ID: 1148020777

View in Genome Browser
Species Human (GRCh38)
Location 17:44551943-44551965
Sequence CTAAGATCACCTAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148020777_1148020781 2 Left 1148020777 17:44551943-44551965 CCATCTTCCCTAGGTGATCTTAG No data
Right 1148020781 17:44551968-44551990 ATGCTCATACCATCAGACATAGG No data
1148020777_1148020782 9 Left 1148020777 17:44551943-44551965 CCATCTTCCCTAGGTGATCTTAG No data
Right 1148020782 17:44551975-44551997 TACCATCAGACATAGGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148020777 Original CRISPR CTAAGATCACCTAGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr