ID: 1148015678

View in Genome Browser
Species Human (GRCh38)
Location 17:44520460-44520482
Sequence GTTTGTTTGTTTTTGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148015676_1148015678 1 Left 1148015676 17:44520436-44520458 CCAAACTTTTTAAAGCAGTGTTT No data
Right 1148015678 17:44520460-44520482 GTTTGTTTGTTTTTGAGACAGGG No data
1148015675_1148015678 30 Left 1148015675 17:44520407-44520429 CCTAAACACATTAAGTGTTATTC No data
Right 1148015678 17:44520460-44520482 GTTTGTTTGTTTTTGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148015678 Original CRISPR GTTTGTTTGTTTTTGAGACA GGG Intergenic