ID: 1148020490

View in Genome Browser
Species Human (GRCh38)
Location 17:44549969-44549991
Sequence CTGTGACGGGGGAAGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148020483_1148020490 1 Left 1148020483 17:44549945-44549967 CCTGGACATGTGTGATTACCTAA No data
Right 1148020490 17:44549969-44549991 CTGTGACGGGGGAAGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148020490 Original CRISPR CTGTGACGGGGGAAGGTGAA AGG Intergenic
No off target data available for this crispr