAGCGGGG + Intronic
1094595448 12:31861979-31862001 CCTTAGACTCCTGAGTAGCTGGG + Intergenic
1094615003 12:32028806-32028828 CCTCAGCCCCATGAGTAGCTGGG - Intergenic
1095423596 12:42050909-42050931 CCTCAGTCTCATGAGTAGTTGGG - Intergenic
1095805497 12:46314907-46314929 CCTTAGCTTCATGAGTAGTTAGG + Intergenic
1096269016 12:50148787-50148809 CCTTAGCCACCTGAGTAGTTGGG - Intronic
1096348250 12:50870076-50870098 CCTTAGCCCCCTGAGTAGCTGGG - Intronic
1096361256 12:50989373-50989395 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1096364926 12:51020973-51020995 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1096822499 12:54247954-54247976 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1097661208 12:62433696-62433718 CCTTAGCCCCCTGAGTAGCTGGG - Intergenic
1097795113 12:63853133-63853155 CCTCAGACTCATGAGTAGCTGGG + Intronic
1098282379 12:68874498-68874520 CCTGAGCCTCCTGAGTAGTGGGG - Intronic
1098798716 12:74925581-74925603 CCTCAGACTCCTGAGTAGTTGGG - Intergenic
1098916405 12:76261210-76261232 CCTCAGCCTCATGAGTAGTTGGG + Intergenic
1099620454 12:84996688-84996710 CCTCAGCCCCCTGAGTAGTTGGG - Intergenic
1100471978 12:94901805-94901827 CCTTAGCCTCCTGAGTAGCGGGG - Intronic
1102113651 12:110384279-110384301 CCTTAGCCCCCTGAGTAGCTGGG - Intronic
1102326259 12:111987387-111987409 CCTCAGACTCCTGAGTAGTTGGG - Intronic
1102378403 12:112442565-112442587 CCTCAGCCCCCTGAGTAGTTGGG + Intronic
1102688589 12:114743010-114743032 CCTCAGCCTCTTGAGTAGTGAGG + Intergenic
1102748583 12:115272000-115272022 CCTCAGCCCCCTGAGTAGTTGGG - Intergenic
1103074728 12:117972892-117972914 CCTTAGCCTCCTGAGTAGTTGGG - Intergenic
1103214676 12:119192537-119192559 CCTCAGCCTCCTGAGTAGTGTGG - Intronic
1103434925 12:120917544-120917566 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
1103499110 12:121387042-121387064 CCTTAGCCTCCTGAGTAGCGGGG - Intronic
1103645023 12:122385046-122385068 CCTCAGACTCATGAGTAGCTGGG + Intronic
1103838487 12:123843691-123843713 CCTTAGACTTCTGAGTAGTTGGG + Intronic
1103920961 12:124398997-124399019 CTTAAGACCCATGAGTGGGGTGG + Intronic
1104511689 12:129385219-129385241 CCTTAGCCTCCCGAGTAGTGGGG + Intronic
1104539232 12:129646913-129646935 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
1104684272 12:130774402-130774424 CCTCAGACCCCTGAGTAGCTGGG - Intergenic
1104687987 12:130802311-130802333 CCTCTGACCCCTGAGTGGTGGGG + Intronic
1104887753 12:132120864-132120886 CCTCAGCCTCCTGAGTAGTGAGG + Intronic
1105781460 13:23708264-23708286 CCTTATCCCCATGAGTAGCTGGG - Intergenic
1106091454 13:26598984-26599006 CCTTAGCCTCATGAGTAGCTGGG + Intronic
1106486237 13:30174989-30175011 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
1107283142 13:38758915-38758937 CCTCAGGCCCCTGAGTAGTTGGG - Intronic
1107347879 13:39482326-39482348 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
1107587426 13:41866231-41866253 CCTCAGCCCCCTGAGTAGTTGGG - Intronic
1109512682 13:63400378-63400400 CCTCAGCCTCATGAGTAGTTGGG - Intergenic
1109709080 13:66140505-66140527 CCTCAGCCCCATGAGTAGCTGGG + Intergenic
1110574908 13:77044245-77044267 CCTCAGCCCCCTGAGTAGTTGGG - Intergenic
1110620730 13:77592672-77592694 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1110737322 13:78952485-78952507 CCTCAGACTCCTGAGTAGTTGGG + Intergenic
1110990087 13:82030218-82030240 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
1111527946 13:89497202-89497224 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
1111789638 13:92837977-92837999 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1111922129 13:94423305-94423327 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
1112239406 13:97666350-97666372 CCTGAGACCCAGAAGCAGTGAGG + Intergenic
1112479032 13:99757010-99757032 CCTCAGCCTCAGGAGTAGTGGGG + Intronic
1112547748 13:100388346-100388368 CCTTAGCCCCCTGAGTAGCTGGG - Intronic
1112800553 13:103105133-103105155 CCTTAGCCTCCTGAGTAGTTGGG - Intergenic
1112880719 13:104103336-104103358 CCTCAGCCCCATGAGTAGCTGGG - Intergenic
1113366104 13:109677392-109677414 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
1114741052 14:25097701-25097723 CCTCAGCCTCATGAGTAGTAGGG - Intergenic
1115229434 14:31143296-31143318 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1115997110 14:39205602-39205624 CCTTAGCCTCCTGAGTAGCGGGG - Intergenic
1116612149 14:47089489-47089511 CCTCAGCCCCCTGAGTAGTTGGG + Intronic
1116878655 14:50141403-50141425 CCTTAGTCTCCTGAGTAGTGGGG - Intronic
1116897116 14:50327217-50327239 CCTCAGACTCCTGAGTAGTTGGG - Exonic
1117322973 14:54641911-54641933 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1117382128 14:55174804-55174826 CCTTAGCCTCATGAGTAGCTGGG + Intronic
1117445374 14:55799256-55799278 CCTTAGCCTCCTGAGTAGTCAGG + Intergenic
1118392810 14:65309864-65309886 CCTCAGCCTCCTGAGTAGTGAGG - Intergenic
1118419402 14:65584292-65584314 CCTCAGACCCCTGAGTAGCTGGG + Intronic
1118546041 14:66890290-66890312 CCTCAGACCCCTGAGTAGCTGGG - Intronic
1118621399 14:67617834-67617856 CCTCAGACTCCTGAGTAGTTGGG + Intergenic
1118631796 14:67712033-67712055 CCTCAGCCCCCTGAGTAGTTGGG + Intronic
1119098291 14:71854888-71854910 CCTCAGACTCCTGAGTAGTTGGG + Intergenic
1119783154 14:77291912-77291934 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1120303503 14:82737973-82737995 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
1120375258 14:83696565-83696587 CCTCAGACTCCTGAGTAGTTGGG + Intergenic
1120569066 14:86095654-86095676 CCTCAGACTCCTGAGTAGTTGGG + Intergenic
1120642469 14:87031778-87031800 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
1120850943 14:89169323-89169345 CCTTAGCCTCCCGAGTAGTGGGG - Intronic
1120976362 14:90252108-90252130 CCTCAGCCTCATGAGTAGTTGGG - Intergenic
1121097458 14:91227697-91227719 CCTTAGCCCCATGAGTAGCTGGG - Intergenic
1121326402 14:93022431-93022453 CCTCAGCCCCATGAGTAGCTGGG - Intronic
1121359650 14:93244973-93244995 CCTTAGCCCCATGAGTAGCTGGG + Intronic
1121693366 14:95893449-95893471 CCTTAGAGCCATAAGGAGTGAGG - Intergenic
1122090741 14:99338060-99338082 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
1122511377 14:102271067-102271089 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
1123713873 15:23012520-23012542 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
1123755314 15:23393330-23393352 CCTTAGACTCCTGAGTAGCTGGG + Intergenic
1125145056 15:36457431-36457453 CCTTAGTCTCCTGAGTAGTTGGG + Intergenic
1125316303 15:38435568-38435590 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
1125632130 15:41155866-41155888 CCTTAGCCCCCTGAGTAGCTGGG + Intergenic
1126167057 15:45662674-45662696 GCTTTGACCCCTGAGTGGTGAGG - Intronic
1126456967 15:48873623-48873645 CCTCAGACTCCTGAGTAGCGGGG - Intronic
1126772657 15:52073262-52073284 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
1127016453 15:54693912-54693934 CCTCAGACCCCTGAGTAGCTGGG - Intergenic
1127818432 15:62633410-62633432 CCTTAGGCCCCTGAGTAGCTAGG + Intronic
1128013348 15:64319658-64319680 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1128297890 15:66540435-66540457 CCTTAGCCACGTGAGTAGTTGGG - Intronic
1128902967 15:71442072-71442094 CCTAAGCCTCCTGAGTAGTGGGG + Intronic
1129359181 15:75013710-75013732 CCTTAGTCCCCTGAGTAGCTAGG - Intronic
1130526567 15:84712123-84712145 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1131033854 15:89208090-89208112 CCTCAGCCTCCTGAGTAGTGGGG + Intergenic
1131192316 15:90326363-90326385 CCTCAGCCCCCTGAGTAGTTGGG - Intergenic
1131498204 15:92933719-92933741 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1131755240 15:95553001-95553023 CCTTAGCCTCCTGAGTAGTTAGG - Intergenic
1131807591 15:96138534-96138556 CCTCAGTCCCATGAGTAGCTGGG - Intergenic
1131968593 15:97870723-97870745 CCTTAGCCCCCTGAGTAGCTGGG - Intergenic
1133227633 16:4349649-4349671 CCTTAGACCCCCAAGTAGTTGGG - Intronic
1133300619 16:4780201-4780223 CCTCAGTCCCCTGAGGAGTGAGG + Intronic
1133381985 16:5338770-5338792 CTTTAGCCTCCTGAGTAGTGGGG + Intergenic
1133467351 16:6040708-6040730 CCTTAGACTCCTGAGTAGCTGGG + Intronic
1133480043 16:6161271-6161293 CCTTAGCCCCCTGAGTAGCTGGG - Intronic
1133753415 16:8742748-8742770 CCTTAGCCCCCTGAGTAGCTGGG - Intronic
1134214270 16:12304386-12304408 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1134372746 16:13640711-13640733 CCTTAGTCCCCTGAGTAGCTGGG + Intergenic
1134601573 16:15537771-15537793 CCTCAGCCCCTTGAGTAGTGGGG + Intronic
1134827672 16:17297605-17297627 CCTCAGCCTCCTGAGTAGTGAGG - Intronic
1135074852 16:19384345-19384367 CCTTAGACTCCTGAGTAGCCAGG - Intergenic
1135199755 16:20427183-20427205 CCTCAGACCCCTGAGTAGCTGGG - Intronic
1135218949 16:20596427-20596449 CCTCAGACCCCTGAGTAGCTGGG + Intergenic
1135240636 16:20804548-20804570 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1135257330 16:20951557-20951579 CCTTAGTCCCCTGAGTAGCTAGG + Intronic
1135273704 16:21091698-21091720 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1135555107 16:23429646-23429668 CCTCAGCCCCATGAGTAGCTGGG - Intronic
1135648233 16:24182403-24182425 CCTTAGCCTCCTGAGTAGTCAGG - Intronic
1136157905 16:28397338-28397360 CCTTAGCCTCATGAGTAGCTGGG + Intronic
1136170403 16:28486111-28486133 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1136205182 16:28717945-28717967 CCTTAGCCTCATGAGTAGCTGGG - Intronic
1136670937 16:31856493-31856515 CCTCAGCCCCCTGAGTAGTTGGG - Intergenic
1136985593 16:35101323-35101345 CCTTAGCCCCCTGAGTAGCTGGG - Intergenic
1137506848 16:49061472-49061494 CCTTATACCCATGGCTACTGAGG - Intergenic
1138683407 16:58703952-58703974 CCTCAGACTCCTGAGTAGTTGGG + Intergenic
1139735054 16:68980517-68980539 CCTTAGCCCCATGATTAGCTGGG + Intronic
1140016908 16:71196435-71196457 CCTGAGAACCATGAGCACTGAGG - Intronic
1140569418 16:76085957-76085979 CCTCAGCCCCCTGAGTAGTTGGG - Intergenic
1141183999 16:81774232-81774254 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1141935994 16:87238137-87238159 ACTTAGACACCTGAGTAGGGCGG + Intronic
1141975656 16:87514445-87514467 CCTTAGCCCCCTGAGTAGCTGGG - Intergenic
1142635608 17:1255507-1255529 CCTCAGCCTCATGAGTAGTTGGG - Intergenic
1142775571 17:2135803-2135825 CCTTAGCCCCTTGAGTAGCTGGG + Intronic
1143713763 17:8752910-8752932 CCTCAGGCTCCTGAGTAGTGGGG + Intergenic
1143975541 17:10826926-10826948 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
1144044647 17:11444201-11444223 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
1144176976 17:12716872-12716894 CCTTAGTCCCATGAGTAGCTGGG - Intronic
1144668580 17:17118576-17118598 CCTTTGAACCATGAGGACTGTGG + Intronic
1144695013 17:17297729-17297751 CCTCAGACCCCTGAGTAGCTAGG + Intergenic
1144700282 17:17333417-17333439 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1145079367 17:19881977-19881999 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
1145803188 17:27704900-27704922 CCTCAGCCTCCTGAGTAGTGGGG + Intergenic
1145872829 17:28289706-28289728 CCTTAGGCTCCTGAGTAGTGGGG - Intergenic
1145918421 17:28591383-28591405 CCTCAGCCTCCTGAGTAGTGAGG + Intronic
1145955235 17:28849965-28849987 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1146038920 17:29432873-29432895 CCTTAGCCTCCTGAGTAGTTAGG + Intronic
1146048271 17:29528722-29528744 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
1146502605 17:33377164-33377186 CCTTAGACTCCTGAGTAGCTGGG + Intronic
1147021122 17:37534048-37534070 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
1147040654 17:37716031-37716053 CCTTAGCTTCCTGAGTAGTGGGG - Intronic
1147633338 17:41946964-41946986 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
1147640067 17:41991793-41991815 CCTCAGCCTCATGAGTAGTTGGG + Intronic
1147680838 17:42244201-42244223 CCTTAGCCCCCTGAGTAGCTGGG + Intronic
1147700505 17:42391106-42391128 CCTTAGCCTCCTGAGTAGTTGGG - Intergenic
1147853575 17:43460914-43460936 CCTAAGCCCCCTGAGTAGTTGGG + Intergenic
1148008860 17:44458133-44458155 CCTTAGACCCATGAGTAGTGGGG - Intronic
1148370519 17:47096422-47096444 CCTCAGCCCCCTGAGTAATGAGG + Intergenic
1148880044 17:50718890-50718912 CCTCAGCCCCCTGAGTAGTTGGG + Intergenic
1148958989 17:51377278-51377300 CCTTAGCCTCCTGAGTAGTTAGG + Intergenic
1149331014 17:55581912-55581934 CCTCAGACTCATGAGTAGATGGG + Intergenic
1149693320 17:58596824-58596846 CCTCAGACCCCTGAGTAGGTGGG - Intronic
1149780452 17:59393241-59393263 CCTCAGCCTCATGAGTAGTTAGG + Intronic
1149960594 17:61105538-61105560 CCTCAGCCCCATGAGTAGCTGGG + Intronic
1150065796 17:62108138-62108160 CCTTAGACTCCCGAGTAGTTGGG - Intergenic
1150464601 17:65381411-65381433 CCCAAGACCCAAGAGAAGTGAGG + Intergenic
1150604243 17:66677193-66677215 CCTCAGACCCCTGAGTAGCTGGG + Intronic
1151261340 17:72918291-72918313 CCTCAGACTCCTGAGTAGTTGGG - Intronic
1151279425 17:73061878-73061900 CCTTAGCCCCCTGAGTAGCTGGG - Intronic
1151295682 17:73184554-73184576 CCTTAGCCCCCTGAGTAGCTGGG - Intergenic
1152337300 17:79706208-79706230 CCTTAGACCCCCGAGGGGTGGGG - Intergenic
1153311803 18:3684303-3684325 CCTCAGACTCCTGAGTAGTTGGG + Intronic
1153800051 18:8660723-8660745 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
1153825691 18:8872312-8872334 CCTCAGCCTCCTGAGTAGTGGGG + Intergenic
1153828179 18:8896463-8896485 CTTTAGACCACTGAGTTGTGAGG + Intergenic
1153901100 18:9617459-9617481 CCTTAGCCCCCTGAGTAGTTGGG + Intergenic
1154086090 18:11306923-11306945 CCTCAGCCCCATGAGTAGCTAGG - Intergenic
1154531747 18:15352945-15352967 CCTTAGACTCCTGAGTAGCTTGG + Intergenic
1155363267 18:25025149-25025171 CCTCAGCCTCCTGAGTAGTGGGG + Intergenic
1155456957 18:26027554-26027576 CCTTAGCCTCATGAGTAACGAGG - Intronic
1155853449 18:30801560-30801582 CCTTAGCCTCCTGAGTAGTTGGG - Intergenic
1155972903 18:32098397-32098419 CCTGAGCCTCCTGAGTAGTGGGG + Intronic
1156271919 18:35543096-35543118 CCTTAGCCTCATGAGTAGCTGGG + Intergenic
1156611573 18:38731070-38731092 CCTCAGTCCCATGAGTAGCTGGG - Intergenic
1156912036 18:42422747-42422769 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
1157015753 18:43710904-43710926 CCTCAGCCCCCTGAGTAGTTGGG + Intergenic
1157040363 18:44031962-44031984 CCTCAGTCTCCTGAGTAGTGGGG - Intergenic
1157347747 18:46855014-46855036 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
1157630327 18:49088905-49088927 CCTTAGCCCCCTGAATAGTTGGG + Intronic
1157732698 18:50018200-50018222 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1158015174 18:52775216-52775238 CCCTAGAAGCATGAGCAGTGAGG - Intronic
1158345655 18:56513859-56513881 CCTTAGCCTCCTGAGTAGTTGGG - Intergenic
1158573282 18:58614672-58614694 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
1159104502 18:63990189-63990211 CCTCAGACCCCTGAGTAGCTGGG + Intronic
1159583880 18:70264234-70264256 CCTTAGACTCCTGAGTAGCTGGG + Intergenic
1160478344 18:79215030-79215052 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
1160593600 18:79959126-79959148 CCTCAGACCCCTGAGTAGCTGGG - Intergenic
1160597245 18:79984723-79984745 TCTTAGCCTCCTGAGTAGTGGGG + Intronic
1161798357 19:6400946-6400968 CCTTAGCCCCCTGAGTAGTTGGG + Intergenic
1162001812 19:7749442-7749464 CCTCAGCCCCCTGAGTAGTTGGG - Intergenic
1162212311 19:9102085-9102107 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
1162305560 19:9871153-9871175 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
1162414461 19:10526687-10526709 CCTCAGCCCCCTGAGTAGTTGGG + Intergenic
1162454457 19:10774883-10774905 CCTTAGTCTCCTGAGTAGTTAGG + Intronic
1162606808 19:11715363-11715385 CCTCAGACCCCTGAGTAGCTTGG + Intergenic
1162749282 19:12818635-12818657 CCTTAGACTCCTGAGTAGCTGGG + Intronic
1162759019 19:12877353-12877375 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
1162991009 19:14302167-14302189 CCTCAGCCCCCTGAGTAGTTGGG - Intergenic
1163065190 19:14787147-14787169 CCTCAGACTCCTGAGTAGCGGGG + Intergenic
1163387813 19:17010905-17010927 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1163407275 19:17130666-17130688 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
1163558233 19:18004571-18004593 CCTTAGCCCCCTGAGTAGCTGGG - Intronic
1163571732 19:18086105-18086127 CCTTAGCCCCTTGAGTAGCTGGG - Intronic
1163706399 19:18816399-18816421 CCTCAGCCTCCTGAGTAGTGGGG + Intergenic
1163715807 19:18871340-18871362 CCTCAGCCTCCTGAGTAGTGTGG + Intronic
1163757741 19:19116571-19116593 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
1164223978 19:23225488-23225510 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
1164275235 19:23711356-23711378 CCTTAGACTCCTGAGTAGCTAGG - Intergenic
1164611244 19:29633359-29633381 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
1164625899 19:29727671-29727693 CCTTAGCCCCCTGAGTAGCTGGG - Intergenic
1164628927 19:29748218-29748240 CCTTAGCCTCCTGAGTAGTTGGG - Intergenic
1165048309 19:33123967-33123989 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
1165054229 19:33163746-33163768 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1165193618 19:34083969-34083991 CCTTAGGAAAATGAGTAGTGAGG + Intergenic
1165196198 19:34105746-34105768 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
1165364100 19:35353371-35353393 CCTCAGACCCCTGAGTAGCTGGG - Exonic
1165550889 19:36584649-36584671 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1165696311 19:37903643-37903665 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1166180857 19:41107625-41107647 CCTTAGCCTCCTGAGTAGTTGGG - Intergenic
1167012012 19:46814789-46814811 CCTCAGTCCCCTGAGTAGTTGGG + Intergenic
1167024956 19:46909010-46909032 CTTTAGAGCCAAGAGTGGTGTGG + Intergenic
1167516589 19:49926973-49926995 CCTTAGCCTCATGAGTAGCTGGG + Intronic
1167909084 19:52687063-52687085 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1167946116 19:52990417-52990439 CCTTAGCCCCCTGAGTAGCTGGG - Intergenic
1168068947 19:53938230-53938252 CCTCAGACTCATGAGTAGCTGGG - Intronic
1168306016 19:55436485-55436507 CCTTAGCCCCCTGAGTAGCTGGG - Intronic
1168398044 19:56065602-56065624 CCTCAGCCTCCTGAGTAGTGGGG + Intergenic
1168661925 19:58173994-58174016 CCTAAGACTCCTGAGTAGTTGGG + Intergenic
926869827 2:17402979-17403001 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
927161933 2:20272041-20272063 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
927549123 2:23981770-23981792 CCTCAGACTCCTGAGTAGCGGGG - Intronic
927620302 2:24649177-24649199 CCTCAGACTCCTGAGTAGTTGGG + Intronic
927957842 2:27220532-27220554 CCTCAGACTCCTGAGTAGTTGGG - Intronic
928460837 2:31470990-31471012 CCTTAGGCTCCTGAGTAGTGGGG + Intergenic
928874734 2:36024670-36024692 CCTCAGCCCCCTGAGTAGTTGGG - Intergenic
928911551 2:36427083-36427105 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
928977990 2:37108683-37108705 CCTCAGCCCCCTGAGTAGTTGGG + Intronic
929160656 2:38829055-38829077 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
929936892 2:46299366-46299388 CCTCAGACCCAAGACAAGTGAGG + Intronic
930439133 2:51384752-51384774 CCTTAGGCTCCTGAGTAGTTGGG + Intergenic
931372225 2:61674108-61674130 CCTTAGCCTCCTGAGTAGTTGGG - Intergenic
933385215 2:81602062-81602084 CCTCAGACTCTTGAGTAGTTGGG + Intergenic
933676539 2:85062555-85062577 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
933884158 2:86702296-86702318 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
933889548 2:86754669-86754691 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
934043365 2:88148093-88148115 TCTTAGGCCCCTGAGTGGTGTGG - Intergenic
934667442 2:96182717-96182739 CCTCAGACCCCTGAGTAGCTGGG - Intergenic
935011911 2:99143584-99143606 CCTTAGCCCCTTGAGTAGCTGGG + Intronic
935228957 2:101079488-101079510 CCTTAGCCTCTTGAGTAGTTAGG + Intronic
935640180 2:105282709-105282731 CCTCAGACCCCTGAGTAGCTAGG - Intronic
936001095 2:108831057-108831079 CCTCAGCCCCATGAGTAGCTGGG - Intronic
936479576 2:112873460-112873482 CCTTAGCCTCATGAGTAGCTGGG + Intergenic
936554297 2:113479935-113479957 CCTCAGACTCATGAGTAGCTGGG + Intronic
936580813 2:113698938-113698960 CCTGAGAACCAGGAGTGGTGAGG + Intergenic
937035844 2:118781214-118781236 CCTCAGACTCCTGAGTAGTTGGG + Intergenic
937277981 2:120698103-120698125 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
937379197 2:121361207-121361229 CCTTAGCCCCCTGAGTAGCTGGG - Intronic
937415710 2:121712880-121712902 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
937556923 2:123169235-123169257 CCTTAGATACATGTGAAGTGGGG - Intergenic
937724883 2:125151009-125151031 CATTATACCCATGAGGAGAGTGG - Intergenic
939481989 2:142760593-142760615 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
940875739 2:158895498-158895520 CCTCAGCCTCCTGAGTAGTGGGG + Intergenic
940981918 2:160012794-160012816 CCTCAGCCCCATGAGTAGCTGGG - Intronic
940996851 2:160158981-160159003 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
941037881 2:160587423-160587445 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
941069284 2:160938299-160938321 CCTCAGCCCCCTGAGTAGCGGGG - Intergenic
941279042 2:163526994-163527016 CCTTAGCCCCCTGAGTAGCTTGG + Intergenic
941490856 2:166140581-166140603 CACTAAACACATGAGTAGTGAGG + Intergenic
941630616 2:167880067-167880089 CCTCAGACTCATGAGTAGCTAGG - Intergenic
941999045 2:171627915-171627937 CCTCAGCCTCCTGAGTAGTGAGG + Intergenic
942105409 2:172629010-172629032 CCTTAGACTCCTGAGTAGCTGGG - Intergenic
942150398 2:173070786-173070808 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
942728735 2:179040141-179040163 TCTTAGACCCATGTGCAGGGAGG + Intronic
943072395 2:183155685-183155707 CCTCAGCCTCATGAGTAGTTGGG + Intronic
943579703 2:189671134-189671156 CCTCAGACTCTTGAGTAGGGAGG - Intergenic
944098969 2:196001478-196001500 CCTCAGCCTCTTGAGTAGTGGGG + Intronic
944259948 2:197666198-197666220 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
944304206 2:198160027-198160049 CCTTAGCCTTCTGAGTAGTGGGG + Intronic
944422817 2:199549129-199549151 CCTTAGCCTCATGAGTAGCTGGG + Intergenic
944455098 2:199885051-199885073 CCTTAGCCTCCTGAGTAGCGAGG - Intergenic
944806035 2:203282151-203282173 CCTTAGCCCCCTGAGTAGCTGGG + Intronic
945219248 2:207467277-207467299 CCTCAGCCTCATGAGTAGTTGGG - Intergenic
945411605 2:209515901-209515923 CCTTAGACTCCTGAGTAGCTGGG + Intronic
945621670 2:212147104-212147126 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
946008274 2:216543937-216543959 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
946383944 2:219370183-219370205 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
946473329 2:219983140-219983162 CCTCAGACACCTGAGTAGTTAGG + Intergenic
946851075 2:223907973-223907995 CCTCAGCCTCTTGAGTAGTGGGG + Intronic
946912827 2:224484053-224484075 CCTTAGCCTCATGAGTAGCTGGG - Intronic
947730440 2:232426461-232426483 CCTTAGCCCCCTGAGTAGCTGGG - Intergenic
948972251 2:241438302-241438324 CCTTAGCCTCTTGAGTAGTTGGG - Intronic
1169161948 20:3387948-3387970 CCTTAGCCTCATGAGTAGGTGGG - Intronic
1169242782 20:3998638-3998660 CCTTAGACTCCTGAGTAGCTGGG - Intronic
1170141435 20:13128804-13128826 CCTTAGCCTCCTGAGTAGTCAGG + Intronic
1170784231 20:19453568-19453590 CCAAAGACACATGAGAAGTGGGG + Intronic
1171001531 20:21421151-21421173 CCTCAGCCTCTTGAGTAGTGAGG + Intergenic
1171300702 20:24057835-24057857 CCTTAGACTCCTGAGTAGCTGGG - Intergenic
1172135379 20:32683101-32683123 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
1172158927 20:32851200-32851222 CCTCAGCCTCGTGAGTAGTGGGG + Intergenic
1172422662 20:34830534-34830556 CCTCAGTCTCATGAGTAGTTGGG - Intergenic
1172748394 20:37231594-37231616 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1173739223 20:45385096-45385118 CCTCAGCCCCCTGAGTAGTGGGG + Intronic
1174043990 20:47720369-47720391 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1174205713 20:48836797-48836819 CCTTAGCCTCCAGAGTAGTGGGG - Intergenic
1174263171 20:49312271-49312293 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
1175283902 20:57824286-57824308 CCTTAGCCTCCTGAGTAGTCAGG + Intergenic
1176652357 21:9562654-9562676 CCTCAGACTCCTGAGTAGCGGGG - Intergenic
1176861462 21:14013548-14013570 CCATAGCCCCAGGAGTGGTGAGG + Intergenic
1177168256 21:17627238-17627260 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
1177653227 21:23984425-23984447 CCTTAGACTCTGGAGTAATGGGG - Intergenic
1177797915 21:25798455-25798477 CCTTAGACTCCTGGGTAGCGGGG + Intergenic
1178325973 21:31645867-31645889 CCTTAGCCCCCTGAGTAGCTGGG + Intergenic
1178556687 21:33597555-33597577 CCTCAGCCTCATGAGTAGTTGGG + Intronic
1178910255 21:36668249-36668271 CCTTAGCCCCCTGAGTAGCTGGG - Intergenic
1179186995 21:39092647-39092669 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
1180371415 22:12041078-12041100 CCTTAGACTCTTGAGTAGCTAGG - Intergenic
1180978009 22:19861162-19861184 CCTCAGCCTCCTGAGTAGTGGGG + Intergenic
1181376734 22:22464688-22464710 CCAAAGACCCGTGAGTATTGCGG + Intergenic
1181920698 22:26318187-26318209 CCTCAGCCTCATGAGTAGTTGGG + Intronic
1182216320 22:28721400-28721422 CCTCAGACCCCTGAGTAGCTGGG + Intronic
1182307299 22:29379235-29379257 CCTGAGACTCCTGAGTAGTTGGG - Intronic
1182313522 22:29426631-29426653 CCTTAGCCTCCTGAGTAGTTGGG - Intergenic
1182381132 22:29889400-29889422 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1182393004 22:30015160-30015182 CCTTAGCCCCCTGAGTAGCTAGG + Intronic
1182550428 22:31098041-31098063 CCTTAGCCCCATGAGAAAGGAGG + Intronic
1182632556 22:31698138-31698160 CCTTAGCCTCATGAGTAGCTGGG + Intronic
1183015795 22:34985493-34985515 CCTCAGCCCCATGAGTAGCTGGG - Intergenic
1183444138 22:37841730-37841752 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1184375742 22:44111560-44111582 CCTCAGACCCCTGAGTAGCTGGG + Intronic
1184584610 22:45439294-45439316 CCTTAGCCCCCTGAGTAGCTGGG - Intergenic
1184635193 22:45822644-45822666 CCTGAGCCCCATGAGTAGCTGGG + Intronic
1185201248 22:49506875-49506897 CCTTAGCCTCATGAGTAGCTGGG - Intronic
949983321 3:9517578-9517600 CCTTAGCCCCCTGAGTAGCTGGG - Intronic
950308317 3:11934068-11934090 CCTTAGCCCCCTGAGTAGCTGGG + Intergenic
950604097 3:14062924-14062946 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
951359227 3:21704622-21704644 CCTTAGTCACATGAGTAGCTGGG + Intronic
951364578 3:21765459-21765481 TCTGAGACCCATGACTTGTGTGG + Intronic
951578700 3:24139497-24139519 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
952012076 3:28911015-28911037 CCTCAGACTCCTGAGTAGTTGGG + Intergenic
952367821 3:32690498-32690520 CCTTAGCCTCTTGAGTAGTTAGG + Intronic
952518830 3:34133679-34133701 CCTTAGCCTCCTGAGTAGTTGGG - Intergenic
952810455 3:37397919-37397941 CCTTAGTCTCCTGAGTAGTGAGG + Intronic
953640759 3:44705365-44705387 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
953642875 3:44726140-44726162 CCTCAGACTCCTGAGTAGTTGGG - Intergenic
953742704 3:45551327-45551349 CCTTAGCCACCTGAGTAGTTGGG + Intergenic
954101263 3:48374441-48374463 CCTTAGCCCCCTGAGTAGCTGGG + Intronic
954610135 3:51940628-51940650 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
954774083 3:52999972-52999994 CCTCAGCCTCATGAGTAGTTGGG + Intronic
954832669 3:53435889-53435911 CCTTAGTCCCCTGAGTAGCTGGG - Intergenic
954844124 3:53540232-53540254 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
954908696 3:54085306-54085328 CCTTAGCCCCCTGAGTAGCTGGG + Intergenic
955565451 3:60239447-60239469 CCTTAGCCCCCTGAGTAGCTGGG - Intronic
955607816 3:60724762-60724784 CCTTAGCCTCATGAGTAGCTGGG + Intronic
955614791 3:60795628-60795650 CCTTAGCCTCTTGAGTAGTTGGG + Intronic
955729791 3:61972766-61972788 CCTTAGACTCCTGAGTAGCTGGG + Intronic
955918544 3:63930642-63930664 CCTTAGCCCCCTGAGTAGCTGGG + Intronic
956183660 3:66542453-66542475 CCTTAGTCCCCTGAGTAGCTAGG + Intergenic
956596651 3:70974411-70974433 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
956642338 3:71426943-71426965 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
956840633 3:73136637-73136659 CCTTAGACTCCTGAGTAGCTGGG - Intergenic
958425074 3:93970449-93970471 CCTTAGACCCCTGAGTAGCTGGG + Intronic
958612738 3:96448330-96448352 CCTTAGACCCCCGAGTAGCTGGG - Intergenic
958616482 3:96499589-96499611 CCTTAGACTCCTGAGTAGCTGGG - Intergenic
959182486 3:102999214-102999236 CCTTAGCCTCCTGAGTAGTTAGG + Intergenic
959271782 3:104220919-104220941 CCTCAGACTCCTGAGTAGTTGGG + Intergenic
960904992 3:122591643-122591665 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
961342337 3:126236106-126236128 CCTCAGCCCCCTGAGTAGTTGGG - Intergenic
961648703 3:128406695-128406717 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
961731989 3:128972355-128972377 CCTTAGACTCCTGAGTAGCTGGG + Intronic
962551178 3:136493537-136493559 CCTCAGCCCCCTGAGTAGTTGGG - Intronic
963105084 3:141640098-141640120 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
963281291 3:143386954-143386976 CCTTAGCCCCCTGAGTAGCTGGG + Intronic
964137451 3:153360633-153360655 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
964974594 3:162603753-162603775 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
966126727 3:176586253-176586275 CCTTAGCCTCGTAAGTAGTGAGG - Intergenic
966166996 3:177030994-177031016 CCTCAGCCCCATGAGTAGCTGGG - Intronic
966209201 3:177435200-177435222 GCTTAGCCTCCTGAGTAGTGGGG + Intergenic
966401311 3:179550324-179550346 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
966524431 3:180905540-180905562 CCTCAGACTCCTGAGTAGCGGGG + Intronic
966604297 3:181806946-181806968 CCTTAGCCTCTTGAGTAGTTTGG + Intergenic
966838660 3:184069569-184069591 CCTTAGCCTCCTGAGTAGTTGGG - Intergenic
966979972 3:185123060-185123082 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
967020685 3:185519718-185519740 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
967123639 3:186405829-186405851 CCTCAGCCTCCTGAGTAGTGGGG + Intergenic
967733972 3:192933032-192933054 CCTTAGCCACATGAGTAGCTGGG + Intergenic
967745333 3:193048720-193048742 CCTCAGACTCTTGAGTAGTTGGG + Intergenic
967959627 3:194910073-194910095 CCTCAGCCTCTTGAGTAGTGGGG + Intergenic
968012224 3:195290695-195290717 CCTTAGCCCCCTGAGTAGCTGGG - Intronic
968124816 3:196151170-196151192 CCTCAGACTCATGAGTAGCTGGG - Intergenic
968196882 3:196713719-196713741 CCTTAGCCCCCTGAGTAGCTGGG - Intronic
968244077 3:197124388-197124410 CCTTAGCCTCCCGAGTAGTGGGG + Intronic
969010535 4:4058261-4058283 CCTCAGCCTCCTGAGTAGTGTGG + Intergenic
969156055 4:5210909-5210931 CCTCAGCCCCATGAGTAGCTGGG + Intronic
969596887 4:8154395-8154417 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
969743527 4:9051635-9051657 CCTCAGCCTCCTGAGTAGTGTGG - Intergenic
969889227 4:10244198-10244220 ACTGGGACCCATGAGTAGTGAGG + Intergenic
970405660 4:15760802-15760824 CTTCAGCCTCATGAGTAGTGGGG + Intergenic
971001805 4:22332042-22332064 CCTTAGCCTCCTGAGTAGTTGGG - Intergenic
971005183 4:22365472-22365494 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
971210522 4:24611618-24611640 CCTTAGCCTCCTGAGTAGTTGGG - Intergenic
971901758 4:32669287-32669309 CTTTGGACCAATGAGTACTGAGG - Intergenic
972384648 4:38553293-38553315 CCTTAGCCTCCAGAGTAGTGGGG - Intergenic
973673386 4:53239598-53239620 CCTTAGCCTCATGAGTAGCTGGG + Intronic
974042502 4:56869524-56869546 CCTTAGCCTCCTGAGTAGTTGGG - Intergenic
974168976 4:58241548-58241570 AATTAGACCCATAAGTAATGTGG - Intergenic
974859688 4:67504704-67504726 CCTTAGACTCCTGAGTAGCTGGG - Intronic
975186096 4:71404909-71404931 CCTTAGCCTCCTGAATAGTGGGG + Intronic
975679095 4:76857863-76857885 CCTCAGCCTCATGAGTAGTTGGG - Intergenic
975742463 4:77442908-77442930 CCTCAGCCTCTTGAGTAGTGGGG + Intergenic
975853657 4:78599807-78599829 CCTTAGCCCCTTGAGTAGCTGGG - Intronic
976130755 4:81881653-81881675 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
976171954 4:82313449-82313471 CCTCAGTCTCCTGAGTAGTGGGG - Intergenic
976172798 4:82321697-82321719 CCTTAGACTCCTGAGTAGCTGGG + Intergenic
976296134 4:83474024-83474046 CCTCAGCCTCATGAGTAGTTGGG - Intronic
976538485 4:86245425-86245447 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
976564703 4:86540382-86540404 CCTCAGCCCCCTGAGTAGTTGGG - Intronic
976837872 4:89396382-89396404 CCTTATACCCATGAATTGTGAGG + Intergenic
977299808 4:95255093-95255115 CCTTAGCCTCATGAGTAGCTGGG + Intronic
977582107 4:98736444-98736466 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
978172666 4:105692366-105692388 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
978500349 4:109402637-109402659 CCTCAGACTCCTGAGTAGTTGGG - Intergenic
979534628 4:121805919-121805941 CCTCAGTCTCCTGAGTAGTGGGG + Intronic
980705355 4:136485843-136485865 CCTTAGACCCAGGACTTATGTGG + Intergenic
982005825 4:151061981-151062003 CCTCAGCCTCATGAGTAGCGGGG + Intergenic
982699912 4:158648995-158649017 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
983374958 4:166914652-166914674 CCTTAGCCTCCTGAGTAGCGGGG - Intronic
983526078 4:168761574-168761596 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
984246127 4:177276921-177276943 CCTCAGACCCTTGAGTAGCTGGG + Intergenic
984369642 4:178846474-178846496 CCTCAGCCCCCTGAGTAGCGGGG - Intergenic
984455847 4:179966837-179966859 CCCTAGCCCCCTGAGTAGTTGGG - Intergenic
984730155 4:183060666-183060688 CCTCAGCCCCTTGAGTAGTTGGG + Intergenic
984809435 4:183781870-183781892 CCTCAGCCCCCTGAGTAGTTGGG + Intergenic
984865741 4:184278964-184278986 CCTTAGCCTCCTGAGTAGTTGGG - Intergenic
984979165 4:185261290-185261312 CCTTAGCCCCCTGAGTAGCTGGG + Intronic
985188071 4:187339263-187339285 CTTCAGACTCATGAGTAGTTGGG - Intergenic
985932940 5:3073319-3073341 CCATAAACCCCTAAGTAGTGGGG - Intergenic
986182981 5:5410891-5410913 CCTCAGACTCATGAGTAGCTGGG - Intergenic
986560565 5:9056604-9056626 CCTCAGCCTCCTGAGTAGTGAGG - Intronic
987519153 5:18956532-18956554 CCTCAGCCTCCTGAGTAGTGGGG + Intergenic
987697424 5:21349999-21350021 CCTTAGACTCCTGAGTAGCTGGG - Intergenic
988559017 5:32263551-32263573 CCTTAGCCTCATGAGTAGCTGGG + Intronic
988574278 5:32404930-32404952 CCTTAGACTCCTGAGTAGCTGGG + Intronic
988842306 5:35094941-35094963 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
989280152 5:39631881-39631903 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
990316164 5:54585174-54585196 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
990421735 5:55642159-55642181 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
990454773 5:55974598-55974620 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
991350088 5:65712149-65712171 CCTTAGACTCGTGAGTAGCTGGG - Intronic
991494205 5:67211657-67211679 CCTTAGCCTCATGAGTAGCAGGG + Intergenic
991645687 5:68798586-68798608 CCTCAGTCCCCTGAGTAGTTGGG - Intergenic
992285802 5:75234410-75234432 CCTCAGCTCCCTGAGTAGTGAGG - Intronic
992710114 5:79444317-79444339 CCTTAGCCTCATGAGTAGCTGGG + Intronic
992778662 5:80109285-80109307 CCTAAGCCTCCTGAGTAGTGGGG + Intergenic
992963086 5:81974729-81974751 CCTCAGCCTCCTGAGTAGTGAGG + Intronic
993943588 5:94092228-94092250 CCTCAGACTCCTGAGTAGTTGGG - Intronic
994162791 5:96575756-96575778 CCTCAGACCCTTGAGTACTTGGG + Intronic
994796625 5:104308949-104308971 CCTCAGCCTCATGAGTAGTTGGG - Intergenic
995493151 5:112713053-112713075 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
996382807 5:122878858-122878880 CCTCAGCCTCTTGAGTAGTGGGG - Intronic
997183968 5:131862810-131862832 CCTCAGACTCCTGAGTAGTTAGG + Intronic
998255214 5:140580789-140580811 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
998355442 5:141531601-141531623 CCTCAGCCCCATGAGTAGCTGGG + Intronic
998662389 5:144254250-144254272 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
998878963 5:146628058-146628080 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
998960452 5:147480836-147480858 CCTTAGACTCCTGAGTAGCTGGG + Intronic
999010400 5:148032090-148032112 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
999134997 5:149312671-149312693 CCTTAGCCTCCTGAGTAGTGAGG - Intronic
999218066 5:149952545-149952567 CCTCAGCCTCCTGAGTAGTGGGG + Intergenic
999220654 5:149974031-149974053 CCTCAGCCTCCTGAGTAGTGAGG - Intronic
999304927 5:150513373-150513395 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
999770985 5:154775375-154775397 CCTTAGTCCCCTGAGTAGCTGGG - Intronic
999809904 5:155117881-155117903 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
1000056872 5:157614931-157614953 CCTTAGCCCCCTGAGTAGCTGGG + Intergenic
1000077188 5:157802008-157802030 CCTTAGTCTCCTGAGTAGCGGGG + Intronic
1000801306 5:165729964-165729986 CCTCAGACTCCTGAGTAGTTGGG + Intergenic
1001078119 5:168644633-168644655 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
1001496476 5:172191176-172191198 CCTGAGTCTCATGAGTAGTTGGG - Intergenic
1001505942 5:172280534-172280556 CCTCAGCCACATGAGTAGTTAGG - Intronic
1001609330 5:172987397-172987419 CCTCAGCCCCCTGAGTAGTTGGG + Intronic
1002141699 5:177145392-177145414 CTTTAGCCTCATGAGTAGTTGGG + Intronic
1002773622 6:310074-310096 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
1002962444 6:1928247-1928269 CCTCAGACTCATGAGTAGCTGGG - Intronic
1002994394 6:2269200-2269222 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
1003119615 6:3308825-3308847 CCTTAGACTCCTGAGTAGCTGGG - Intronic
1003162524 6:3648510-3648532 CCTTAGACTCCTGAGTAGCTGGG + Intergenic
1003565178 6:7216479-7216501 CCTCGGCTCCATGAGTAGTGAGG + Intronic
1003646471 6:7916665-7916687 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1003762694 6:9198522-9198544 CCTTAGCCCCCTGAGTAGCTGGG + Intergenic
1003791071 6:9548503-9548525 CCTCAGCCTCCTGAGTAGTGGGG + Intergenic
1003848684 6:10199914-10199936 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1003999634 6:11585272-11585294 CCTTAGCCCCTTGAGTAGCCGGG + Intergenic
1004076462 6:12348407-12348429 CCTTAGCCTCCTGAGTAGTTCGG + Intergenic
1004339340 6:14794640-14794662 CATTAGACCCTTGAACAGTGTGG - Intergenic
1004476766 6:15980463-15980485 CCTCAGCCCCATGAGTAGCTGGG - Intergenic
1004770610 6:18776992-18777014 CCTCAGCCCCATGAGTAGCTGGG + Intergenic
1005301765 6:24478057-24478079 CCTCAGAACCTTGATTAGTGTGG + Intronic
1005492168 6:26357105-26357127 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
1005700255 6:28393623-28393645 CCTTAGTCCCCTGAGTAGTTAGG - Intronic
1005974132 6:30784401-30784423 CCTTAGTCCCCTGAGTAGCTGGG + Intergenic
1006199652 6:32276759-32276781 TCTTATACTAATGAGTAGTGGGG + Intergenic
1006693636 6:35912081-35912103 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1006705583 6:36017514-36017536 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
1006853970 6:37119890-37119912 CCTTAGCCTCCTGAGTAGTTGGG - Intergenic
1007485897 6:42180457-42180479 CCTTAGCCTCCTGAGTATTGGGG - Intergenic
1007711531 6:43827380-43827402 CCTTAGACTCCTGAGTAGCTGGG + Intergenic
1008162151 6:48091759-48091781 CCTTAGACTCCTGAGTAGCTGGG + Intergenic
1008314486 6:50023179-50023201 CCTTGGACCCCTGAGTAGCTGGG - Intergenic
1008314877 6:50027226-50027248 CCTTAGCCCCCTGAGTAGCTGGG - Intergenic
1009421297 6:63467805-63467827 CCTCAGACCCCTGAGTAGCTGGG + Intergenic
1009548622 6:65056474-65056496 CCTTAGTCCCCTGAGTAGATAGG - Intronic
1010239127 6:73600615-73600637 CCTTAGCCTCCTGAGTAGCGGGG + Intronic
1010274449 6:73952919-73952941 CCTAAGTCCCATGAGCATTGAGG - Intergenic
1010345391 6:74804248-74804270 CCTCAGACTCCTGAGTAGCGGGG - Intergenic
1010605680 6:77887410-77887432 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1010699328 6:79023192-79023214 CCTCAGACCCCTGAGTAGCTGGG + Intronic
1011023363 6:82838832-82838854 CCTCAGACTCTTGAGTAGCGGGG + Intergenic
1011108801 6:83813556-83813578 CCTCAGCCCCTTGAGTAGTTGGG - Intergenic
1011126345 6:84012015-84012037 CCTTAGCCCCCTGAGTAGTTGGG - Intergenic
1011513778 6:88129699-88129721 CCTCAGACTCCTGAGTAGTTGGG - Intergenic
1011812692 6:91151399-91151421 CCTCAGACTCCTGAGTAGTTGGG - Intergenic
1011883150 6:92057599-92057621 CCTTAGACTCAAGAGCAGAGAGG + Intergenic
1012100172 6:95074444-95074466 CCTCAGCCTCATGAGTAGTTGGG + Intergenic
1012871472 6:104677410-104677432 CCTTAGACTCACAAGTAGTTGGG - Intergenic
1013068696 6:106708540-106708562 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
1013069028 6:106711358-106711380 CCTTAGCCCCCTGAGTAGCTGGG + Intergenic
1013506367 6:110804456-110804478 CCTCAGACCCCTGAGTAGCTGGG + Intronic
1014699271 6:124663313-124663335 CCTTAGCCTCCTGAGTAGCGGGG - Intronic
1015037313 6:128671818-128671840 CCTCAGCCTCCTGAGTAGTGAGG + Intergenic
1015688178 6:135889866-135889888 CCTCAGACTCCTGAGTAGTTGGG + Intronic
1015760049 6:136649083-136649105 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
1016256444 6:142111122-142111144 CCTCAGACTCCTGAGTAGTTGGG - Intergenic
1017663322 6:156695093-156695115 CCTCAGCCTCCTGAGTAGTGAGG - Intergenic
1017692926 6:156984801-156984823 CCTCAGCCTCATGAGTAGTTGGG + Intronic
1017721845 6:157248881-157248903 CCTTAGCCTCATGAGTAGCTGGG + Intergenic
1018250911 6:161869261-161869283 CCTCAGACTCATGAGTAGCTGGG - Intronic
1018568095 6:165178485-165178507 CCTGAGAACCAGGAGTACTGAGG - Intergenic
1018912218 6:168108387-168108409 CCTTGGACACATGAGGAGGGCGG - Intergenic
1019066078 6:169299158-169299180 CCTTAGAACCAGGAGTGCTGAGG + Intergenic
1019743440 7:2687209-2687231 CCTCAGCCGCCTGAGTAGTGGGG - Intronic
1019930301 7:4218275-4218297 CCTTAGCCTCATGAGTAGCTGGG - Intronic
1019951198 7:4374196-4374218 CCTTAGACCCCCAAGTAGTTGGG - Intergenic
1020021064 7:4869246-4869268 CCTTAGCCCCCTGAGTAGCTGGG + Intronic
1020051334 7:5083938-5083960 CCTCAGCCTCCTGAGTAGTGGGG + Intergenic
1020103411 7:5408181-5408203 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
1020160523 7:5767712-5767734 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
1020372457 7:7447326-7447348 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1020655260 7:10921627-10921649 CATAAGCCACATGAGTAGTGAGG + Intergenic
1020680187 7:11227345-11227367 CCTAACACCCATGAATATTGAGG - Intergenic
1021469954 7:20990667-20990689 CCTTAGCCTCCTGAGTAGCGGGG - Intergenic
1021672811 7:23049133-23049155 CCTCAGACCCCTGAGTAGCTGGG + Intergenic
1021751513 7:23805597-23805619 CCTTAGCCCCCTGAGTAGCTGGG + Intronic
1022191069 7:28017233-28017255 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1022401168 7:30039397-30039419 CCTTAGCCTCCTGAGTAGTGGGG - Intronic
1022451147 7:30516565-30516587 CCTTAGGCCCCTGAGTAGCTGGG - Intronic
1022732856 7:33046917-33046939 CCTTAGCCTCTGGAGTAGTGGGG + Intronic
1023394982 7:39744210-39744232 CCTCAGCCTCATGAGTAGTTGGG + Intergenic
1023402265 7:39798827-39798849 CCTCAGCCCCCTGAGTAGTTGGG + Intergenic
1023449572 7:40268752-40268774 CCTCAGACTCCTGAGTAGTTGGG + Intronic
1023772413 7:43570028-43570050 CCTTAGCCTCCTGAGTAGTTGGG - Intergenic
1023857201 7:44191914-44191936 CCTCAGACCCACGAGTAGCTGGG + Intronic
1023958016 7:44903273-44903295 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
1024289172 7:47788404-47788426 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
1024647357 7:51381838-51381860 CCTCAGCCCCCTGAGTAGTTGGG - Intergenic
1024780877 7:52846891-52846913 TCTTATACCAATGAGTAATGAGG - Intergenic
1025051192 7:55736344-55736366 CCTCAGCCCCCTGAGTAGTTGGG - Intergenic
1025607538 7:63050150-63050172 CCTTAGCCCCCTGAGTAGCTGGG - Intergenic
1025746434 7:64246870-64246892 CCTTAGACACAGCAGCAGTGTGG + Intronic
1025904384 7:65772118-65772140 CCTCAGACTCTTAAGTAGTGGGG - Intergenic
1025953500 7:66164694-66164716 CCTTAGCCCCCTGAGTAGCTGGG - Intergenic
1026666247 7:72342142-72342164 CCTTAGCCTCCTGAGTAGTTAGG - Intronic
1026788703 7:73318242-73318264 CCTCAGCCTCATGAGTAGCGGGG + Intronic
1026872338 7:73860752-73860774 CTTTAGACTCCTGAGTAGTTGGG + Intergenic
1027245310 7:76363103-76363125 CCTCAGCCTCCTGAGTAGTGGGG + Intergenic
1027408631 7:77889704-77889726 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
1027962713 7:84967441-84967463 CCTTAGGCCCCTGAGTAGTTGGG + Intergenic
1028182532 7:87742996-87743018 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
1028562663 7:92192775-92192797 CCTCAGCCTCATGAGTAGTTGGG + Intergenic
1028978679 7:96942511-96942533 CCTCAGACTCCTGAGTAGTTAGG - Intergenic
1029069819 7:97886261-97886283 CCTCAGCCTCCTGAGTAGTGTGG + Intergenic
1029138853 7:98395321-98395343 CCTCAGACTCCTGAGTAGTTGGG - Intronic
1029150909 7:98479821-98479843 CCTCAGCCCCCTGAGTAGTTGGG + Intergenic
1029181751 7:98706996-98707018 CCTCAGACCCCTGAGTAGCTGGG + Intergenic
1029188085 7:98753756-98753778 CCTTAGCCTCTTGAGTAGTTGGG + Intergenic
1029303998 7:99605542-99605564 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1029447515 7:100622139-100622161 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1029519991 7:101053942-101053964 CCTCAGCCTCATGAGTAGTTGGG - Intronic
1029562987 7:101316112-101316134 CCTTAGCCCCCTGAGTAGCTGGG + Intronic
1029728391 7:102423790-102423812 CCTCAGCCTCATGAGTAGCGAGG + Intronic
1029870896 7:103691695-103691717 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1030135183 7:106239937-106239959 CCTCAGCCTCCTGAGTAGTGAGG + Intergenic
1030467972 7:109926096-109926118 CCTCAGCCCCATGAGTAGCTGGG + Intergenic
1032052774 7:128659208-128659230 CCTCAGCCCCCTGAGTAGTTGGG + Intergenic
1032599648 7:133279632-133279654 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1032773867 7:135090176-135090198 CTTTAGACCCTGGAATAGTGAGG + Intronic
1032826592 7:135575677-135575699 CCTTAGCCTCCTGAGTAGTTAGG - Intronic
1032997523 7:137464447-137464469 CATCAGACCCATCAGTAGTGGGG - Intronic
1034128198 7:148692929-148692951 CTTTAGCCTCCTGAGTAGTGGGG - Intergenic
1034291862 7:149939094-149939116 CCTCAGACTCCTGAGTAGTTGGG + Intergenic
1034784195 7:153910343-153910365 CCTCAGACCCCTGAGTAGCTGGG + Intronic
1034814220 7:154157815-154157837 CCTCAGACTCCTGAGTAGTTGGG - Intronic
1035882347 8:3256209-3256231 CCTCAGCCCCCTGAGTAGTTGGG - Intronic
1036252065 8:7170920-7170942 CCTCAGCCTCCTGAGTAGTGTGG + Intergenic
1036365425 8:8116541-8116563 CCTCAGCCTCCTGAGTAGTGTGG - Intergenic
1036476187 8:9095634-9095656 CCTTAGACTCCTGAGTAGCTGGG + Intronic
1036523597 8:9514962-9514984 CCTCAGCTCCATGAGTAGTTGGG + Intergenic
1036885518 8:12549575-12549597 CCTCAGCCTCCTGAGTAGTGTGG + Intergenic
1036976983 8:13424686-13424708 CCTTAGCCCCCTGAGTAGCTTGG + Intronic
1037055870 8:14441457-14441479 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1037363260 8:18096105-18096127 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
1037475186 8:19250115-19250137 CCTCAGCCCCATGAGTAGCTGGG - Intergenic
1037633343 8:20677910-20677932 CCTCAGCCCCCTGAGTAGTTGGG - Intergenic
1037698364 8:21248500-21248522 CCTTAGACTGAGGAGTGGTGAGG - Intergenic
1038162081 8:25049405-25049427 CCTCAGCCTCATGAGTAGTTGGG - Intergenic
1038616490 8:29100557-29100579 CCTTAGACTCCTGAGTAGTTCGG + Intronic
1039038487 8:33384703-33384725 CCTTAGCCTCCTGAGTAGTTAGG - Intronic
1039065847 8:33606829-33606851 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
1039264873 8:35813819-35813841 CCTTAGACTCCTGAGTAGCTGGG - Intergenic
1039485792 8:37908767-37908789 CCTTAGACTCCTGAGTAGCTGGG - Intergenic
1039981784 8:42414527-42414549 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
1040047250 8:42976392-42976414 CCTTAGTCTCCTGAGTAGTTGGG - Intronic
1040053221 8:43035614-43035636 CCTTAGCCTCCTGAGTAGTTAGG + Intronic
1040424915 8:47275970-47275992 CCTCAGACCCCTGAGTAGCTGGG + Intronic
1040829281 8:51660003-51660025 CCTTAGCCCCCTGAGTAGCTGGG + Intronic
1041065513 8:54079091-54079113 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1041462363 8:58125230-58125252 CCTTAGCCCCTTGAGTAGCTGGG - Intronic
1042381105 8:68115141-68115163 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1042517549 8:69675288-69675310 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1042697937 8:71578847-71578869 CCTTAGCCCAATGAGTAGCTGGG + Intronic
1043012013 8:74892916-74892938 CCTTAGCCTCCTGAGTAGTTGGG - Intergenic
1043393387 8:79812701-79812723 CCTCAGACCCCTGAGTAGATGGG - Intergenic
1043418137 8:80072190-80072212 CCTCAGCCTCATGAGTAGTTGGG - Intronic
1043959905 8:86405645-86405667 CCTTAGCCCCCTGAATAGTTGGG + Intronic
1044282032 8:90367564-90367586 CCTTAGCCTCATGAGTAGCTGGG + Intergenic
1044655601 8:94545007-94545029 CCTCAGCCCCCTGAGTAGTTAGG - Intronic
1045007862 8:97931816-97931838 CCTTAGCCTCATGAGTAGCTGGG + Intronic
1045986037 8:108250842-108250864 CCTTAGACTCCTGAGTAGCTGGG + Intronic
1046194586 8:110843510-110843532 CCTCAGTCTCCTGAGTAGTGGGG + Intergenic
1046315782 8:112499991-112500013 CCTCAGCCCCCTGAGTAGTTGGG - Intronic
1046794684 8:118358027-118358049 CCTTAGCCCCTTGAGTAGCTGGG - Intronic
1047321250 8:123785931-123785953 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
1047640853 8:126820570-126820592 CCCTAGAGGTATGAGTAGTGGGG - Intergenic
1048551162 8:135434778-135434800 CCTTAGACCCCTGAGTAGCTGGG + Intergenic
1048738130 8:137524488-137524510 CCTTAGTCTCCTGAGTAGTTGGG - Intergenic
1049226805 8:141457045-141457067 CCTTAGCCTCATGAGTAGCTAGG - Intergenic
1049559454 8:143301720-143301742 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
1049860036 8:144891907-144891929 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1049898710 9:137243-137265 CCTCAGACTCATGAGTAGCTGGG - Intronic
1050138041 9:2488538-2488560 CCTTAGCCTCCTGAGTAGTTGGG - Intergenic
1050145551 9:2563401-2563423 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
1050302440 9:4273475-4273497 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
1050548396 9:6728416-6728438 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
1050879596 9:10682187-10682209 CATTAGATCCATGAATAGAGTGG + Intergenic
1051541140 9:18219482-18219504 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
1051793082 9:20830790-20830812 CCTTAGACTCCTGAGTAGCTGGG + Intronic
1052952236 9:34222011-34222033 CCTTAGCCCCCTGAGTAGCTGGG - Intronic
1053023452 9:34711360-34711382 CCTCAGTCTCCTGAGTAGTGGGG + Intergenic
1053267783 9:36728343-36728365 CCTTAGACTCCTGAGTAGCTGGG + Intergenic
1053741760 9:41147555-41147577 CCTCAGACTCATGAGTAGCTGGG - Intronic
1054347024 9:63977365-63977387 CCTCAGACTCATGAGTAGCTGGG - Intergenic
1054444754 9:65303702-65303724 CCTCAGACTCATGAGTAGCTGGG - Intergenic
1054485517 9:65717801-65717823 CCTCAGACTCATGAGTAGCTGGG + Intronic
1054686581 9:68283745-68283767 CCTCAGACTCATGAGTAGCTGGG + Intronic
1055136227 9:72832069-72832091 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
1055564552 9:77555386-77555408 CCTTAGCCTCATGAGTAGCTGGG - Intronic
1055635636 9:78275487-78275509 CCTCAGACTCCTGAGTAGTTGGG - Intronic
1055874244 9:80923301-80923323 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
1056121150 9:83490402-83490424 CCTTAGCCTCCTGAGTAGTTGGG + Intronic
1056287000 9:85098582-85098604 CCTCAGACCCCTGAGTAGCTGGG + Intergenic
1056333874 9:85546242-85546264 CCTCAGACTCCTGAGTAGTTGGG + Intergenic
1056961614 9:91129742-91129764 CCTCAGACTCCTGAGTAGTTGGG - Intergenic
1057007909 9:91576810-91576832 CCTCAGCCCCCTGAGTAGTTGGG + Intronic
1057074514 9:92130415-92130437 CCTCAGCCTCCTGAGTAGTGGGG + Intergenic
1057357181 9:94341254-94341276 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
1057650570 9:96916372-96916394 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1057763983 9:97899776-97899798 CCTCAGCCTCTTGAGTAGTGGGG - Intergenic
1058439608 9:104994632-104994654 CCTTAGTCTCCTGAGTAGTTGGG + Intergenic
1058471783 9:105286846-105286868 CCTTAGCCTCCTGAGTAGTTAGG - Intronic
1058694782 9:107549995-107550017 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
1059202345 9:112429965-112429987 CCTCAGCCCCCTGAGTAGTTGGG - Intronic
1059255461 9:112926707-112926729 CCTCAGGCTCCTGAGTAGTGGGG + Intergenic
1059300528 9:113308904-113308926 CCTTAGACCCCTGAGTAGCTGGG - Intergenic
1059487665 9:114639249-114639271 CCTTAGTCTCCTGAGTAGTTGGG + Intronic
1060233546 9:121843258-121843280 TCTAAGATCCATGAGTACTGAGG + Intronic
1060355398 9:122902734-122902756 CCTCAGACTCCTGAGTAGTTGGG - Intronic
1060506776 9:124203724-124203746 CCTTAGCCTCATGAGTAGCTAGG + Intergenic
1060901239 9:127259915-127259937 CCTTAGCCCCTTGAGTAGATGGG - Intronic
1061152107 9:128834714-128834736 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1061316324 9:129798437-129798459 CCTTAGCCCCCCGAGTAGTTGGG + Intergenic
1061557137 9:131377869-131377891 CCTTAGCCTCCTGAGTAGTTGGG + Intergenic
1061600451 9:131666500-131666522 CCTTAGCCTCCTGAGTAGCGGGG + Intronic
1203630085 Un_KI270750v1:66200-66222 CCTCAGACTCCTGAGTAGCGGGG - Intergenic
1185513520 X:680744-680766 CCTCAGCCTCCTGAGTAGTGGGG + Intergenic
1185807061 X:3067741-3067763 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
1186271150 X:7889739-7889761 CCTTAGACTCCTGAGTAGCTAGG + Intergenic
1186468459 X:9803042-9803064 CCTTAGCCCCCTGAGTAGCTGGG + Intronic
1186947359 X:14583621-14583643 CCTTAGCCTCCTGAGTAGTTGGG - Intronic
1186960201 X:14728275-14728297 CCTCAGACCCCTGAGTAGCTGGG - Intronic
1187457298 X:19453382-19453404 CCTTAGCCCCCTGAGTAGCTGGG - Intronic
1188546081 X:31308843-31308865 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
1189067927 X:37831165-37831187 CCTCAGCCTCCTGAGTAGTGGGG - Intronic
1189323747 X:40100999-40101021 CCTAAGAGGCATGAGTGGTGGGG + Intronic
1189441187 X:41037638-41037660 CCTCAGCCTCCTGAGTAGTGGGG - Intergenic
1190662620 X:52668872-52668894 CCTTAGTCCCTTGAGTAGCTGGG + Intronic
1190699620 X:52977550-52977572 CCTCAGACCCCTGAGTAGCTGGG + Intronic
1190868862 X:54408055-54408077 CCTTAGCCTCCTGAGTAGTTGGG - Intergenic
1192367126 X:70483166-70483188 CCTTAGCCCCCTGAGTAGCTGGG - Intronic
1192959288 X:76110317-76110339 CCTCAGCCTCATGAGTAGTTGGG - Intergenic
1193364261 X:80611997-80612019 CCTCAGCCCCATGAGTAGTTTGG - Intergenic
1193667733 X:84343368-84343390 CCTTAGACTCCTGAGTAGATGGG + Intronic
1194356476 X:92890863-92890885 CCTCAGACTCCTGAGTAGTTGGG - Intergenic
1194780571 X:98020853-98020875 CCTTAGTCCCCTGAGTAGCTAGG + Intergenic
1196012600 X:110904598-110904620 CCTCAGCCTCATGAGTAGTTGGG + Intergenic
1197328344 X:125121956-125121978 CCTCAGCCCCAAGAGTAGTTGGG - Intergenic
1197720722 X:129742784-129742806 CCTTAGCCTCCTGAGTAGCGGGG - Intronic
1197724084 X:129764537-129764559 CCTCAGCCCCATGAGTAGCTGGG - Intronic
1198866395 X:141127907-141127929 CCTCAGACCCCCGAGTAGTTGGG - Intergenic
1199199148 X:145066868-145066890 CCTTAGCCTCATGAGTAGCTGGG + Intergenic
1199413972 X:147558431-147558453 CCTAAGATCCATGAGAGGTGAGG + Intergenic
1199517541 X:148694929-148694951 CCTCAGCCTCCTGAGTAGTGGGG + Intronic
1200087406 X:153614414-153614436 CCTTAGCCCCCTGAGTAGCTGGG + Intergenic
1200664815 Y:6007863-6007885 CCTCAGACTCCTGAGTAGTTGGG - Intergenic
1201355896 Y:13096799-13096821 CCTCAGTCTCCTGAGTAGTGGGG - Intergenic
1201549803 Y:15207865-15207887 CCTCAGCCTCATGAGTAGTTGGG - Intergenic
1201769043 Y:17599950-17599972 CCTCAGCCCCATGAGTAGCTGGG - Intergenic
1201832511 Y:18306035-18306057 CCTCAGCCCCATGAGTAGCTGGG + Intergenic
1202084131 Y:21118056-21118078 CCTTAGAGATATGAGCAGTGGGG - Intergenic