ID: 1148020851

View in Genome Browser
Species Human (GRCh38)
Location 17:44552511-44552533
Sequence GGGGTGAAATAGATGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148020851_1148020860 12 Left 1148020851 17:44552511-44552533 CCCTACTCCATCTATTTCACCCC No data
Right 1148020860 17:44552546-44552568 CACACAATGTTCCCTCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148020851 Original CRISPR GGGGTGAAATAGATGGAGTA GGG (reversed) Intergenic
No off target data available for this crispr