ID: 1148018388

View in Genome Browser
Species Human (GRCh38)
Location 17:44538461-44538483
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148018388_1148018397 14 Left 1148018388 17:44538461-44538483 CCCCTCACCAGCAGCATACCAGC No data
Right 1148018397 17:44538498-44538520 TCCTCCATAAAAGCCACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148018388 Original CRISPR GCTGGTATGCTGCTGGTGAG GGG (reversed) Intergenic
No off target data available for this crispr