ID: 1148018650

View in Genome Browser
Species Human (GRCh38)
Location 17:44539632-44539654
Sequence AAGTGGGAAAGGAGGAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148018634_1148018650 20 Left 1148018634 17:44539589-44539611 CCCAGTGATCCAAAAGCTACGCC No data
Right 1148018650 17:44539632-44539654 AAGTGGGAAAGGAGGAGGGAAGG No data
1148018633_1148018650 23 Left 1148018633 17:44539586-44539608 CCTCCCAGTGATCCAAAAGCTAC No data
Right 1148018650 17:44539632-44539654 AAGTGGGAAAGGAGGAGGGAAGG No data
1148018635_1148018650 19 Left 1148018635 17:44539590-44539612 CCAGTGATCCAAAAGCTACGCCT No data
Right 1148018650 17:44539632-44539654 AAGTGGGAAAGGAGGAGGGAAGG No data
1148018637_1148018650 11 Left 1148018637 17:44539598-44539620 CCAAAAGCTACGCCTGATTTGGA No data
Right 1148018650 17:44539632-44539654 AAGTGGGAAAGGAGGAGGGAAGG No data
1148018631_1148018650 25 Left 1148018631 17:44539584-44539606 CCCCTCCCAGTGATCCAAAAGCT No data
Right 1148018650 17:44539632-44539654 AAGTGGGAAAGGAGGAGGGAAGG No data
1148018632_1148018650 24 Left 1148018632 17:44539585-44539607 CCCTCCCAGTGATCCAAAAGCTA No data
Right 1148018650 17:44539632-44539654 AAGTGGGAAAGGAGGAGGGAAGG No data
1148018643_1148018650 -1 Left 1148018643 17:44539610-44539632 CCTGATTTGGAGAGGGGGTGGCA No data
Right 1148018650 17:44539632-44539654 AAGTGGGAAAGGAGGAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148018650 Original CRISPR AAGTGGGAAAGGAGGAGGGA AGG Intergenic
No off target data available for this crispr