ID: 1148028467

View in Genome Browser
Species Human (GRCh38)
Location 17:44604319-44604341
Sequence TTGTGTTTAGGGAGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148028451_1148028467 13 Left 1148028451 17:44604283-44604305 CCCACCATGTGCTTAGCCCCTAA No data
Right 1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG No data
1148028450_1148028467 18 Left 1148028450 17:44604278-44604300 CCATGCCCACCATGTGCTTAGCC No data
Right 1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG No data
1148028453_1148028467 9 Left 1148028453 17:44604287-44604309 CCATGTGCTTAGCCCCTAACAGC No data
Right 1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG No data
1148028452_1148028467 12 Left 1148028452 17:44604284-44604306 CCACCATGTGCTTAGCCCCTAAC No data
Right 1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG No data
1148028459_1148028467 -4 Left 1148028459 17:44604300-44604322 CCCTAACAGCTGGGGTGGCTTGT No data
Right 1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG No data
1148028460_1148028467 -5 Left 1148028460 17:44604301-44604323 CCTAACAGCTGGGGTGGCTTGTG No data
Right 1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG No data
1148028449_1148028467 24 Left 1148028449 17:44604272-44604294 CCTCTGCCATGCCCACCATGTGC No data
Right 1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG No data
1148028448_1148028467 25 Left 1148028448 17:44604271-44604293 CCCTCTGCCATGCCCACCATGTG No data
Right 1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG No data
1148028458_1148028467 -3 Left 1148028458 17:44604299-44604321 CCCCTAACAGCTGGGGTGGCTTG No data
Right 1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG No data
1148028447_1148028467 30 Left 1148028447 17:44604266-44604288 CCTGGCCCTCTGCCATGCCCACC No data
Right 1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148028467 Original CRISPR TTGTGTTTAGGGAGGGGAGA GGG Intergenic
No off target data available for this crispr