ID: 1148015676

View in Genome Browser
Species Human (GRCh38)
Location 17:44520436-44520458
Sequence AAACACTGCTTTAAAAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148015676_1148015677 0 Left 1148015676 17:44520436-44520458 CCAAACTTTTTAAAGCAGTGTTT No data
Right 1148015677 17:44520459-44520481 TGTTTGTTTGTTTTTGAGACAGG No data
1148015676_1148015679 20 Left 1148015676 17:44520436-44520458 CCAAACTTTTTAAAGCAGTGTTT No data
Right 1148015679 17:44520479-44520501 AGGGTCTTCCTCTGTCACCCAGG No data
1148015676_1148015678 1 Left 1148015676 17:44520436-44520458 CCAAACTTTTTAAAGCAGTGTTT No data
Right 1148015678 17:44520460-44520482 GTTTGTTTGTTTTTGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148015676 Original CRISPR AAACACTGCTTTAAAAAGTT TGG (reversed) Intergenic