ID: 1148026372

View in Genome Browser
Species Human (GRCh38)
Location 17:44591713-44591735
Sequence GGGTAGAGATTCAGGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148026372_1148026378 10 Left 1148026372 17:44591713-44591735 CCTTCCTGCCTGAATCTCTACCC No data
Right 1148026378 17:44591746-44591768 ATCAAGCCCCTTTCTTCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148026372 Original CRISPR GGGTAGAGATTCAGGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr