ID: 1148018076

View in Genome Browser
Species Human (GRCh38)
Location 17:44536573-44536595
Sequence GGACAGAGGGAGAATGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148018076_1148018079 -6 Left 1148018076 17:44536573-44536595 CCTGGCTCATTCTCCCTCTGTCC No data
Right 1148018079 17:44536590-44536612 CTGTCCTCATTTCCTTGCTCTGG No data
1148018076_1148018084 2 Left 1148018076 17:44536573-44536595 CCTGGCTCATTCTCCCTCTGTCC No data
Right 1148018084 17:44536598-44536620 ATTTCCTTGCTCTGGAGGGGAGG No data
1148018076_1148018083 -1 Left 1148018076 17:44536573-44536595 CCTGGCTCATTCTCCCTCTGTCC No data
Right 1148018083 17:44536595-44536617 CTCATTTCCTTGCTCTGGAGGGG No data
1148018076_1148018088 25 Left 1148018076 17:44536573-44536595 CCTGGCTCATTCTCCCTCTGTCC No data
Right 1148018088 17:44536621-44536643 GTGGTGAACAATCTTCTCAGAGG No data
1148018076_1148018085 3 Left 1148018076 17:44536573-44536595 CCTGGCTCATTCTCCCTCTGTCC No data
Right 1148018085 17:44536599-44536621 TTTCCTTGCTCTGGAGGGGAGGG No data
1148018076_1148018089 28 Left 1148018076 17:44536573-44536595 CCTGGCTCATTCTCCCTCTGTCC No data
Right 1148018089 17:44536624-44536646 GTGAACAATCTTCTCAGAGGAGG No data
1148018076_1148018087 6 Left 1148018076 17:44536573-44536595 CCTGGCTCATTCTCCCTCTGTCC No data
Right 1148018087 17:44536602-44536624 CCTTGCTCTGGAGGGGAGGGTGG No data
1148018076_1148018080 -3 Left 1148018076 17:44536573-44536595 CCTGGCTCATTCTCCCTCTGTCC No data
Right 1148018080 17:44536593-44536615 TCCTCATTTCCTTGCTCTGGAGG No data
1148018076_1148018082 -2 Left 1148018076 17:44536573-44536595 CCTGGCTCATTCTCCCTCTGTCC No data
Right 1148018082 17:44536594-44536616 CCTCATTTCCTTGCTCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148018076 Original CRISPR GGACAGAGGGAGAATGAGCC AGG (reversed) Intergenic
No off target data available for this crispr