ID: 1148023364

View in Genome Browser
Species Human (GRCh38)
Location 17:44568314-44568336
Sequence GCCAGCCAGCCCGCAAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148023361_1148023364 -7 Left 1148023361 17:44568298-44568320 CCCCGCACTCGTAGCGGCCAGCC No data
Right 1148023364 17:44568314-44568336 GCCAGCCAGCCCGCAAGCCCCGG No data
1148023363_1148023364 -9 Left 1148023363 17:44568300-44568322 CCGCACTCGTAGCGGCCAGCCAG No data
Right 1148023364 17:44568314-44568336 GCCAGCCAGCCCGCAAGCCCCGG No data
1148023354_1148023364 29 Left 1148023354 17:44568262-44568284 CCAGCGCGAGTTCTGGGTGGGCG 0: 27
1: 184
2: 401
3: 860
4: 627
Right 1148023364 17:44568314-44568336 GCCAGCCAGCCCGCAAGCCCCGG No data
1148023362_1148023364 -8 Left 1148023362 17:44568299-44568321 CCCGCACTCGTAGCGGCCAGCCA No data
Right 1148023364 17:44568314-44568336 GCCAGCCAGCCCGCAAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148023364 Original CRISPR GCCAGCCAGCCCGCAAGCCC CGG Intergenic
No off target data available for this crispr