ID: 1148013387

View in Genome Browser
Species Human (GRCh38)
Location 17:44503572-44503594
Sequence TCCGGGTCGCGCGCGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148013387_1148013391 -10 Left 1148013387 17:44503572-44503594 CCCTGCTCCGCGCGCGACCCGGA No data
Right 1148013391 17:44503585-44503607 GCGACCCGGAGCGACCCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148013387 Original CRISPR TCCGGGTCGCGCGCGGAGCA GGG (reversed) Intergenic