ID: 1148013387 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:44503572-44503594 |
Sequence | TCCGGGTCGCGCGCGGAGCA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1148013387_1148013391 | -10 | Left | 1148013387 | 17:44503572-44503594 | CCCTGCTCCGCGCGCGACCCGGA | No data | ||
Right | 1148013391 | 17:44503585-44503607 | GCGACCCGGAGCGACCCCGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1148013387 | Original CRISPR | TCCGGGTCGCGCGCGGAGCA GGG (reversed) | Intergenic | ||