ID: 1148019202

View in Genome Browser
Species Human (GRCh38)
Location 17:44542317-44542339
Sequence CTAGGGGGACAGTGGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148019189_1148019202 9 Left 1148019189 17:44542285-44542307 CCCCAGACTGGGTCCAGGTGAGA No data
Right 1148019202 17:44542317-44542339 CTAGGGGGACAGTGGGCAGAAGG No data
1148019190_1148019202 8 Left 1148019190 17:44542286-44542308 CCCAGACTGGGTCCAGGTGAGAG No data
Right 1148019202 17:44542317-44542339 CTAGGGGGACAGTGGGCAGAAGG No data
1148019195_1148019202 -4 Left 1148019195 17:44542298-44542320 CCAGGTGAGAGGAGGGATGCTAG No data
Right 1148019202 17:44542317-44542339 CTAGGGGGACAGTGGGCAGAAGG No data
1148019191_1148019202 7 Left 1148019191 17:44542287-44542309 CCAGACTGGGTCCAGGTGAGAGG No data
Right 1148019202 17:44542317-44542339 CTAGGGGGACAGTGGGCAGAAGG No data
1148019185_1148019202 30 Left 1148019185 17:44542264-44542286 CCTGGCTGACTCACATCAAAGCC No data
Right 1148019202 17:44542317-44542339 CTAGGGGGACAGTGGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148019202 Original CRISPR CTAGGGGGACAGTGGGCAGA AGG Intergenic
No off target data available for this crispr